Algae - Science topic

Hi! I found these organisms on a woman's stockings, by rinsing the fragments with serum, and I suspect their presence is the result of friction with a wall covered with mold and/or algae. These are relevant in a forensic case. I think the first 2 represent a fungus, and the last 2 pictures are some unicellular algae. Does someone have a more specific idea of what kind of organisms are in these photos?

I need to know how the colored proteins react with BCA to give the appropriate color which is to be read by the spectrophotometer? I mean I have worked with colorless proteins up till now. How to go about with these colored protein estimation?

in order to be able to make a characterization NMR?

NA

I collected these from a late Miocene lake deposit. The pictures are taken from thin sections with a monocular microscope. Any help super appreciated!

Thanks, John

Can anyone help me and recommend a specialist algae doctor to conduct research??

for animal nutrition/ruminant.goat kids

Hai everyone....

I have a medium with added Na2CO3 for algal growth...after somedays algal cells will utilize the Carbonate for its growth...i need to find out how much carbonate ion is consumed by algae after 15 days of growth...Any one kindly tell me the titration procedure for this...

Algae interact with bacteria in multiple ways, ranging from endosymbiosis, ectobiotic symbiosis (in phycosphere, attached on seaweed surface as epiphytes), and non-physically associated but functionally interactive via metabolites. The underlying genomic mechanisms, i.e. how the two partners express their genomes to establish and maintain the relationships, do not seem to be well studied. Any ideas about which genomes have been analyzed in the context of symbiosis with microbes and what the major findings are would be appreciated.

Dear colleagues

We are having a lot of difficulties removing green algae from a duckweed taken from a pond. We tried several attempts with sodium hypochlorite at different concentrations until the wild duckweed borders turned white. Also, we tried covering the growth flask with aluminum foil, and this prevented the algae growth, but after removing this cover, we noticed that the algae were still there, and it started increasing again...

I would appreciate it if you have any suggestions or recommendations.

Thanks in advance

What specific natural plant nutrient sources or plant growth-promoting sources, such as BIOSTIMULANTS, BIOFERTILIZERS, etc., would you use for starting cultivating tropical crops like corn, sorghum, millet, peanuts, tomatoes, and onions in a middle scale production in a tropical country as Simbabwe, where chemical fertilizers are economically not afordable or either unavailable, but where some animal dung is accessible?

How economically successful is it which commercially available mycorrhiza to use or other microorganisms of the soil microbiome with similar benefits such as PGPR (plant growth-promoting rhizobacteria), PGPF (plant growth promoting fungi), PGPM (plant-growth-promoting microorganisms), as well to use seaweed, algae stimulants or verimcompost?

For biofuel production from microalgae

The size differ little bit from one species to another, yet they have one size range. Also, the size of them in their native form so they don't lose their colour while isolation.

the best culture medium or media?

some specific steps to be considered and precautions and then culturing at a higher scale.

Green algae or blue green algae?

I am planning to cultivate algae-bacteria biofilms under greenhouse conditions using biofilm carriers. I have routinely come across Industrial Soft Carriers as frequently used substrates for biofilm development. What are these carriers commonly made of? Are they based on plastic polymers?

Additionally, suggest any specific type of biofilm carriers that are particularly helpful in cultivating biofilms for later use in plastic bioremediation processes.

Much thanks.

I would like to perform a multiple displacement amplification experiment on microalgal cells（possibly diatoms, dinoflagellates, cryptophytes, gold algae, ciliates, etc.）.Due to transportation issues with the samples, I fixed the microalgal cells with glutaraldehyde. Could you please advise on an effective method for cell lysis of these fixed algae cells to adapt to the subsequent MDA reaction?

In algae i care about cyanobacteria

salam alaikum

is this Raphidonema?

Previous I used colchicine to induce polyploidy in eukaryotic algae but now I want to know is the same for prokaryotic algae such as spirulina or not?

Hello. I am a post-graduate student and I am doing a research on the blooming of bioluminescent algae. I came across this organism in my sample and failed to identify it. If anyone of you know what is it, please let me know.

