Huajun Zhang’s scientific contributions

What is this page?


This page lists works of an author who doesn't have a ResearchGate profile or hasn't added the works to their profile yet. It is automatically generated from public (personal) data to further our legitimate goal of comprehensive and accurate scientific recordkeeping. If you are this author and want this page removed, please let us know.

Publications (1)


Photograph of Corydoras pygmaeus.
Gene map of the Corydoras pygmaeus mitochondrial genome.
Maximum likelihood tree of 14 Callichthyidae species and one outgroup based on 13 protein-coding genes. The accession numbers are listed after the species names. The C. pygmaeus mitochondrial genome is marked in bold font.
First complete mitochondrial genome of the Corydoras pygmaeus (Actinopteri: Callichthyidae) and its phylogenetic implications
  • Article
  • Full-text available

September 2022

·

121 Reads

·

3 Citations

Huajun Zhang

·

Li-An Gao

·

Wenlei Zhang

The Pygmy corydoras Corydoras pygmaeus Knaack, 1966, is the smallest member of the genus Corydoras, belonging to the family Callichthyidae and order Siluriformes. The complete mitochondrial genome of C. pygmaeus was sequenced and assembled using next-generation sequencing technology, and phylogenetically compared with those of other species of this genus. The mitochondrial genome of C. pygmaeus is a circular DNA molecule with a size of 16,840 bp (GenBank no. ON729306). A phylogenetic tree was constructed based on 13 protein-coding genes of C. pygmaeus and 13 species of the family Callichthyidae, which showed that C. pygmaeus clustered with other species of this genus, but was the first branch to differentiate. These results could provide basic data for phylogenetic analysis and population genetic diversity protection of Corydoras and Callichthyidae fish in the future.

Download

Citations (1)


... Insertion sequences of 29 bp (TATTTAAATCTAGCTCTATTAAATTAATT) and 30 bp (TATCTAAAACTATACTAAACTAAATAATTA) were observed in D. longibarbis and D. urostriatum, respectively. A similarly long intergenic sequence of 30 bp (CACATAAT-TAATCACATAAATTAAATCT) was also observed in H. littiorale, another species in the Callichthyinae, while a shorter intergenic sequence of 15-21 bp was observed in Corydoradinae [14,[38][39][40][41][42][43][44][45][46][47][48]. Given the high interspecific similarity in Corydoradinae, it was suggested that the atp6-cox3 intergenic sequence could function as a molecular marker for species classification, whereas in Callichthyinae, no intergenic sequence similarity was observed, except for length [48]. ...

Reference:

The First Complete Mitochondrial Genomes for the Genus Dianema (Siluriformes: Callichthyidae): Dianema longibarbis and D. urostriatum
First complete mitochondrial genome of the Corydoras pygmaeus (Actinopteri: Callichthyidae) and its phylogenetic implications