Jordi Barbé

Autonomous University of Barcelona, Cerdanyola del Vallès, Catalonia, Spain

Are you Jordi Barbé?

Claim your profile

Publications (199)563.4 Total impact

  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Swarming, a flagellar-driven multicellular form of motility, is associated with bacterial virulence and increased antibiotic resistance. In this work we demonstrate that activation of the SOS response reversibly inhibits swarming motility by preventing the assembly of chemoreceptor-signaling polar arrays. We also show that an increase in the concentration of the RecA protein, generated by SOS system activation, rather than another function of this genetic network impairs chemoreceptor polar cluster formation. Our data provide evidence that the molecular balance between RecA and CheW proteins is crucial to allow polar cluster formation in Salmonella enterica cells. Thus, activation of the SOS response by the presence of a DNA-injuring compound increases the RecA concentration, thereby disturbing the equilibrium between RecA and CheW and resulting in the cessation of swarming. Nevertheless, when the DNA-damage decreases and the SOS response is no longer activated, basal RecA levels and thus polar cluster assembly are reestablished. These results clearly show that bacterial populations moving over surfaces make use of specific mechanisms to avoid contact with DNA-damaging compounds.
    Full-text · Article · Jan 2016 · PLoS ONE
  • [Show abstract] [Hide abstract]
    ABSTRACT: Acinetobacter baumannii , a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarine novobiocin, which inhibits the DNA damage response in gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis.
    No preview · Article · Oct 2015 · Antimicrobial Agents and Chemotherapy
  • [Show abstract] [Hide abstract]
    ABSTRACT: The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria, LexA is known to target a palindromic sequence with the consensus sequence CTGT-N8- ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus. In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales. Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria. However, their lexA gene is unrelated to the standard Betaproteobacteria lexA, and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria, suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis-type motif an optimal interface for multiple LexA sequences.
    No preview · Article · May 2015 · Journal of bacteriology
  • [Show abstract] [Hide abstract]
    ABSTRACT: The effect of antimicrobials on SOS-mediated mutagenesis induction depends on the bacterial species and the antimicrobial group. In this work, we studied the effect of different families of antimicrobial agents used in clinical therapy against Acinetobacter baumannii in the induction of mutagenesis in this multiresistant Gram-negative pathogen. The data showed that ciprofloxacin and tetracycline induce SOS-mediated mutagenesis, whereas colistin and meropenem, which are extensively used in clinical therapy, do not.
    No preview · Article · Apr 2015 · Antimicrobial Agents and Chemotherapy
  • [Show abstract] [Hide abstract]
    ABSTRACT: Non-typeable Haemophilus infl uenzae (NTHi) is an opportunist pathogen well adapted to the human upper respiratory tract and responsible for many respiratory diseases. In the human airway, NTHi is exposed to pollutants, such as alkylating agents, that damage its DNA. In this study, we examined the significance of genes involved in the repair of DNA alkylation damage in NTHi virulence. Two knockout mutants, tagI and mfd, encoding N3methyladenine-DNA glycosylase I and the key protein involved in transcription-coupled repair, respectively, were constructed and their virulence in a BALB/c mice model was examined. This work shows that N3-methyladenine-DNA glycosylase I is constitutively expressed in NTHi and that it is relevant for its virulence. © 2014, Sociedad Espanola de Microbiologia. All rights reserevd.
    No preview · Article · Jan 2015 · International Microbiology