I will ferment ulva substrate with saccharomyces cerevisiae yeast. Can I add it directly or do I have to do the activation process first? If there is a need for the activation process, can you help me with the procedure?

Is algae fertilization considered biological or organic if the algae is dried?

Dear all,

I will really appreciate if someone could give me some suggestions to how to embed (fixation, postfixation, which resin) and in particular how to cut Diatoms algae, in order to investigate the plastids ultrastructure by transmission electron microscopy. Because their skeleton is made of silica, the diamond knive will be destroyed for sure, how to overcome this?

Many thanks!!!

Francesco

i'm looking for a good, general eukaryotic (?18s) primer that would amplify in most protists and eukaryotic single celled algae in pond samples. Can you suggest a good one?

Some freshwater species difficult to identify. Please help me find this species.

I want to do liminology of my fish pond. My major concern is with different types of algae present in the pond. ....kindly share your experience regarding sampling of algae and cell count per liter....

Samples from freshwater, surface water.

Some of the freshwater algae and diatoms we find. But this species identification not easy. Anyone expert help me to find the genus or species?

I am waiting for your support.

Thanking you!

By,

Vijayan

I am analyzing trace metal concentrations in algae pellets, which have been digested in HNO3. Some of the media used to grow the algae have very high concentrations of macro-level nutritional elements i.e. Na, Mg, P, S, and Ca. The range of concentrations is from 1000 ppm to 10,000 ppm. Can I run these samples directly on the ICP-MS without damaging the mass specs/multiplier?

I expect issues like signal suppression and deposits on the cone, but the main concern is not damaging the ICP-MS.

In a study in which we want to study the rhodophyte Gracilaria vermiculophylla with PAM fluorometry (diving PAM) we are facing the problem that this small tubular algae doesn't cover the complete area of the dark leaf clip. How can we correct the measurements?

Currently, I use pure water as my eluate. I wanted to use NaN3, but our company won't allow me to use that due to safety issues, so I wonder if there is something else I can use to prevent algae growth?

The pictures attached were detected on gills of the shrimp

I want to use the primer Fw_ITS1 (5'- AGGAGAAGTCGTAACAAGGT -3') to amplify algae but I don't seem to find the original paper of this primer. I can find it in most articles referred to White et al., 1990 (Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics), but I can't find it in this paper. Does anyone have an idea what is the "real"/original paper that developed this primer?

Many thanks in advance.

Hello,

I recently have started in a new position analyzing seagrass and other submerged aquatic vegetation (SAV) within an aquatic preserve. Our data is collected using a modified Braun-Blanquet (BB) score where if a species is present in our quadrat we give it a score of1 (less than 5%), 2 (5-25%), 3 (25-50%), 4 (50-75%), and 5 (75-100%). Historically they had been analyzing this data using average BB scores and percent occurrence. In each system we collect four quadrats from 25 sites and then the system as a whole is analyzed. I have not used BB methods before so I was looking into ways to analyze and learned basically that averaging these scores is not a good method for analyzing BB scores. Does anyone have any suggestions or insight on the best way to analyze this data? I've been reading from many different sources that all suggest different methods. I was wondering if anyone can help point me in the right direction for starting out, we have large datasets with 5 species of seagrasses and multiple species of algae. Any advice or suggested reading is highly appreciated.

Thank you

Hai ..

I have a doubt whether we can cultivate algae (in 500ml conical flask) in BOD incubator....Since our lab is small we don't have any provision to arrange a separate place for algae growth and culture.. But We have BOD incubator in our lab...i saw its specification it can maintain 25 degree celsius and light source is also available (i can switch it on during growth for 16h:8h light:dark cycle), which are needed for algal growth. Can i grow algae in it...Is there any humidity control or other specification needed for algal growth. Help me in making a budget friendly algal incubator.

I am requesting response... kindly help me in this regard

I want to learn as a species.

