Fan Lin’s research while affiliated with University of Pittsburgh and other places
What is this page?
This page lists works of an author who doesn't have a ResearchGate profile or hasn't added the works to their profile yet. It is automatically generated from public (personal) data to further our legitimate goal of comprehensive and accurate scientific recordkeeping. If you are this author and want this page removed, please let us know.
Prostate cancer is a biologically heterogeneous disease with considerable variation in clinical aggressiveness. The behavior of prostate cancer can be considered a direct or indirect result of aberrant alterations of gene expression in prostate epithelial cells. Identification of the patterns of gene-expression alterations that are related to the aggressiveness of prostate cancers will greatly assist the development of tools for early detection of prostate cancers with poor clinical outcome and identification of targets for future therapeutic intervention. To detect the patterns of gene-expression alterations of prostate cancers, we performed a comprehensive gene-expression analysis on 30 prostate tissues of various levels of invasiveness (ranging from those confined to the organ to distant metastases) and Gleason grades (combined scores 4-9), using the Affymetrix chip set Hu35k (A-D) and U95a. Following three sequential selection screens, we identified 84 largely novel genes and expressed sequence tag (EST) sequences whose expression levels were altered significantly in prostate cancer samples compared with control normal tissues. In addition, the expression levels of a group of 12 genes and EST sequences was found to be altered significantly in aggressive type of prostate cancers but not in organ-confined prostate cancers. Cluster analysis using the 84-gene list showed that the highly aggressive prostate cancers contained gene-expression patterns that were distinct from organ-confined prostate cancers.
Prostate cancer is one of the leading causes of cancer-related deaths for men in the United States. Like other malignancies, prostate cancer is underscored by a variety of aberrant genetic alterations during its development. Although loss of heterozygosity or allelic loss is frequently identified among prostate cancers, few genes have been identified thus far as critical to the development of invasive prostate cancers. In this report, we used the recently developed technology, the "differential subtraction chain," to perform a genome-wide search for sequences that are deleted in an aggressive prostate cancer. Among the deleted sequences, we found that one sequence was deleted in >50% of prostate cancers we tested. We mapped this sequence to chromosome 4q25 by screening the Genebridge 4 hamster radiation panel with primers specific to this probe, and subsequently identify a 54-kb minimal common deletion region that contains the sequence encoding myopodin. Sequence analysis indicates that myopodin shares significant homology with synaptopodin, a protein closely associated with podocyte and neuron differentiation. Further study shows that frequent complete or partial deletions of the myopodin gene occurred among invasive prostate cancer cases (25 of 31 cases, or 80%). Statistical analysis indicates that deletion of myopodin is highly correlated with the invasiveness of prostate cancers, and thus may hold promise as an important prognostic marker for prostate cancers.
Prostate cancer is the second leading cause of cancer-related deaths in the United States. However, the underlying molecular events for prostate cancer development are not clear. In this study, we applied the recently developed technology known as differential subtraction chain (DSC) to identify a novel gene whose expression is inactivated in high grade prostate cancer. This gene, designated as SAPC, is expressed in normal prostate acinar cells. Its expression is dramatically down-regulated in high grade prostate cancers (4/4) but is unaltered in low grade prostate cancers. It encodes a 7.7-kd protein. Its sequence shares some homology with the cysteine-rich domain of 2-5A-dependent RNase L, which is a critical component of the interferon-induced apoptosis cascade. The selective inactivation in the more aggressive prostate cancers holds promise for SAPC as a potential prognostic marker for high grade prostate cancer.
