Laure Perchepied's research while affiliated with University of Angers and other places

Publications (31)

Article
Full-text available
Background Scab is the most important fungal disease of apple and pear. Apple ( Malus x domestica Borkh.) and European pear ( Pyrus communis L.) are genetically related but they are hosts of two different fungal species: Venturia inaequalis for apple and V. pyrina for European pear. The apple/ V. inaequalis pathosystem is quite well known, whereas...
Preprint
Full-text available
Background Nonhost resistance is the outcome of most plant/pathogen interactions, but it has rarely been described in Rosaceous fruit species. Apple ( Malus x domestica Borkh.) is a nonhost for Venturia pyrina , the scab species attacking European pear ( Pyrus communis L.). Reciprocally, P. communis is a nonhost for Venturia inaequalis , the scab s...
Preprint
Full-text available
Background Scab is the most important fungal disease of apple and pear. Apple ( Malus x domestica Borkh.) and European pear ( Pyrus communis L.) are genetically related but they are hosts of two different fungal species: Venturia inaequalis for apple and V. pyrina for European pear. The apple/ V. inaequalis pathosystem is quite well known, whereas...
Article
Full-text available
Diversifying disease control methods is a key strategy to sustainably reduce pesticides. Plant genetic resistance has long been used to create resistant varieties. Plant resistance inducers (PRI) are also considered to promote crop health, but their effectiveness is partial and can vary according to the environment and the plant genotype. We invest...
Article
Full-text available
Pear psylla (Cacopsylla pyri) causes severe damage on European pear cultivars, resulting in high yield losses. Its control has become difficult since it developed resistance to a wide range of pesticides, while the number of authorized molecules for pest control has decreased. Identifying pear psylla resistance factors should help breeding new resi...
Article
Full-text available
Fire blight, caused by the bacterium Erwinia amylovora (Burrill) Winslow et al., is one of the most serious diseases of pear. The development of pear cultivars with a durable resistance is extremely important for effective control of fire blight and is a key objective of most pear breeding programs throughout the world. We phenotyped seedlings from...
Article
Full-text available
Deleterious epistatic interactions in plant inter- and intraspecific hybrids can cause a phenomenon known as hybrid necrosis, characterized by a typical seedling phenotype whose main distinguishing features are dwarfism, tissue necrosis and in some cases lethality. Identification of the chromosome regions associated with this type of incompatibilit...
Article
Full-text available
Scab is one of the major fungal diseases infecting pear trees, causing the greatest economic losses. Identifying and pyramiding scab resistance factors should help in breeding new resistant pear cultivars. We have identified and mapped two new pear resistance loci against the fungal pathogen Venturia pirina. The first locus, mapped both as a major...
Article
Full-text available
Cacopsylla pyri (pear psylla) is one of the most serious pests of pear (Pyrus spp.) in Europe. It can cause high yield losses, and its control has become difficult since it has developed resistance to a wide range of pesticides. Pear breeders are developing new cultivars resistant to pear psyllids, and Asian species, such as Pyrus ussuriensis and P...
Data
Psylla resistance phenotypic data distributions in a segregating interspecific pear population in 2013 and 2014.
Data
Distribution of the phenotypic means of psylla resistance adjusted for environmental factors in a pear segregating population in 2013 and 2014.
Conference Paper
We present our findings on genetics of resistance to fire blight (caused by the bacterium Erwinia amylovora) and psylla (Cacopsylla pyri) in a pear inter-specific segregating population between P128R068T003 (Pyrus x bretschneideri X P. communis) and ‘Moonglow’ (P. communis). Asian pears are usually less susceptible to psylla than their European rel...
Article
Full-text available
We present a draft assembly of the genome of European pear (Pyrus communis) 'Bartlett'. Our assembly was developed employing second generation sequencing technology (Roche 454), from single-end, 2 kb, and 7 kb insert paired-end reads using Newbler (version 2.7). It contains 142,083 scaffolds greater than 499 bases (maximum scaffold length of 1.2 Mb...
Article
Full-text available
We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We the...
