January 2018
·
19 Reads
This page lists works of an author who doesn't have a ResearchGate profile or hasn't added the works to their profile yet. It is automatically generated from public (personal) data to further our legitimate goal of comprehensive and accurate scientific recordkeeping. If you are this author and want this page removed, please let us know.
January 2018
·
19 Reads
January 2018
·
251 Reads
·
17 Citations
Metallo-β-lactamases (MBLs) are a group of enzymes that can inactivate most commonly used β-lactam-based antibiotics. Among MBLs, New Delhi metallo-β-lactamase-1 (NDM-1) constitutes an urgent threat to public health as evidenced by its success in rapidly disseminating worldwide since its first discovery. Here we report the biochemical and genetic characteristics of a novel MBL, ElBla2, from the marine bacterium Erythrobacter litoralis HTCC 2594. This enzyme has a higher amino acid sequence similarity to NDM-1 (56%) than any previously reported MBL. Enzymatic assays and secondary structure alignment also confirmed the high similarity between these two enzymes. Whole genome comparison of four Erythrobacter species showed that genes located upstream and downstream of elbla2 were highly conserved, which may indicate that elbla2 was lost during evolution. Furthermore, we predicted two prophages, 13 genomic islands and 25 open reading frames related to insertion sequences in the genome of E. litoralis HTCC 2594. However, unlike NDM-1, the chromosome encoded ElBla2 did not locate in or near these mobile genetic elements, indicating that it cannot transfer between strains. Finally, following our phylogenetic analysis, we suggest a reclassification of E. litoralis HTCC 2594 as a novel species: Erythrobacter sp. HTCC 2594.
February 2016
·
95 Reads
·
37 Citations
Background: Abnormal expression of serum TGF-β1 was found in patients with diabetic nephropathy. However, the association of TGF-β1 with the risk of diabetic nephropathy remains unknown. The present study was undertaken to investigate whether such an association exists. Methods: We searched the Chinese VIP, Wangfang, China National Knowledge Infrastructure, PubMed, Embase, and Google Scholar databases for relevant studies and extracted all eligible data. Stata12 software was used for statistical analysis. Results: Nine reports met our criteria and were used for data extraction. There were 264 patients and 227 healthy controls from qualified reports in this meta-analysis. The results suggested that serum TGF-β1 levels were significantly up-regulated in patients with diabetic nephropathy; the instrumental variable was 3.94 (95% confidence interval 3.20-4.68, p<0.01). Conclusions: Meta-analysis suggested that elevated serum TGF-β level in patients with diabetes is associated with a high risk of nephropathy. Further studies are required to validate these observations.
February 2016
·
19 Reads
September 2015
·
16 Reads
ChemInform
Two new polyketides, neosarphenols A (I) and B (II), are isolated from Neosartorya glabra together with six known polyketides.
April 2015
·
24 Reads
·
9 Citations
Two new polyketides, neosarphenols A and B (1 and 2, resp.), were isolated from Neosartorya glabra, together with six known polyketides, 3–8, and two meroterpenoids, 9 and 10. The structures of the new compounds were elucidated by comprehensive spectroscopic analysis, especially by HR-ESI-MS and NMR experiments. All compounds were evaluated for their cytotoxic activities against MDA-MB-231, MCF-7, and PANC-1 tumor cell lines; 1 and 6 exhibited selective and moderate cytotoxicities against PANC-1 cell line.
January 2015
·
57 Reads
·
22 Citations
Three new xanthones, namely huperxanthones A–C (1–3, resp.), were obtained from the cultures of Aspergillus versicolor, a fungal endophyte of Huperzia serrata, together with 1,7‐dihydroxy‐8‐(methoxycarbonyl)xanthone‐3‐carboxylic acid (4), β‐diversonolic acid methyl ester (5), 4‐hydroxyvertixanthone (6), and sydowinin B (7). The structures of the new compounds were established by detailed NMR and MS analysis, especially by 2D‐NMR experiments. All xanthones were evaluated for their effects on α‐glucosidase. Compound 4 exhibited a potent inhibitory activity against α‐glucosidase with an IC 50 value of 0.24 mM (vs. 0.38 mM for acarbose). The rest of the compounds showed weak or no activity against α‐glucosidase.
January 2014
·
13 Reads
·
2 Citations
ChemInform
Two new polyhydroxypregnane glycosides, namely cynotophyllosides I–J, were isolated from the roots of Cynanchum otophyllum, together with three known steroids, namely deacetylmetaplexigenin, sarcostin and hemoside. Their structures were established by extensive spectroscopic methods especially 2D NMR techniques) and acidcatalysed hydrolysis.
October 2013
·
1,017 Reads
·
57 Citations
Applied Microbiology and Biotechnology
Novel specific 16S rDNA-targeted primers were successfully designed and applied to the characterization of endophytic diversity in Dendrobium officinale. Using the popular universal bacterial primers 27f/1492r, the fragments of chloroplast and mitochondrion 16S/18S rDNA were amplified from D. officinale. They shared high nucleotide identity with the chloroplast 16S rDNAs (99-100 %) and with the mitochondrion 18S rDNAs (93-100 %) from various plants, respectively, and both shared 73-86 % identities with the bacterial 16S rDNA sequences in GenBank. The current bacterial universal primers, including 27f/1492r, match well with the chloroplast and mitochondrion 16S/18S rDNAs, which accordingly renders these primers not useful for endophytic diversity analysis. Novel 16S rDNA-targeted primers fM1 (5'-CCGCGTGNRBGAHGAAGGYYYT-3') and rC5 (5'-TAATCCTGTTTGCTCC CCAC-3') were designed, which show good specificity compared to the 16S/18S rDNAs of D. officinale, and perfect universality within bacteria except for Cyanobacteria. The primers fM1/rC5, together with 515f-GC/rC5, which overlaps the whole V4 region of 16S rDNA, were subjected to nested polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) to analyze the diversity of endophytic bacteria in D. officinale from three different sources in China. The results showed diversities in roots and stems of the plants from all three locations. Altogether, 29 bands were identified as bacteria, with the dominant group being Proteobacteria and the dominant genus being Burkholderia, some of which commonly has the function of nitrogen fixation and thus may play potentially important roles in D. officinale. Therefore, the nested PCR-DGGE method based on the novel primers provides a good alternative for investigating the communities and roles of endophytes in D. officinale.