Briefly, it is a mixed system of bacteria and algae, and collected liquid samples from reactor. The first time centrifuge was conducted at 12000rpm for 10min，supernatant is clean, while after whased by PBS buffer and second centrifuge 12000rpm 10min, the supermenatnt turns bule/green, as shown in Attached picture. So seek suggestions here. Thanks

I am working on a genera frequency project in California Rivers. We go out and collect and document algal diversity in our system and I keep coming across the same looking organism, but attempts to key it have proved difficult. The photos were taken with 400X zoom. I don't know if this is an early stage of growth for an organism, or if it is just a fragment. Any help would be wonderful.

Dear diatomists,

Can someone could say to which Thalassiosira species this diatom belongs? Or it is not a Thalassiosira?

The scale bar is 10 mkm.

Recently, we identified our microalgae using 18s rRNA, and the data showed that the isolate was 99% similar to unclassified microalgae with general information on NCBI and no publications.

Our publication is interested in synthesizing NPs using microalgae. Does it necessary to undergo a classification process, or it is enough to publish the isolate and clearly state that these algae are not classified?

Thank you

Usually, the morphology of Spirulina is a screw-like coil. However, my strain changed its morphology into a straight form. How does it happen? Can it change back into a screw-like coil shape? Any suggestions or advice?

I work the research about stabilization of soil by Biological soil crust especially algae (Cyanobacteria and green algae)

Could anyone please help me about this topic soil stabilization using Algae.

I am working about biocrust to reduce water erosion

I am thinking do you advise me with something

why dry condition give us more stability than wet condition if the soil covered with biological soil crust especially algae? In my opinion the stability should decrease due to lesser activity of microorganisms ?

what about the range of time after watering Which makes algae capable of live and stabilizer soil surface under dry condition?

I am working in the green flagellated algae, I want to do live cell imaging for studying colocalization experiment. Please help me out with that.

Actually I am facing problem that cells are mobile but for imaging they should be fixed. I need to do colocalization experiment for two proteins in cell. So, kindly suggest me any suitable protocol or lab who can help me with that.

Thanks

I had grown Chlorella sorokiniana in BG-11 media supplementing with antibiotic and antifungal cocktail. The culture became healthy green in a few hours to pale yellow in a day. Suddenly, in next day, the culture converted its colour from pale yellow to white with some floc-formation and after a day or two colour changed to green again . So what should be the reason of sudden colour changes in the micro-algae culture?

Classification and forms prepared in each season of the year

📷

How and why is growth of benthic algae a disadvantage to the closed microalgal photobioreactor?? Basically also how benthic algae grows in closed pbr having a different algal strain

Recently, as a result of an increase in water temperature and a decrease in the concentration of dissolved oxygen in the water, whitening of corals has been recorded (death of algae in the symbiosis of algae and polyps). Why have colonies of algae colonized coral reefs in the Red Sea in recent years? What is the reason for this contradiction?

Hi everyone,

I hope all is well . I was wondering if anyone can recommend a solution that's safe for primary cells and iPSCs to add to the incubator water bath to aid in preventing microorganisms from growing. I have been using the one from RPI(algae inhibitor) but I am not 100% sure its safe for use in incubators. Anyone have other recommendations other than Aquaguard (can't find it anywhere to get in California)

Thank you !

For the built environment, AgNPs have been mostly explored for their efficacy against fungal biodeteriogenic strains while for such kinds of algal strains, TiO2 NPs have been explored extensively. If both algae and fungi are eukaryotic, why is there a particular preference for an antibiofouling agent for the two different kinds of organisms?

This algae invade my culture lately (Chlamydomonas). It will caused the culture to clump and eventually die. This contaminant was motile, with more than 4 flagella observed.

I had problems raising fresh water algae in Bold Basal Media. The chemical components in the media tend to react so much, even though they are mixed thoroughly after adding one by one. Moreover fresh water algae Chlorella vulgaris could not grow well in it. Even after making dilute and transparent media, the algae could not grow. I even doubt the quality of the algae I received.

I have raised marine algae and diatom in my previous research and even used them to treat textile effluent.

Please advice if I can use marine algae to treat domestic waste water (even though its source is fresh water) or should I use the sensitive fresh water algae? Please advice?