  • No preview · Article · Oct 2014 · Veterinary Microbiology
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The RecA protein is the main bacterial recombinase and the activator of the SOS system. In Escherichia coli and Salmonella enterica sv. Typhimurium, RecA is also essential for swarming, a flagellar-driven surface translocation mechanism widespread among bacteria. In this work, the direct interaction between RecA and the CheW coupling protein was confirmed, and the motility and chemotactic phenotype of a S. Typhimurium ΔrecA mutant was characterized through microfluidics, optical trapping, and quantitative capillary assays. The results demonstrate the tight association of RecA with the chemotaxis pathway and also its involvement in polar chemoreceptor cluster formation. RecA is therefore necessary for standard flagellar rotation switching, implying its essential role not only in swarming motility but also in the normal chemotactic response of S. Typhimurium.
    Full-text · Article · Aug 2014 · PLoS ONE
  • [Show abstract] [Hide abstract]
    ABSTRACT: Introducción: Acinetobacter baumannii es uno de los principales agentes causante de infecciones nosocomiales, produciendo brotes alrededor de todo el mundo [1]. Alarmantemente, muchos aislados clínicos son resistentes a casi todos los antibióticos de uso clínico, hecho que implica que algunas infecciones de A. baumannii sean intratables [2]. En la cepa de A. baumannii ATCC 17978, se han identificado 2 operones homólogos a umuDC (0636-7 y 1174-3) y un gen homólogo a umuD [3], todos ellos implicados en la mutagénesis inducida por daño en el DNA [4, 5]. El objetivo de este trabajo ha sido establecer la relación entre el tratamiento de este patógeno con distintos grupos de antibióticos y su capacidad de generar mutagénesis mediante la inducción de genes que codifican componentes de DNA polimerasas tendentes a error. Métodos: La inducción de los genes que codifican componentes de DNA polimerasas tendentes a error mediante el tratamiento con antibióticos se estudió a través de RT-PCR en tiempo real. Los análisis de mutagénesis se realizaron determinando la frecuencia de aparición de clones resistentes a rifampicina. Resultados: Los datos obtenidos muestran que todos los genes identificados en la cepa A. baumannii ATCC 17978 que codifican componentes de la DNA polimerasa V tendente a error (UmuDC) se inducen en presencia de varios antibióticos de uso clínico pertenecientes a los grupos de las quinolonas, los aminoglucósidos y las tetraciclinas. Sin embargo antibióticos pertenecientes a los grupos de los β-lactámicos y de las polimixinas no los inducen. Además, la inducción de estos genes se corresponde con un incremento de la tasa de mutagénesis en este patógeno. Conclusiones: La utilización de carbapenemes o colistina frente a A. baumannii no comporta el aumento de la generación de clones resistentes por mutaciones en el genoma de esta especie bacteriana.
    No preview · Conference Paper · Jun 2014
  • [Show abstract] [Hide abstract]
    ABSTRACT: The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from that of the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene, the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.
    No preview · Article · Dec 2013 · Antimicrobial Agents and Chemotherapy
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
    Full-text · Article · Oct 2013 · Journal of bacteriology
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: This paper addresses the use of bacteriophages immobilized on magnetic particles for the biorecognition of the pathogenic bacteria, followed by electrochemical magneto-genosensing of the bacteria. The P22 bacteriophage specific to Salmonella (serotypes A, B, and D1) is used as a model. The bacteria are captured and preconcentrated by the bacteriophage-modified magnetic particles through the host interaction with high specificity and efficiency. DNA amplification of the captured bacteria is then performed by double-tagging polymerase chain reaction (PCR). Further detection of the double-tagged amplicon is achieved by electrochemical magneto-genosensing. The strategy is able to detect in 4 h as low as 3 CFU mL-1 of Salmonella in Luria-Bertani (LB) media. This approach is compared with conventional culture methods and PCR-based assay, as well as with immunological screening assays for bacteria detection, highlighting the outstanding stability and cost-efficient and animal-free production of bacteriophages as biorecognition element in biosensing devices.
    Full-text · Article · Feb 2013 · Analytical Chemistry