July 2013
·
1 Read
·
4 Citations
Two new polyhydroxypregnane glycosides, namely cynotophyllosides I-J, were isolated from the roots of Cynan-chum otophyllum, together with three known steroids, namely deacetylmetaplexigenin, sarcostin and hemoside. Their structures were established by extensive spectroscopic methods especially 2D NMR techniques) and acid-catalysed hydrolysis.
... This similarity challenges the classification of the serine-dependent enzymes and the metal-dependent enzymes found in marine bacteria. When such enzymes are purified and annotated as β-lactamases (and often as having an ancient heritage) [148][149][150][151][152], is the basis for their heritage that of β-lactam resistance or that of quorum quenching [153]? Selleck et al. suggest credibly that lactonase/lactamase promiscuity may offer an evolutionary advantage [153]. ...
Reference:
β-Lactams from the Ocean
January 2018
... Using microarray analysis, Liu et al. [33] showed that TGF-β1 was one of the differentially expressed genes in early diabetic nephropathy (DN) and non-diabetic samples as its expression was upregulated. Further, serum TGF-β1 has been identified as a risk factor for developing DN and may even serve as a potential biomarker, as shown in a meta-analysis conducted by Mou et al. [34]. However, clinical trials have not demonstrated the effectiveness of anti-TGF-β1 antibodies in preventing DKD progression, suggesting a complex role of TGF-β1 in DKD [35]. ...
February 2016
... Neosarphenol (24) is an isomer of hydroxyvermistatin, which was named basis of the producing fungus, Neosartorya glabra (currently reclassified as As neoglaber), rather than with reference to its chemical structure [40]. ...
April 2015
... The metabolite analysis demonstrated that strain MNP-2 has the capacity to create complex molecular skeletons, particularly some heterocyclic or compound skeletons with a bridge-ring (G-1 -G-8, Fig. 7). These compounds come from a wide range of sources and have diverse biological activities (Table S13) [46][47][48][49][50]. Destruxin A (A-8), a cyclic peptide with strong bioactivity, was also found in sample 1 (Fig. 7, G-4), and the antiSMASH analytical platform was used to look into its potential BGC (Fig. 6h). ...
January 2015
... By comparison of the nmR (Table 2) -19) to δ C 139.9 (C-5) explained that the double bond was located at H-5 and H-6. In addition, the 13 C nmR spectroscopic data of the skeleton of 3 matched well with those of the sarcostin skeleton isolated from Cynanchum botanicals [31,32]. By detailed analyses of its HSQC, 1 H-1 H COSY and HMBC spectra ( Figures S29-S31) to δ C 171.3 (C-1 ) revealed the placement of the two ester groups at C-20 and C-12, respectively. ...
February 2011
... Cynanchum otophyllum Schneid (Chinese name Qingyangshen), a plant of the genus Cynanchum L. (Family: Asclepiadaceae), is mostly distributed in the southwest of China (Ma et al., 2011a;Shi et al., 2013). As a traditional medicinal plant, the dried root of C. otophyllum has been used clinically to treat rheumatism, lumbar muscle strain and epilepsy. ...
January 2014
ChemInform
... (Murray et al. 1980). Subsequently, each DNA extract was used as a template for polymerase chain reaction (PCR) amplification of the 16S rRNA gene, using the universal bacterial primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (TACGGYTACCTTGTTACGACTT) (Yu et al. 2013). PCR reactions were conducted in a total volume of 50 µL, which included 25 µL of 2× Master Mix (Ampliqon, Denmark), 0.6 µL of each primer, and 3 µL of DNA. ...
October 2013
Applied Microbiology and Biotechnology
... These characteristic NMR data ( Figure S23, Table S7) suggested this compound was likely an aromatic alkaloid [3]. This compound was identified as harmane through a literature survey and comparison with reported data [27]. ...
March 2013
Chemistry of Natural Compounds
... It has been shown to have reasonably good psychometric properties 24,25 in various medical settings. [26][27][28][29][30] Versions of 60, 41, and 30 items in Chinese, English, and Japanese 23,31 have been developed and evaluated, 32 with over 2277 papers, 55% of which are journal articles published between 2006 and 2016. 33 Despite its popularity, challenges to its use included 34 (i) difficulty for people with limited education to understand some items, (ii) questionable classification of some items, (iii) many items classified as mixed body constitution, (iv) some items cross-linked to multiple body constitutions, [34][35][36] (v) the originally proposed structure could not be reproduced with empirical data (eg, 8 factors found in research despite the 9 originally proposed in CCMQ), 32,37 and (vi) items not allocated to their intended constitutions (many items in some constitutions, but few items in others). ...
April 2013
Chinese Journal of Integrative Medicine
... In recent years, many studies have revealed that D. moniliforme also has medicinal value, including antiinflammatory and antioxidant properties (5). Many studies have demonstrated that D. moniliforme includes a wide range of beneficial secondary metabolites, such as alkaloids (6) and flavonoids (7). The flavonoids in D. moniliforme are an important part of its pharmacological activity and an important index for evaluating D. moniliforme quality. ...
June 2007