Conference Paper
Fire blight, caused by the bacterium Erwinia amylovora, is a serious disease of European pear (Pyrus communis) and is widely distributed over the world. The chemical control of fire blight is problematic, as the use of antibiotics is not allowed in many countries, and the eradication of infected plants remains the most effective method. Cacopsylla...
Article
Full-text available
The failure of gene-for-gene resistance traits to provide durable and broad-spectrum resistance in an agricultural context has led to the search for genes underlying quantitative resistance in plants. Such genes have been identified in only a few cases, all for fungal or nematode resistance, and encode diverse molecular functions. However, an under...
Article
Full-text available
Studies of the interaction between Arabidopsis thaliana and the necrotrophic fungal pathogen Sclerotinia sclerotiorum have been hampered by the extreme susceptibility of this model plant to the fungus. In addition, analyses of the plant defense response suggested the implication of a complex interplay of hormonal and signaling pathways. To get a de...
Data
Phenotypic correlations among experiments (0.04 MB DOC)
Data
Analysis of the F1 progeny of reciprocal crosses between Bay-0 and Shahdara for partial resistance to Pseudomonas syringae pv. tomato DC3000. In planta bacterial growth was assessed three days post inoculation in the F1 generation of reciprocal crosses between Bay-0 and Shahdara. Each value is the average of in planta bacterial growth of at least 4...
Article
Full-text available
Low-level, partial resistance is pre-eminent in natural populations, however, the mechanisms underlying this form of resistance are still poorly understood. In the present study, we used the model pathosystem Pseudomonas syringae pv. tomato DC3000 (Pst) - Arabidopsis thaliana to study the genetic basis of this form of resistance. Phenotypic analysi...
Article
Fusarium oxysporum f. sp. melonis (FOM) causes serious economic losses in melon (Cucumis melo L.). Two dominant resistance genes have been identified, Fom-1 and Fom-2, which provide resistance to races 0 and 2 and races 0 and 1, respectively, however FOM race 1.2 overcomes these resistance genes. A partial resistance to FOM race 1.2 that has been f...
Article
ABSTRACT Partial resistance to downy mildew (Pseudoperonospora cubensis) and complete resistance to powdery mildew (Podosphaera xanthii races 1, 2, 3, and 5 and Golovinomyces cichoracearum race 1) were studied using a recombinant inbred line population between 'PI 124112' (resistant to both diseases) and 'Védrantais' (susceptible line). A genetic m...
Article
ABSTRACT Fusarium oxysporum f. sp. melonis is responsible for Fusarium wilt of melon. Race 1.2 strains overcome two dominant resistance genes (Fom-1 and Fom-2) and are further divided into two types depending on the symptoms they cause, yellowing or wilting. Partial resistance to F. oxysporum f. sp. melonis race 1.2 was studied by using a recombina...

Citations

... Nevertheless, polygenic disease resistance consists of many additive quantitative loci that can confer durable resistance against rapidly evolving pathogen populations. Moreover, pyramiding of such quantitatively controlled disease and pest resistance loci into susceptible cultivated backgrounds can lead to the development of cultivars with wide-spectrum and durable resistance [201]. QTLs linked to disease and pest resistance have been identified in pear, and molecular markers are becoming widely available for use in breeding programs [202]. ...
... Many genetically studies have been done on different crop species about the impact of management measures and climate change on different plants traits and their ability to face the stress produced by different biotic and abiotic constrainers (Duncan and Howard, 2000;Loarie et al., 2009;Wittenberg et al., 2009;Burger at al., 2012;Johnson et al., 2012;Bonciu, 2018;Bonciu et al., 2018;Bonciu, 2019). However, despite biological, chemical and cultural methods, the use of resistant genotypes remains the most efficient way to control the disease (Aysan et al., 1999;Durel et al., 2003;Bell et al., 2005;Dondini et al., 2005;Stockwell et al., 2011;Montanari et al., 2016;Calis et al., 2017;Hashman et al., 2017;Kellerhals et al., 2017;Mertoğlu and Evrenosoglu, 2017). The aim of the present study was to determine the response of four pear varieties to the attack of the bacteria Erwinia amylovora under natural infection in terms of the relationship between weather conditions, varieties susceptibility to Fire Blight and pathogen impact on pear fruits yield and sugar content. ...