Prostate cancer is one of the leading causes of cancer- related deaths for men in the United States. Like other malignancies, prostate cancer is underscored by a variety of aberrant genetic alterations during its de- velopment. Although loss of heterozygosity or allelic loss is frequently identified among prostate cancers, few genes have been identified thus far as critical to the development of invasive prostate cancers. In this report, we used the recently developed technology, the "differential subtraction chain," to perform a ge- nome-wide search for sequences that are deleted in an aggressive prostate cancer. Among the deleted se- quences, we found that one sequence was deleted in >50% of prostate cancers we tested. We mapped this sequence to chromosome 4q25 by screening the Genebridge 4 hamster radiation panel with primers specific to this probe, and subsequently identify a 54-kb minimal common deletion region that contains the sequence encoding myopodin. Sequence analysis indicates that myopodin shares significant homology with synaptopodin, a protein closely associated with podocyte and neuron differentiation. Further study shows that frequent complete or partial deletions of the myopodin gene occurred among invasive prostate cancer cases (25 of 31 cases, or 80%). Statistical anal- ysis indicates that deletion of myopodin is highly correlated with the invasiveness of prostate cancers, and thus may hold promise as an important prognos- tic marker for prostate cancers. (Am J Pathol 2001, 159:1603-1612) Prostate cancer remains one of the most frequently diag- nosed malignancies in American men. Approximately 37,000 men die from this disease annually. 1 Despite the recent advances in our understanding of the environmen- tal, hormonal, and nutritional parameters affecting the incidence of prostate cancers, much remains to be learned about the pathogenesis of prostate cancer. Epi- demiological and laboratory studies indicate that genetic factors are important in the pathogenesis of prostate cancers. 2,3 For example, 9% of prostate cancer cases have a strong familial component that is inherited as an autosomal dominant trait with high penetrance. In addi- tion, cytogenetic studies, fluorescent in situ hybridization, comparative genomic hybridization, and allelotype anal- yses have revealed numerous genetic abnormalities as- sociated with invasive prostatic carcinoma, including loss or gain of regions of several chromosomes, presence of trisomies, amplification of certain genes in X chromo- some, loss of Y chromosome, and high frequency of loss of heterozygosity in several hot spots. These aberrant genomic alterations seem to accumulate with advancing stages of prostate cancers. However, it is not clear what molecular events are responsible for the progression of prostate cancer from a relatively indolent disease to one that could be life threatening. In this report, we applied a methodology previously developed from this laboratory, namely, the "differential subtraction chain" (DSC) to identify sequences that were deleted in prostate cancer genome. One of the deleted sequences identified in an aggressive prostate cancer was found similarly deleted in many other prostate can- cer genomes. We mapped out a common deletion region among the prostate cancers, and identified a gene named "myopodin" that was within the minimal common deletion region. Further study indicated that there were
Citations (5)
... It has an isoelectric point (PI) of 9.3 and molecular weights of 79 kDa and 103 kDa [1,2]. In 2001, Lin et al. documented a 54 kb minimal common deletion region on chromosome 4q25 of the genome associated with invasive prostate cancer [3]. Subsequently, the SYNPO2 gene, approximately 3. 6 Kb, has been identified in mouse skeletal muscles and cardiomyocytes [4]. ...
... The procedures for RNA extraction, cDNA synthesis and the detection of fusion genes were described previously [35][36][37][38][39][40][41][42][43][44][45][46][47][48][49]. Briefly, total RNA was extracted using Trizol to lyse the cells in the cancer tissues (Invitrogen, CA, USA). ...
... The procedures for RNA extraction, cDNA synthesis and the detection of fusion genes were described previously [35][36][37][38][39][40][41][42][43][44][45][46][47][48][49]. Briefly, total RNA was extracted using Trizol to lyse the cells in the cancer tissues (Invitrogen, CA, USA). ...
... Because of published data indicating that deletions in the SYNPO2 gene were associated with invasive prostate cancer [29], we aimed at revealing the specific localization of SYNPO2 in the normal human prostate. Staining of cryosections with antibodies against all SYNPO2 isoforms (RbM2) and against all cytokeratins revealed that epithelial cells identified by keratin staining were not stained by anti-SYNPO2 antibodies ( Figure 5A,B). ...
... RNA extraction, cDNA synthesis, TaqMan RT-PCR, and breakpoint Taqman PCR Total RNA was extracted from cell pellets using TRIzol (Invitrogen). [9][10][11][12][13][14][15][16][17] Two micrograms of RNA were used to synthesize the first-strand cDNA with random hexamer primers and Superscript II (Invitrogen). One microliter of each cDNA sample was used for TaqMan PCR with 50 heating cycles at 94°C for 30 seconds, 61°C for 30 seconds, and 72°C for 30 seconds using the primer sequences AGCGCAGTTTGGGATACAGCA/CTTTAATGTGCCCTT ATATACTTCACC and the TaqMan probe: 5ʹ/56-FAM/ TCAGAAACA/ZEN/GCCTATGAGGGAAATT/3IABkFQ/3ʹ in a thermocycler (QuantStudio 3 real-time PCR system, ThermoFisher, Inc or Mastercycler RealPlex2, Eppendorf, Inc). ...
