Erika Sallet's research while affiliated with French National Centre for Scientific Research and other places

Publications (80)

Article
Full-text available
Plant epigenetic regulations are involved in transposable element silencing, developmental processes and responses to the environment1–7. They often involve modifications of DNA methylation, particularly through the DEMETER (DME) demethylase family and RNA-dependent DNA methylation (RdDM)8. Root nodules host rhizobia that can fix atmospheric nitrog...
Article
Fungal symbiosis with early land plants Hundreds of millions of years ago, evolved descendants of aquatic plants began showing up on dry land. These newly terrestrialized species had to deal with increased ultraviolet light exposure, desiccation, and less accessible nutrients. Rich et al. show how mutualist fungi may have helped these nascent plant...
Article
Full-text available
Legume plants can form root organs called nodules where they house intracellular symbiotic rhizobium bacteria. Within nodule cells, rhizobia differentiate into bacteroids, which fix nitrogen for the benefit of the plant. Depending on the combination of host plants and rhizobial strains, the output of rhizobium-legume interactions varies from nonfix...
Preprint
Full-text available
Legume plants can form root organs called nodules where they house intracellular symbiotic rhizobium bacteria. Within nodule cells, rhizobia differentiate into bacteroids, which fix nitrogen for the benefit of the plant. Depending on the combination of host plants and rhizobial strains, the output of rhizobium-legume interactions is varying from no...
Article
Full-text available
Root-knot nematodes (genus Meloidogyne) are plant parasites causing huge economic loss in the agricultural industry and affecting severely numerous developing countries. Control methods against these plant pests are sparse, the preferred one being the deployment of plant cultivars bearing resistance genes against Meloidogyne species. However, M. en...
Article
Full-text available
Background: A key step in domestication of the grapevine was the transition from separate sexes (dioecy) in wild Vitis vinifera ssp. sylvestris (V. sylvestris) to hermaphroditism in cultivated Vitis vinifera ssp. sativa (V. vinifera). It is known that V. sylvestris has an XY system and V. vinifera a modified Y haplotype (Yh) and that the sex locus...
Article
Full-text available
White lupin (Lupinus albus L.) is an annual crop cultivated for its protein-rich seeds. It is adapted to poor soils due to the production of cluster roots, which are made of dozens of determinate lateral roots that drastically improve soil exploration and nutrient acquisition (mostly phosphate). Using long-read sequencing technologies, we provide a...
Preprint
Full-text available
Grapevine has a major economical and cultural importance since antiquity. A key step in domestication was the transition from separate sexes (dioecy) in wild Vitis vinifera ssp. sylvestris (V. sylvestris) to hermaphroditism in cultivated Vitis vinifera ssp. vinifera. While the grapevine sex locus is known to be small, its precise boundaries, gene c...
Preprint
Full-text available
White lupin (Lupinus albus L.) is a legume that produces seeds recognized for their high protein content and good nutritional value (lowest glycemic index of all grains, high dietary fiber content, and zero gluten or starch). White lupin can form nitrogen-fixing nodules but has lost the ability to form mycorrhizal symbiosis with fungi. Nevertheless...
Conference Paper
Full-text available
O. cumana (the sunflower broomrape) is an obligate parasitic plant that needs to fix to the sunflower roots for collecting water and nutrients from sunflower. For sunflower physiology, O. cumana can be considered as a new sink that leads to yield losses. During the early stages of the interaction, the connection of O. cumana to the vascular system...
Chapter
EuGene is an integrative gene finder applicable to both prokaryotic and eukaryotic genomes. EuGene annotated its first genome in 1999. Starting from genomic DNA sequences representing a complete genome, EuGene is able to predict the major transcript units in the genome from a variety of sources of information: statistical information, similarities...
Book
EuGene is an integrative gene finder applicable to both prokaryotic and eukaryotic genomes. EuGene annotated its first genome in 1999. Starting from genomic DNA sequences representing a complete genome, EuGene is able to predict the major transcript units in the genome from a variety of sources of information: statistical information, similarities...
Article
Full-text available
Advances in deciphering the functional architecture of eukaryotic genomes have been facilitated by recent breakthroughs in sequencing technologies, enabling a more comprehensive representation of genes and repeat elements in genome sequence assemblies, as well as more sensitive and tissue-specific analyses of gene expression. Here we show that PacB...
Poster
Full-text available
Sweet cherry (Prunus avium L.) is a diploid species with an estimated genome size of 338 MB (Arumuganathan et al. 1991). It is mostly self-incompatible, and therefore has a heterozygous genetic background. We have sequenced and assembled the genome of the ‘Regina’ sweet cherry variety, which is a late blooming cultivar. Here we present a draft phas...
Article
Full-text available
Background The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the co...