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The Streptococcus suis 103 gene product is an immunogenic and protective lipoprotein that is a component of an ATP-binding cassette transporter implicated in zinc uptake. Belonging to the same transcriptional unit and downstream of the 103 gene is a gene that encodes a homologue of the pneumococcal histidine triad (Pht) protein Pht309. In an intraperitoneal mouse model the virulence of a mutant lacking the 103 gene was more than 50 times lower than that of the wild-type (WT) parent strain, S. suis serotype 2 strain P1/7. In addition, the immunogenicity of this mutant was dramatically decreased. In striking contrast, the virulence and immunogenicity of a P1/7 mutant lacking the Pht309 gene were similar to those of the parent strain. These results demonstrate that the 103 lipoprotein is strongly involved in S. suis virulence and support the hypothesis that this lipoprotein might be an excellent candidate for vaccines aiming to achieve broad protection against streptococci.
    Full-text · Article · Jul 2012 · Canadian journal of veterinary research = Revue canadienne de recherche vétérinaire
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: The SOS response is a well-known regulatory network present in most bacteria and aimed at addressing DNA damage. It has also been linked extensively to stress-induced mutagenesis, virulence and the emergence and dissemination of antibiotic resistance determinants. Recently, the SOS response has been shown to regulate the activity of integrases in the chromosomal superintegrons of the Vibrionaceae, which encompasses a wide range of pathogenic species harboring multiple chromosomes. Here we combine in silico and in vitro techniques to perform a comparative genomics analysis of the SOS regulon in the Vibrionaceae, and we extend the methodology to map this transcriptional network in other bacterial species harboring multiple chromosomes. Our analysis provides the first comprehensive description of the SOS response in a family (Vibrionaceae) that includes major human pathogens. It also identifies several previously unreported members of the SOS transcriptional network, including two proteins of unknown function. The analysis of the SOS response in other bacterial species with multiple chromosomes uncovers additional regulon members and reveals that there is a conserved core of SOS genes, and that specialized additions to this basic network take place in different phylogenetic groups. Our results also indicate that across all groups the main elements of the SOS response are always found in the large chromosome, whereas specialized additions are found in the smaller chromosomes and plasmids. Our findings confirm that the SOS response of the Vibrionaceae is strongly linked with pathogenicity and dissemination of antibiotic resistance, and suggest that the characterization of the newly identified members of this regulon could provide key insights into the pathogenesis of Vibrio. The persistent location of key SOS genes in the large chromosome across several bacterial groups confirms that the SOS response plays an essential role in these organisms and sheds light into the mechanisms of evolution of global transcriptional networks involved in adaptability and rapid response to environmental changes, suggesting that small chromosomes may act as evolutionary test beds for the rewiring of transcriptional networks.
    Full-text · Article · Feb 2012 · BMC Genomics
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: RecA is the major enzyme involved in homologous recombination and plays a central role in SOS mutagenesis. In Acinetobacter spp., including Acinetobacter baumannii , a multidrug-resistant bacterium responsible for nosocomial infections worldwide, DNA repair responses differ in many ways from those of other bacterial species. In this work, the function of A. baumannii RecA was examined by constructing a recA mutant. Alteration of this single gene had a pleiotropic effect, showing the involvement of RecA in DNA damage repair and consequently in cellular protection against stresses induced by DNA damaging agents, several classes of antibiotics, and oxidative agents. In addition, the absence of RecA decreased survival in response to both heat shock and desiccation. Virulence assays in vitro (with macrophages) and in vivo (using a mouse model) similarly implicated RecA in the pathogenicity of A. baumannii . Thus, the data strongly suggest a protective role for RecA in the bacterium and indicate that inactivation of the protein can contribute to a combined therapeutic approach to controlling A. baumannii infections.
    Full-text · Article · Jun 2011 · Journal of bacteriology
