Sitti Fatimah Syahid’s research while affiliated with The National Agency of drug and food control, Indonesia and other places

The wilt disease caused by Ralstonia solanacearum and the leaf spot disease caused by Phyllosticta sp. are significant constraints in ginger cultivation as they can lead to crop failure. One approach to eliminating these diseases is to use disease-free ginger plantlets obtained through tissue culture propagation. This study investigated the influence of plant growth regulators, i.e., Benzyl Adenine (BA) and Thidiazuron (TDZ), on the in vitro multiplication of large white ginger shoots. The tested treatments included combinations of BA (0, 1, 2, 3 mg L-1) and TDZ (0, 0.1, and 0.2 mg L-1), with ten replicates each. A complete randomised factorial experimental design was employed. The observed variables were shoot height, number of shoots, number of leaves, and number and length of roots at 2, 4, 6, and 8 weeks of age. The results indicated an interaction between TDZ and BA for shoot number and root length. The highest numbers of shoots were obtained after eight weeks using 0.1 mg L-1 TDZ alone without BA. Meanwhile, the longest roots were obtained after eight weeks using a specific combination of TDZ and BA concentrations. Based on this study, we proposed a strategy to implement this protocol to induce the formation of shoots, leaves, and roots in a multistep tissue culture propagation.

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been underexplored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early. This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R: 5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.

Rauvolfia serpentina is widely recognized for its use as a raw material in hypertension and antihypertensive medications, including reserpine. Since this plant is used directly from the natural world, cultivation activities are necessary. Seeds for cultivation must be consistent, high-quality, and free of pests and diseases. Thus, a suitable propagation technique is required. In vitro propagation is one method that can produce homogeneous plants with a relatively high rate of multiplication. Cytokinin-family regulatory molecules are crucial for in vitro proliferation techniques. The aim of this research was to determine the optimal type and concentration of cytokinin for the in vitro induction of R. serpentina shoots. This study employed a completely randomized factorial design. The first factor was the type of cytokinin (Benzylaminopurine (BA), Zeatin, Kinetin, and 2iP), and the second factor was the cytokinin concentration (0, 0.5, 1.0, 1.5 mg/l). Each treatment was replicated 10 times. The results showed that the best cytokinin for R. serpentina shoot induction in vitro was BA at a concentration of 0.5 mg/l. This treatment produced a greater number of shoots and leaves, taller shoots compared to other treatments, and resulted in more well-developed plant visualization.