Data
Distribution of % identity between pairs of duplicated regions in the asexual Meloidogyne. Counts of pairs of duplicated genomic blocks (y-axis) as a function of their % identity (x-axis), in M. incognita (M. inc), M. javanica (M. jav) and M. arenaria (M. are). (PDF)
Data
Collinearity plotted against average Ks per pair of duplicated blocks. For each pair of collinear blocks collinearity is computed as the fraction of collinear genes within a pair of blocks and Ks is obtained using the add_ka_and_ks_to_collinearity.pl script of the MCScanX package. (PDF)
Data
Vista plot of alignment of a pair of duplicated blocks taken as an example for M. incognita. To illustrate the divergence between pair of duplicated collinear blocks formed by MCScanX, we aligned (using LAGAN: at http://genome.lbl.gov/vista/index.shtml), 2 collinear blocks of M. incognita. Block located on scaffold “Minc3s00001” from position 286,6...
Data
Relative DNA staining in nuclei of Meloidogyne spp. Example of an unfiltered cytogram (arbitrary units) where nuclei were processed alone in a single acquisition: (A) M. incognita sample and (B) C. elegans standard. (C) Cytogram example obtained after gating on G0/G1 nuclei (arbitrary units) from each Meloidogyne species (M. hapla, M. incognita, M....
Data
Example of episodic diversifying selection detected in a phylogenetic tree. Example of a duplicated gene copy harboring signature of episodic diversifying selection as detected by the Branch-Site REL model. The branch leading to the gene Mjav1s00402g005840 is inferred to be under (or to have underwent) episodic diversifying selection (corrected p =...
Data
Statistic of transcriptome reads used for gene models prediction. (PDF)
Data
Abundance of Pfam domains associated to transposable elements. (PDF)
Article
Full-text available
Root-knot nematodes (genus Meloidogyne) exhibit a diversity of reproductive modes ranging from obligatory sexual to fully asexual reproduction. Intriguingly, the most widespread and devastating species to global agriculture are those that reproduce asexually, without meiosis. To disentangle this surprising parasitic success despite the absence of s...
Data
Per base coverage distribution of Illumina PE-reads mapped on asexual Meloidogyne genomes. Two peaks are observed. One corresponding to the average coverage of the genome and a second at ~ twice the coverage of the first peak. This second peak shows that a substantial portion of the genomes has a twice higher coverage. Sequences with this twice hig...
Data
Mitochondrial phylogeny with branch lengths. Mitochondrial phylogenetic tree of Meloidogyne with actual branch lengths showing high identity level between apomictic root-knot nematodes. (PDF)
Data
Functional annotation of genes under positive selection (Ka/Ks >1). (XLSX)
Data
Species list and sequence accession number for the mitochondrial phylogeny. (PDF)
Data
Statistics of genome reads used for genome assemblies. (PDF)
Data
Circos and corresponding phylogenies for genomic regions in one copy in M. hapla and two or more copies in asexual Meloidogyne. In each Circo (unit = kb), color codes between collinear blocks are as follows. Collinear orthologs between M. hapla and any of the three asexuals species in grey. Collinear ‘homoeologs’ within asexual species in purple. C...
Data
Functional annotation of genes under episodic diversifying selection (EDS). (XLSX)
Article
Full-text available
The domesticated sunflower, Helianthus annuus L., is a global oil crop that has promise for climate change adaptation, because it can maintain stable yields across a wide variety of environmental conditions, including drought. Even greater resilience is achievable through the mining of resistance alleles from compatible wild sunflower relatives, in...
Article
Full-text available
The legume-Rhizobium symbiosis leads to the formation of a new organ, the root nodule, involving coordinated and massive induction of specific genes. Several genes controlling DNA methylation are spatially regulated within the Medicago truncatula nodule, notably the demethylase gene, DEMETER (DME), which is mostly expressed in the differentiation z...
Article
Full-text available
Nod factors (NF) are lipochitooligosaccharidic signal molecules produced by rhizobia, which play a key role in the rhizobium-legume symbiotic interaction. In this study, we analyzed the gene expression reprogramming induced by purified NF (4h and 24h of treatment) in the root epidermis of the model legume Medicago truncatula. Tissue-specific transc...
Preprint
Full-text available
Root-knot nematodes (genus Meloidogyne ) show an intriguing diversity of reproductive modes ranging from obligatory sexual to fully asexual reproduction. Intriguingly, the most damaging species to the world agriculture are those that reproduce without meiosis and without sex. To understand this parasitic success despite the absence of sex and genet...
Article
Full-text available
The obligate biotroph oomycete Plasmopara halstedii causes downy mildew on sunflower crop, Helianthus annuus. The breakdown of several Pl resistance genes used in sunflower hybrids over the last 25 years came along with the appearance of new Pl. halstedii isolates showing modified virulence profiles. In oomycetes, two classes of effector proteins,...
Data
(A) International nomenclature of Pl. halstedii pathotypes based on the virulence profile of a given isolate on 9 differential sunflower lines (D1-D9) selected according to their resistance patterns [3]. Resistance (R) and susceptibility (S) are defined by the absence or presence of disease symptoms and sporulation on leaves 2–3 weeks after inocula...