... The candidate region corresponds to an approximate 240-kb region of the peach genome, where RLKs and genes with LRR were concentrated. The mapping of inter-specific reproductive barriers was also reported in other Rosaceae species (inter-specific pear: Montanari et al. 2016, apple × pear: Morimoto et al. 2020. Interestingly, lethal quantitative trait loci were located in the region with clusters of pest resistance genes in the inter-specific pear hybrid (Montanari et al. 2016). ...
... Resistance QTLs linked to pear scab, incited by Venturia pirina, were identified on LGs 1 and 2 in pear (Terakami et al. 2006;Abe et al. 2008;Cho et al. 2009;Bouvier et al. 2012). Furthermore, additional QTLs linked to pear scab were also reported on LGs 3, 4, 5, 7, 10, and 17 (Table 1) (Pierantoni et al. 2007;Won et al. 2014;Perchepied et al. 2015). Some of these loci were also fine-mapped down as Vnk, Vn, Rvn2, and Rvp1 (Terakami et al. 2006;Abe et al. 2008;Cho et al. 2009;Bouvier et al. 2012). ...
... Here, we report on the genetic mapping of resistances to pear slug/sawfly and blister mite in the interspecific pear family 'PremP003' × P. communis 'Moonglow' using the parental maps described by Montanari et al. (2013). ...
... Possible epistatic interactions between detected QTLs were tested using ANOVA, as described previously (Montanari et al. 2015). In short, epistatic interactions between detected QTLs were modelled as the interaction term, as in the twoway ANOVA model: ...
... Primers for CDKB2:2 (GenBank accession number CN943384; forward: 5′ TGCACAGGGATCTTAAGC 3′, reverse: 5′ ATACTTCTTGAGTGGCAC 3′) (Janssen et al., 2008) and EXP3 (Genbank accession number AF527800 (Chagné et al., 2014), Apple homologue accession number MDP0000670959; forward: 5′ GATGCAGGAGAAGAGGAGGC 3′, reverse: 5′ ATTGCACATCTCCAGCACCA 3′) were designed by spanning an intron using Primer 3 Plus online software (http://www.bioinformatics.nl/cgi-bin/primer3plus/pri mer3plus.cgi/). ...
... Illumina developed other BeadArray (GoldenGate) that uses fluorescent universal primers that hybridize to the allele-specific oligos. These technologies have been extensively used to discover and genotype SNPs in food crops, including cereals (barley [66], maize [67,68], oat [69], rice [70,71], and wheat [72]), oil crops (oilseed rape [73] and sunflower [74,75]), horticultural crops (cowpea [76], potato [77], tomato [78], and soybean [79]), and woody crops (apple tree [80,81], cherry tee [82], peach tree [83][84][85], pear tree [86], and vine [87,88]), among others. ...
... Subfamily III cluster, which is similar to the rice RLCKs, was not identified in maize (Shiu et al. 2004). The Arabidopsis RLCK subfamily III contains ZRK3 (AT3G57720), which is required for recognition of the Pseudomonas syringae type III effector HopF2a (Seto et al. 2017) and RKS1 (AT3G57710), which is associated with broad-spectrum resistance to Xanthomonas campestris (Huard-Chauveau et al. 2013). ...
... In contrast, the stomatal opening is controlled by oxalic acid, which facilitates soothing access of fungal mycelium by distracting the ABA-dependence (Guimaraes and Stotz 2004). In Arabidopsis, a positive association is established between ABA and JA to promote resistance to S. sclerotiorum (Perchepied et al. 2010). A study about the relationship between jasmonate signalling (JS) and resistance to white mold in soybeans revealed that early initiation of JS facilitates the ability to scavenge ROS and contributes to improvements in antifungal activities by altering the phenylpropanoid pathway . ...