Matthew MacKay's research while affiliated with Weill Cornell Medical College and other places

... The time period of each phase is drawn can be found in Table S1. For each infected individual, PATAT randomly draws a withinhost viral load trajectory over the duration of infection, which impacts the sensitivity of Ag-RDTs 40 , based on known distributions for Omicron BA.1 41 . Similar viral load trajectories were drawn for both asymptomatic and symptomatic infected individuals 42 using a stochastic model modified from the one previously developed by Quilty et al. 43 A baseline Ct value (Ct baseline ) of 40 is established upon exposure. ...

... A variety of biospecimen collection methods have been used in human spaceflight studies to date [24]. For frequent sampling, particularly in-flight, non-invasive or minimally invasive sample collection methods (e.g. ...

... 11,84 A study by Liu et al analysed 300 MBCpaired tissues and liquid biopsies from MBC patients using NGS and found significant concordance between tissue and cfDNA. 85 They observed that 77.8% of pathogenic tissue variants were detected in cfDNA, and similarly, 75.7% of pathogenic cfDNA variants were identified in tissue when the tests were conducted within a 7-day interval. However, these percentages decreased to 50.3% and 51.8%, respectively, when the time gap between tests exceeded 365 days. ...

... At the beginning of the study, the Delta VOC was prevalent, but the Omicron sublineage BA.1 variant became dominant in January 2021, followed by the emergence of the Omicron 2 variant thereafter. Later, with the emergence of the Omicron sublineage BA.2 (characterized by the absence of the ∆69-70 mutation) and the progressive disappearance of Delta variant circulation, the SGTF result was applied to distinguish between Omicron BA.1 and BA.2 lineages (Figure 2) [18]. ACAAAGTTTTCAGATCCTCAGT 47-171 Del69-70, T95I, G142D, Del143-145, and Del144 TCCATAAGAAAAGGCTGAGA TGCTTTACTAATGTCTATGCAGA 399-616 K417T/N, D428E, N440K, G446S, L452R, Q474R, S477N, T478K, E484A/Q/K, Q493R, G496S, Q498R, N501Y, Y505H, T547K, A570D, and D614G ACAGGGACTTCTGTGCAGT GTTTAACAGGCACAGGTGT 552-722 D614G, H655Y, N679K, P681H/R, and T716I CACTGGTAGAATTTCTGTGGTA ...

... A large autopsy study investigating multiple organs (heart, lung, kidney, liver, and lymph nodes) showed that the cellular and functional gene signatures from each organ's major cell types (e.g., cardiomyocytes in the heart) decrease as a function of the viral load. More specifically in the heart (n = 41 from patient autopsy samples), despite no histological change, many heart functional markers (e.g., TNNI3, TNNT2, MYBPC3, PLN, and HAND1) showed decreased levels resulting from COVID-19 infection [35]. Another study showed the presence of SARS-CoV-2 in the myocardial heart tissue from autopsy cases, suggested to be tied to myocardial injury [36]. ...

... To validate our hypothesis that isolation may be a selection pressure to further drive the evolution of viral phenotypes, we additionally used the longitudinal viral load of SARS-CoV-2 from the BA.1 subvariant in 49 infected patients 41 (Table S1), and similarly analyzed those data together with the same data for the Delta variant (see METHODS in detail). The individual viral loads for the Delta variant (red) and BA.1 subvariant (green) are described in Fig. S8, and the estimated population parameters are shown in Table S5. ...

... Given the widespread infection and vaccination leading to high-level population immunity worldwide, this factor could have a profound impact on the evolution of the virus. Some studies suggest that COVID-19 vaccinations may affect the SARS-CoV-2 infection dynamics 32,39 . Accordingly, we conducted further analysis to investigate the impact of prior immunity caused by vaccinations or prior infections on our findings. ...

... Telomeres were significantly elongated during spaceflight in all crewmembers and in all in-flight samples analyzed (blood, and in one case also urine), irrespective of mission duration or means of measurement. In addition, mitochondrial dysregulation, increased oxidative stress and inflammation (evidenced by elevated 8-oxoG, TNF, PGF2) as well as genome instability were observed during spaceflight in these crew members, and astronauts in general 25,27,[29][30][31] . Consistent with a rapid human response to spaceflight, telomere elongation and upregulation of pathways related to oxidative stress were evident during and post the 3-day high elevation orbital mission for all four Inspiration4 crew members 28 . ...

... For more accurately evaluating the off-target effect of CRISPR editing, GUIDE-Seq will use to test the safety of SHP-1 editing in future work [8]. Compared with virus-transduced CAR T cells, very few clinical trials have applied CAR T cells prepared using PiggyBac system, and more attention needs to be paid on the safety of novel vector systems in future clinical trials [9]. ...

... 3 Sequence analysis of VOC revealed the S-gene as a site bearing numerous mutations, some of which are shared among different VOC. [3][4][5][6]8 This finding highlights the important need of a genotyping approach for tracking mutations of concern (MOC) expressed in SARS-CoV-2 variants. Indeed, disease monitoring programs should exhibit high sensitivity and quick turn-around-times, while workflows should remain largely unaffected by varying positivity rates. ...