Mingming Shi’s research while affiliated with Gansu Agricultural University and other places

Anthracnose is recognized as a significant agricultural disease. This study investigates the disease symptoms characterized by black dots on walnut fruits observed in the walnut orchards of Longnan City, Gansu Province, China, in June 2022. These symptoms resemble those of anthracnose reported in previous studies. A strain designated Ht-10 was initially isolated and identified as belonging to the Colletotrichum species based on its morphological features. Pathogenicity tests confirmed that this strain induced pronounced anthracnose symptoms in walnuts, consistent with those originally observed in the field. Subsequently, multilocus phylogenetic analysis, which included partial sequences of the internal transcribed spacer (ITS), actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-tubulin2 (TUB2), and chitin synthase (CHS-1) genes of Ht-10, indicated that it most likely clustered with Colletotrichum fioriniae. The determination of biological characteristics revealed that the optimal temperature for the growth of Ht-10 was 25 °C in full light at a pH of 6, with soluble starch and yeast paste serving as the optimal carbon and nitrogen sources, respectively. To our knowledge, this is the first report of C. fioriniae as a causal agent of anthracnose in walnut fruits in China.

Cyst nematodes are obligate parasitic nematodes found in the fields of many cultivated crops. These nematodes, which have great economic importance, pose a threat to food security, though they are frequently ignored or misdiagnosed as pests because of covert parasitism. A cyst nematode population parasitizing on Artemisia lavandulaefolia DC., one of the traditional Chinese medicines was collected in Gansu Province. The species was diagnosed using integrative taxonomy and molecular approaches. The cyst population is spherical or lemon-shaped, light brown or dark brown in color, with a long neck and a protruding vulval cone. The stylet of the second-stage juvenile is strong, and the front end of the ball at the base of the stylet is concave; the median bulb and excretory pore are prominent; the tail is blunt and circular, and the transparent tail is usually shorter than the stylet. A phylogenetic analysis was carried out using the internal transcribed spacer (ITS) and 28S genes of ribosomal DNA, which further confirmed the presence of Cactodera chenopodiae. According to our literature review, this is the first report on C. chenopodiae in Compositae. By following this research, we can better understand the challenges posed by A. lavandulaefolia DC. and develop effective strategies for managing its spread and impacts. This will help to protect vulnerable ecosystems and ensure the sustainability of agricultural and forestry activities in affected areas.

Oat (Avena sativa L.) is a vital cereal crop and serves as food, feed, and industrial material for many commercial growers. The presence of root-lesion nematodes (RLN; Pratylenchus spp.) in oat-cultivated areas of China is alarming because RLNs display an endo-migratory life cycle and rank third among the most damaging nematode pests (Jones et al. 2013). Their penetration and feeding cause necrotic lesions on the roots, which further dispose plants to other soilborne pathogens resulting in extensive root rots (LaMondia, 2003). In China, it has been reported that P. thornei harmed sugarcane and wheat. (Fang et al 1994; Fan et al. 2020), However, there are no reports on the damage of P. thornei to oat. In June 2021, a survey of one oat field, exhibiting poorly developed plants reduced till number and distinct lesions on roots was conducted in Dingxi city, Gansu province, China (N 35°56', E 104°60'). Thirteen soil and root samples were collected from symptomatic plants (cultivar: Jizhangyan No.5). Nematodes were extracted from root and soil samples using the modified Baermann funnel method (Hooper, 1986). Twelve