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Previous studies have established that the expression of Salmonella enterica pathogenicity island 1 (SPI1), which is essential for epithelial invasion, is mainly regulated by the HilD protein. The ferric uptake regulator, Fur, in turn modulates the expression of the S. enterica hilD gene, albeit through an unknown mechanism. Here we report that S. enterica Fur, in its metal-bound form, specifically binds to an AT-rich region (BoxA), located upstream of the hilD promoter (P(hilD)), at position -191 to -163 relative to the hilD transcription start site. Furthermore, in a P(hilD) variant with mutations in BoxA, P(hilD*), Fur·Mn(2+) binding is impaired. In vivo experiments using S. enterica strains carrying wild-type P(hilD) or the mutant variant P(hilD*) showed that Fur activates hilD expression, while in vitro experiments revealed that the Fur·Mn(2+) protein is sufficient to increase hilD transcription. Together, these results present the first evidence that Fur·Mn(2+), by binding to the upstream BoxA sequence, directly stimulates the expression of hilD in S. enterica.
    Full-text · Article · May 2011 · PLoS ONE
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Integrons are found in hundreds of environmental bacterial species, but are mainly known as the agents responsible for the capture and spread of antibiotic-resistance determinants between Gram-negative pathogens. The SOS response is a regulatory network under control of the repressor protein LexA targeted at addressing DNA damage, thus promoting genetic variation in times of stress. We recently reported a direct link between the SOS response and the expression of integron integrases in Vibrio cholerae and a plasmid-borne class 1 mobile integron. SOS regulation enhances cassette swapping and capture in stressful conditions, while freezing the integron in steady environments. We conducted a systematic study of available integron integrase promoter sequences to analyze the extent of this relationship across the Bacteria domain. Our results showed that LexA controls the expression of a large fraction of integron integrases by binding to Escherichia coli-like LexA binding sites. In addition, the results provide experimental validation of LexA control of the integrase gene for another Vibrio chromosomal integron and for a multiresistance plasmid harboring two integrons. There was a significant correlation between lack of LexA control and predicted inactivation of integrase genes, even though experimental evidence also indicates that LexA regulation may be lost to enhance expression of integron cassettes. Ancestral-state reconstruction on an integron integrase phylogeny led us to conclude that the ancestral integron was already regulated by LexA. The data also indicated that SOS regulation has been actively preserved in mobile integrons and large chromosomal integrons, suggesting that unregulated integrase activity is selected against. Nonetheless, additional adaptations have probably arisen to cope with unregulated integrase activity. Identifying them may be fundamental in deciphering the uneven distribution of integrons in the Bacteria domain.
    Full-text · Article · Apr 2011 · Mobile DNA
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Phage-mediated transfer of microbial genetic elements plays a crucial role in bacterial life style and evolution. In this study, we identify the RinA family of phage-encoded proteins as activators required for transcription of the late operon in a large group of temperate staphylococcal phages. RinA binds to a tightly regulated promoter region, situated upstream of the terS gene, that controls expression of the morphogenetic and lysis modules of the phage, activating their transcription. As expected, rinA deletion eliminated formation of functional phage particles and significantly decreased the transfer of phage and pathogenicity island encoded virulence factors. A genetic analysis of the late promoter region showed that a fragment of 272 bp contains both the promoter and the region necessary for activation by RinA. In addition, we demonstrated that RinA is the only phage-encoded protein required for the activation of this promoter region. This region was shown to be divergent among different phages. Consequently, phages with divergent promoter regions carried allelic variants of the RinA protein, which specifically recognize its own promoter sequence. Finally, most Gram-postive bacteria carry bacteriophages encoding RinA homologue proteins. Characterization of several of these proteins demonstrated that control by RinA of the phage-mediated packaging and transfer of virulence factor is a conserved mechanism regulating horizontal gene transfer.
    Full-text · Article · Mar 2011 · Nucleic Acids Research
  • [Show abstract] [Hide abstract]