Data
Effector polymorphisms, PCR programs, and primers used for KASP markers. The position of the polymorphism relative to the start of the CDS is indicated in parentheses. Sequences of specific primers are respectively added at 5’ end by FAM tag (GAAGGTGACCAAGTTCATGCT) or VIC tag (GAAGGTCGGAGTCAACGGATT). (TIF)
Data
Description of the 54 putative effectors identified in Pl. halstedii and their polymorphisms. The table lists EST names of effectors and their corresponding PSI-tBLASTn best values against an oomycete effector gene database generated from Genebank, the effector names and their conserved motifs, and eventual signal peptide predictions. For each effe...
Data
Genomic sequences of the 54 Pl.halstedii effector genes in 7 pathotypes. The pathotype name is indicated in the effector sequence name after the underscore sign (for example: PhCRN01_100). (PDF)
Article
Full-text available
Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicill...
Article
Full-text available
Background Legume roots show a remarkable plasticity to adapt their architecture to biotic and abiotic constraints, including symbiotic interactions. However, global analysis of miRNA regulation in roots is limited, and a global view of the evolution of miRNA-mediated diversification in different ecotypes is lacking. Results In the model legume Me...
Article
RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family wo...
Article
Full-text available
Unlabelled: It is now easy and increasingly usual to produce oriented RNA-Seq data as a prokaryotic genome is being sequenced. However, this information is usually just used for expression quantification. EuGene-PP is a fully automated pipeline for structural annotation of prokaryotic genomes integrating protein similarities, statistical informati...
Article
Full-text available
Rhizobium-induced root nodules are organs specialized for symbiotic nitrogen fixation. Indeterminate-type nodules are formed from an apical meristem and exhibit a spatial zonation which corresponds to successive developmental stages. To get a dynamic and integrated view of plant and bacterial gene expression associated with nodule development, we s...
Article
Full-text available
While the extent and impact of horizontal transfers in prokaryotes are widely acknowledged, their importance to the eukaryotic kingdom is unclear and thought by many to be anecdotal. Here we report multiple recent transfers of a huge genomic island between Penicillium spp. found in the food environment. Sequencing of the two leading filamentous fun...
Article
Full-text available
The availability of next-generation sequences of transcripts from prokaryotic organisms offers the opportunity to design a new generation of automated genome annotation tools not yet available for prokaryotes. In this work, we designed EuGene-P, the first integrative prokaryotic gene finder tool which combines a variety of high-throughput data, inc...
Article
Full-text available
Legumes (Fabaceae or Leguminosae) are unique among cultivated plants for their ability to carry out endosymbiotic nitrogen fixation with rhizobial bacteria, a process that takes place in a specialized structure known as the nodule. Legumes belong to one of the two main groups of eurosids, the Fabidae, which includes most species capable of endosymb...
Article
Full-text available
We sequenced and assembled the draft genome of Theobroma cacao, an economically important tropical-fruit tree crop that is the source of chocolate. This assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of these genes anchored on the 10 T. cacao chromosomes. Analysis of this sequen...
Article
Full-text available
We sequenced and assembled the genome of Theobroma cacao, an economically important tropical fruit tree crop that is the source of chocolate. The assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of them anchored on the 10 T. cacao chromosomes. Analysis of this sequence information...
Article
Full-text available
Posttranscriptional regulation of a variety of mRNAs by small 21- to 24-nucleotide RNAs, notably the microRNAs (miRNAs), is emerging as a novel developmental mechanism. In legumes like the model Medicago truncatula, roots are able to develop a de novo meristem through the symbiotic interaction with nitrogen-fixing rhizobia. We used deep sequencing...
Article
Full-text available
© 2008 Nature Publishing Group. This article is distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike license. The definitive version was published in Nature Biotechnology 26 (2008): 909-915, doi:10.1038/nbt.1482. Plant-parasitic nematodes are major agricultural pests worldwide and novel approaches to control the...
Conference Paper
MicroRNAs (miRNAs) are small non-coding RNAs of about 21nt and important regulators of gene expression. In Medicago truncatula (Mt), about 600 miRNAs have been identified but the extent to which miRNA pathways contribute to innate immunity during plant-pathogen interactions remains unknown. The bacterium Ralstonia solanacearum (Rs) and the fungus V...
Conference Paper
Root developmental plasticity is a major agricultural trait controlling plant adaptation to environmental constraints, such as nutrient deficiency or abiotic stresses. In legumes, root system architecture is determined by the formation of two different organs, lateral roots and symbiotic nitrogen-fixing nodules. Comparative transcriptomic analyses...
Conference Paper
With the advent of new generation sequencing, the annotation of new prokaryotic (symbiont) genomic sequences increasingly occurs in a data-rich context, including a variety of libraries of short reads of transcriptomic sequences. This creates new opportunities in annotation. In this talk, I will introduce the new prokaryotic variant of the integrat...