samples tested positive for the presence of RLN with population densities ranging from 3 to 25 juveniles and females/100 g of soil and 2 to 32/g of root. No males were detected. Twenty females from the twelve positive samples were selected at random and examined morphologically for species-level identification (Figure 1A-J). The female bodies were slender, almost straight or ventrally curved after heat relaxation (Figure 1A), labial region continuous with the rest of the body and bears three faint lip annuli. The stylets were short and stout with well-developed basal knobs (Figure 1C, G). The pharyngeal and reproductive components were typical of pratylenchid nematodes (Figure 1B). Tail region cylindrical, straight or curved ventrally, having variable terminus viz., broad, bluntly rounded or truncate, with no striations around terminus (Figure 1H-J). The diagnostic morphometrics of adult females were as follows: body length 591.4 ± 20.1 μm (466.6 to 742.7 μm), body width 22.5 ± 0.5 μm (20.1 to 26.2 μm), distance from anterior end to excretory pore 88.4 ± 3.5 μm (75.7 to 99.7 μm), stylet length 16.8 ± 0.2 μm (15.2 to 18.7 μm), and tail length 33.7 ± 1.3 μm (25.5 to 43.2 μm). De man's morphometric parameters were a: 26.3 ± 0.8 (19.8 to 31.1), b: 5.7 ± 0.2 (4.7 to 7.0), c: 17.9 ± 0.8 (12.9 to 23.7), c': 2.3 ± 0.1 (1.7 to 2.8) and V value was 77.8 % ± 1.2 (67.3 to 86.6 %). The morphological and morphometric characteristics of our detected population is consistent with Loof's 1960 description of P. thornei Sher and Allen, 1953 (Table 1). For molecular analysis, five females from the twelve positive samples were selected at random for molecular analysis. DNA was extracted from single females according to the method of Wang et al. (2011). The ITS region was amplified by primer pair 18S/26S (Vrain et al., 1992) and the D2/D3 expansion region of the 28S rDNA was amplified by primer pair D2A/D3B (Castillo et al., 2003). High quality PCR products of accurate fragment length were sent to the Tsingke Biological Technology (Xian, China) for sequencing. The ITS sequences (813 bp-817 bp, GenBank OP902282, OP902284, OP902287, OP902288 and OP902289) of Gansu population showed 99.26%-100% sequence identity with P. thornei reported from Italy (FR692299, FR692303 and FR692304) (Figure 2). The 28S sequences (738 bp-764 bp, GenBank OM278343, OP217988, OP218403, OP218404 and OP218567) showed 100% identity with P. thornei populations reported from Belgium (KY828302), the USA (OK490327) and Iran (JX261960) (Figure 3). Morphological and molecular data of the Gansu population obtained in this study supported its identification as P. thornei. The endo-migratory association of the host-nematode relationship was confirmed by observing nematodes inside the roots using acid fuchsin root staining (Wu et al. 2014) (Figure 4). Oat (cultivar: Jizhangyan No.5) seeds were sown in pots containing 500 g of naturally infested soil (an average of 12 P. thornei /100g of soil); autoclaved soil was used as a control. Fifty seeds were directly sown in pots (20 × 16 cm), with three replicates. Plants were maintained in an incubator at 28 ± 1°C (12 h/12 h light/dark). Results indicated that plants inoculated obviously grew poorly with some lesions on roots and P. thornei numbers in them increased 16 times both in soil (50.7 ± 9.6 nematodes/100g) and roots (708.0 ± 8.7 nematodes in the entire root system). No P. thornei was found in the control soil and roots (Figure 5). Morphological and molecular characteristics of specimens isolated from oat symptomatic roots (n = 10) were identical to P. thornei. The losses caused by P. thornei are still unknown, and considering Pratylenchus spp. are commercially important nematode, the more investigations on oats should be made in the future. As of yet, RLNs were not reported from any oat-cultivated areas of China. To our knowledge, this is the first report of P. thornei parasitizing oats in the Gansu province of China.