Peace, mercy, and blessing of good. I am trying to blast algal nucleotide sequence (purified using primer target 18S rRNA) and the result did not show any alignments as well the search for the conserved domain didn't show any result. Any suggestion?

During a group project, we work on a problem encountered by a farm is aquaponics. We need to develop a solution to reduce the nitrate level of the water leaving the system (100mg/L to 50mg/L), while producing value-added biomass (plants, algae?) that can be sold.

So, we are looking for a plant or algae that strongly assimilates nitrate and that can bring a benefit to the aquaponics farm. Do you have ideas for innovative solutions? techniques to optimize space and growth?

For now, we were thinking of using microalgae, Nelumbo nucifera, cress or pak choi. Are they interesting for our mission ?

Hello all,

I have been trying to revive the algal (chlorella minutisimma) culture stored in the fridge having fungal contamination for the past 4 months. During all my attempts after 10 days, my culture is getting faded and losing its green color. I have added penicillin (622.5mg/L) streptomycin (250 mg/L) antimicrobials and bavistin (6mg/L) and fluconazole (100mg/L) antifungal agents, but still, fungal growth is there and no algae are growing. Kindly suggest some technique or enrichment strategy to boost the culture.

Thanks in advance

I recently cultured a Microcystis aeruginosa strain, however it was contaminated by bacteria. I have tried to use solid medium to purify it. I used 0.4% agarose as the gel, and sterilized the agarose and BG11 medium separately and combined them together after the temperature decreased to ~40 degrees centigrade. Culture of Microcystis aeruginosa was spread over the midium. Two weeks later, only some bacteria grew on the plate, while no algae grew. What went wrong? How to improve my solid medium?

Or are there any other methods to purify a bacteria-contaminated algae except using the solid medium?

I am dealing with the presence of Lemna Major in WWTP secondary settling, is it a positive or negative presence? I guess they are helping the reputation process but it can lead to full covering of the settling

I'm working on determining the composition of algae after culturing it with wastewater.

I plan on using a lab-scale centrifuge for algae harvesting. What speed and time are suitable for a 40 ml algae culture?

Any protocol or procedure available will be helpful.

Thank you.

There is a recent increase in temperature for which there might be a disbalance of fish and algae population in the pond ecosystem. I was wondering if anyone working on this problem based on population dynamics of fish and algae - interactive mathematical model.

I'd like your advice on Pyrocystis Fusiformis growth. I purchased a culture a month ago and began cultivating it right away. Things, on the other hand, do not appear to be moving forward. There has been no bioluminescence observed yet, and the algae's growth has been poor. The culture was maintained at a pH of 8.2 and a temperature of 20 degrees Celsius with a 12-12 dark/light cycle. Cell counting under a microscope was used to monitor the algae's progress, but because I don't have much experience in the field of microbiology I wasn't sure of my count. I've attached a photo of what I see under the microscope, and I'm not sure if it's algae cells or not.

I'm hoping you could give me some suggestions on how to improve the growth of algae and its bioluminescence.

I have tried to extract nanocellulose fibres from algae powder and have yielded 15% of the total biomass taken. I want a suggestion for how to extract maximum yield of nanocellulose from it.

Extracted fucoidan and alginate from algae and carried HPLC and FTIR. FTIR spectrum was matching with that of standard. But, for HPLC I didn't get any peaks for sample ( got peak for standard). Hydrolysis was carried in different ways ( TFA and H2So4) to get peaks but still no result. Column specification: Hypersil Gold Amino, 250 X 4.6 mm, Particle size 5 micro. Can any one help me get peak for monosaccharaides in my sample?

I am currently working on culturing Chlorella vulgaris. If it was a contamination, the stock algae should have also been contaminated. But it wasn't, instead it has shown significant growth. I prepared BBM for Standard operating procedure. What would be the reasons?

I am currently working on cultivation of Chlorella vulgaris. I am just curious to know what happens. Thank you in advance.

I am currently working on culturing chlorella vulgaris. I have EDTA disodium salt instead of EDTA tetrasodium salt to prepare bold basal media. Does it affect the species?