S. Ge's research while affiliated with Qufu Normal University and other places
What is this page?
This page lists the scientific contributions of an author, who either does not have a ResearchGate profile, or has not yet added these contributions to their profile.
It was automatically created by ResearchGate to create a record of this author's body of work. We create such pages to advance our goal of creating and maintaining the most comprehensive scientific repository possible. In doing so, we process publicly available (personal) data relating to the author as a member of the scientific community.
If you're a ResearchGate member, you can follow this page to keep up with this author's work.
If you are this author, and you don't want us to display this page anymore, please let us know.
It was automatically created by ResearchGate to create a record of this author's body of work. We create such pages to advance our goal of creating and maintaining the most comprehensive scientific repository possible. In doing so, we process publicly available (personal) data relating to the author as a member of the scientific community.
If you're a ResearchGate member, you can follow this page to keep up with this author's work.
If you are this author, and you don't want us to display this page anymore, please let us know.
Publications (2)
Oryza officinalis complex includes five diploid species involving the B, C and E genomes, and is distributed in Asia, Africa and Oceania. These species are very important because O. australiensis is the only species with E genome, while O. punctata is the single species with B genome. Although there are three species with the C genome (O. eichinger...
The genus Oryza consists of approximately 24 species with 10 recognized genome types (A, B, C, BC, CD, E, F, G, HJ, HK). The species with the CD genome are endemic to the Central and South America and comprise three species, i.e. O. latifolia Desv., O. alta Swallen and O. grandiglumis (Doell) Prod. Although the three species can be easily distingui...
Citations
... O. rhizomatis (IRGC-103421) and O. eichingeri (IRGC-101429) possessed instead a SUB1 gene similar to the SUB1C-1 of domesticated submergence-tolerant indica rice ( Figure S11; Table 1). The C-genome group is a defined monophyletic clade (Ge et al., 1999), and phylogenetic and population genetic studies showed that the three closely related species belonging to this group, O. rhizomatis, O. eichingeri and Oryza officinalis, have diverged recently with a low level of species differentiation (Ge et al., 1999;Bao and Ge, 2003;Bao et al., 2006;Bautista et al., 2006). The absence of SUB1A in C-genome rice species is not surprising. ...
... ITS sequence data was employed to infer phylogeny in this study. They were amplified and sequenced using primer pairs ITS1 (AAGTCGTAACAAGGTTTCCGTAGGTG) [15] / ITS4 (TCCTCCGCTTATTGATATGC) [16]. The amplification parameters were: initial denaturation phase of 4 min at 94˚C; followed by 30 cycles of denaturation at 94˚C for 30 s, annealing phase at 55˚C-57˚C for 30 s, extension phase at 72˚C for 1 min 10 s, and final extension at 72˚C for 6 min. ...