Snow pea root rot in China is caused by Fusarium solani (FSH) and Fusarium avenaceum (FAH), which affect snow pea production. The chemical control methods used against FSH and FAH are toxic to the environment and resistance may be developed in persistence applications. Therefore, an alternative approach is needed to control these pathogens. This study focuses on Trichoderma longibrachiatum strains (TL6 and TL13), mycoparasitic mechanisms of FSH and FAH, as well as growth-promoting potentials on snow pea seedlings under FSH and FAH stress at the physiological, biochemical, and molecular levels. The average inhibitory rates of TL6 against FSH and FAH were 54.58% and 69.16%, respectively, on day 7. Similarly, TL13 average inhibitory rates against FSH and FAH were 59.06% and 71.27%, respectively, on day 7. The combined TL13 and TL6 with FSH and FAH reduced disease severity by 86.6, 81.6, 57.60, and 60.90%, respectively, in comparison to the controls. The snow pea plants inoculated with FSH and FAH without TL6 and TL13 increased malondialdehyde (MDA) and hydrogen peroxide (H2O2) contents in the leaves by 64.8, 66.0, 64.4 and 65.9%, respectively, compared to the control. However, the combined FSH and FAH with TL6 and TL13 decreased the MDA and H2O2 content by 75.6, 76.8, 70.0, and 76.4%, respectively, in comparison to the controls. In addition, the combined TL6 + FSH and TL6 + FAH increased the activity of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) by 60.5, 64.7, and 60.3%, respectively, and 60.0, 64.9, and 56.6%, respectively, compared to the controls. Again, compared to the controls, the combined TL13 + FSH and TL13 + FAH increased the activity of SOD, POD, and CAT by 69.7, 68.6, and 65.6%, respectively, and 70.10, 69.5, and 65.8%, respectively. Our results suggest that the pretreatment of snow pea seeds with TL6 and TL13 increases snow pea seedling growth, controls FSH and FAH root rot, increases antioxidant enzyme activity, and activates plant defense mechanisms. The TL13 strain had the greatest performance in terms of pathogen inhibition and snow pea growth promotion compared to the TL6 strain.

In China, chestnut blight usually causes insignificant damage to fruit production of Chinese chestnut (Castanea mollissima Blume) and no serious disease epidemics occur, due to the high resistance to Cryphonectria parasitica (Huang et al. 1998). According to recent surveys, chestnut blight was mainly found in sixteen provinces including Shandong, Hebei, Anhui, Hunan, Jiangxi, Beijing, and Fujian, with severe cases occurring occasionally (Guo et al. 2005). The disease incidence has been aggravated with increasing monoculture of newly improved chestnut cultivars in chestnut-producing areas (Yan et al. 2007), though it was not detected in Gansu Province. In September 2021, some chestnut trees (Castanea seguinii) showing symptoms of crown dieback and diffuse sunken cankers on the trunk with swelled margins and subsequent cracking of the outer bark, were collected in mountains of Hui County in Longnan City, Gansu Province (E 104° 15′ 5.76″ ，N 35° 11′ 30.84″). Symptomatic branches were washed using tap water and dried on sterilized tissue paper. The Junction between diseased and healthy tissue was cut from the bark and sterilized with NaClO (2.5 %) for 2 minutes, then plated on potato dextrose agar (PDA) and incubated at 25 ℃ for 3 to 4 days. After fungal colonies formed, mycelia were transferred and subcultured onto new PDA media and then purified using single spore culture. After 7 days, colonies turned yellow white. Uninucleate conidia were formed in orange pycnidia and the orange pigments could turn purple if in 2% KOH. Conidia were straight or slightly curved, hyaline, with 2.5-3.5 × 1.2-1.5 μm in size. The characteristics of the culture and morphology were similar with those of C. parasitica (Tziros et al. 2016). Perithecia were not found on culture medium. In accordance with previous findings, the sexual stage of C. parasitica appears on diseased trees in late October. For molecular identification, genomic DNA was extracted from mycelium using a Fungal Genomic DNA Extraction Kit (Tsingke Biotech Co. Ltd, Xi’an, China), the ITS region was amplified with primers ITS1/ITS4 (Sorrentino et al. 2019), and the TEF1-α region was amplified with primers TEF-1H/TEF-2T (O’Donnel et al. 1998). Cloning and sequencing of PCR products were carried out by Tsingke Biotech Co. Ltd, Xi’an, China. The resulting sequences were deposited in GenBank (ITS sequence accession number: OM033734, TEF sequence accession number: OM12254). BLAST results revealed that the sequences of ITS and TEF shared identity over 99% with those of C. parasitica strains (GenBank accession number: AY308953, KP524763, KP824756 and KF220299). Based on morphological and molecular characteristic, the fungal isolates were identified as C. parasitica. To verify pathogenicity, thirty 3-year-old chestnut seeding (70 cm high, 1 cm diameter) of Castanea seguinii were used for inoculation. Chestnut branches were wounded (five wounds per sapling) using a hole punch and inoculated with a mycelial plug (5 mm in diameter) from the edge of 7-day-old, actively growing colonies. Pathogen-free PDA plugs were used as controls. To prevent desiccation, inoculated wounds were sealed with parafilm, and saplings were incubated in a greenhouse at 25℃. Each treatment consisted of 5 seedling and the pathogenicity tests were repeated three times. After inoculation for 5 weeks, symptoms of bark cankers were observed on branches similar to those of diseased chestnut trees in the field. Control saplings with sterile PDA discs did not display symptoms. C. parasitica was reisolated from inoculated branches. To our knowledge, this is the first report of C. parasitica causing chestnut blight in Gansu Province, one of the few areas in the China thought to be free of the disease. The specimens were found in the westernmost part of the natural distribution of chestnuts in China. There are more than 2.6 million chestnut trees, which constitute one of the most important economic forests in Hui County Gansu Province (Yang et al. 2005). The occurrence of chestnut blight could be a restricting factor for chestnut forests.

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19′42″; E 104°2′24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 μm, 439.72 to 659.93 μm), W (maximum body width) = (403.92 ± 57.17 μm, 311.01 to 513.34 μm), St (stylet length) = (11.28 ± 1.05 μm, 9.82 to 12.91 μm), MBW (width of the median bulb) = (31.13 ± 3.32 μm, 23.66 to 35.55 μm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 μm, 58,62 to 71.92 μm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 μm, 2.72 to 5.00 μm). Male (n=20): L= (1038.25 ± 90.34 μm, 877.28 to 1206.12 μm), St= (18.13 ± 1.48 μm, 15.10 to 20.12 μm), a (body length divided by greatest body width) = (31.77 ± 4.03 μm, 23.29 to 41.16μm), MBW= (10.97 ± 0.78 μm, 9.05 to 12.31 μm), MB= (64.81 ± 3.45 μm, 59.59 to 71.38 μm), DGO= (4.05 ± 0.47 μm, 3.11 to 5.08 μm), and Spic (spicule length) = (22.57 ± 1.91 μm, 19.26 to 26.43 μm). J2 (n=25): L= (381.73 ± 25.85μm, 336.96 to 419.98 μm), St= (10.52 ± 1.03 μm, 9.15 to 12.14 μm), a= (24.35 ± 2.10 μm, 20.45 to 28.29 μm), DGO= (3.02 ± 0.42 μm, 2.42 to 3.79 μm), c (body length divided by tail length) = (8.90 ± 0.86 μm, 7.71 to 10.48 μm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 μm, 3.47 to 5.04 μm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. was isolated from the rhizosphere soil of Polygonum viviparum L. in Tianzhu county, China. Morphologically, the new species is characterized by lemon-shaped or rounded cysts that have protruding necks and vulval cones. The vulval cone of the new species appeared to be circumfenestrate without bullae and underbridge, vulval denticle present and anus distinct. Second-stage juveniles are vermiform, stylet well-developed with the rounded stylet knobs to slightly concave anteriorly. Lateral field with four incisures. Tail gradually tapering to a finely rounded terminus with a length of ca 54 (47-59) µm, outline of hyaline portion is V-shaped or U-shaped. Egg shells without visible markings or punctations. The phylogenetic analyses based on ITS-rDNA, D2-D3 of 28S-rDNA clearly revealed that the new species formed a separate clade from other Cactodera species, which further support the unique status of C. tianzhuensis n. sp. Therefore, it is described herein as a new species of the genus Cactodera.