    ABSTRACT: In streptococci, the pleiotropic regulators AdcR and Fur control the transport of, zinc and iron, respectively, which are essential components of many proteins. In this work, DeltaadcR, Deltafur, and DeltaadcR Deltafur mutants of Streptococcus suis, a serious pathogen in pigs and humans, were assayed in a mouse model to determine their involvement in the virulence of this bacterium. The results showed, for the first time, that the virulence of S. suis mutants carrying an inactivation of adcR, fur, or both genes is significantly attenuated compared to the wild-type parent strain. Furthermore, all mutants were found to be more sensitive to oxidative stress. Our data provide evidence that the adcR and fur genes play important roles in the oxidative stress response of S. suis as well as in the full virulence of this bacterium.
    No preview · Article · Jul 2010 · Veterinary Microbiology
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Transcription of the Salmonella enterica recA gene is negatively controlled by the LexA protein, the repressor of the SOS response. The introduction of a mutation (recAo6869) in the LexA binding site, in the promoter region of the S. enterica ATCC 14028 recA gene, allowed the analysis of the effect that RecA protein overproduction has on the fitness of this virulent strain. The fitness of orally but not intraperitoneally inoculated recAo6869 cells decreased dramatically. However, the SOS response of this mutant was induced normally, and there was no increase in the sensitivity of the strain toward DNA-damaging agents, bile salts, or alterations in pH. Nevertheless, S. enterica recAo6869 cells were unable to swarm and their capacity to cross the intestinal epithelium was significantly reduced. The swarming deficiency in recAo6869 cells is independent of the flagellar phase. Moreover, swimming activity of the recAo6869 strain was not diminished with respect to the wild type, indicating that the flagellar synthesis is not affected by RecA protein overproduction. In contrast, swarming was recovered in a recAo6869 derivative that overproduced CheW, a protein known to be essential for this function. These data demonstrate that an equilibrium between the intracellular concentrations of RecA and CheW is necessary for swarming in S. enterica. Our results are the first to point out that the SOS response plays a critical role in the prevention of DNA damage by abolishing bacterial swarming in the presence of a genotoxic compound.
    Full-text · Article · Jul 2010 · Infection and immunity
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Staphylococcal superantigen-carrying pathogenicity islands (SaPIs) are discrete, chromosomally integrated units of approximately 15 kilobases that are induced by helper phages to excise and replicate. SaPI DNA is then efficiently encapsidated in phage-like infectious particles, leading to extremely high frequencies of intra- as well as intergeneric transfer. In the absence of helper phage lytic growth, the island is maintained in a quiescent prophage-like state by a global repressor, Stl, which controls expression of most of the SaPI genes. Here we show that SaPI derepression is effected by a specific, non-essential phage protein that binds to Stl, disrupting the Stl-DNA complex and thereby initiating the excision-replication-packaging cycle of the island. Because SaPIs require phage proteins to be packaged, this strategy assures that SaPIs will be transferred once induced. Several different SaPIs are induced by helper phage 80alpha and, in each case, the SaPI commandeers a different non-essential phage protein for its derepression. The highly specific interactions between different SaPI repressors and helper-phage-encoded antirepressors represent a remarkable evolutionary adaptation involved in pathogenicity island mobilization.
    Full-text · Article · Jun 2010 · Nature

Publication Stats

4k Citations
563.40 Total Impact Points

Institutions

  • 1982-2015
    • Autonomous University of Barcelona
      • • Department of Genetics and Microbiology
      • • Faculty of Bioscience
      • • Faculty of Sciences
      Cerdanyola del Vallès, Catalonia, Spain
  • 2011
    • University of the Balearic Islands
      Palma, Balearic Islands, Spain
    • University of Maryland, Baltimore County
      • Department of Biological Sciences
      Baltimore, Maryland, United States
  • 2010
    • Universidad Pública de Navarra
      • Instituto de Agrobiotecnología
      Iruña, Navarre, Spain
  • 2006
    • CReSA Research Centre for Animal Health
      Cerdanyola del Vallès, Catalonia, Spain
  • 1985-2004
    • University of Barcelona
      • • Departament d'Anatomia Patològica, Farmacologia i Microbiologia
      • • Department of Microbiology
      • • Department of Pathological Anatomy, Pharmacology and Microbiology
      Barcino, Catalonia, Spain