Josiane Courtois

Université de Picardie Jules Verne, Amiens, Picardie, France

Are you Josiane Courtois?

Claim your profile

Publications (107)

  • [Show abstract] [Hide abstract] ABSTRACT: The efficacy of two algal saccharides, glucuronan and oligoglucuronans (average degree of polymerization = 3), against postharvest blue mold (Penicillium expansum) and gray mold (Botrytis cinerea) on apple fruit (Malus domestica Borkh. cv Golden Delicious) and the related-defense responses involved were evaluated. The severity of both blue and gray mold in apple fruits was reduced with the greatest efficacy being achieved using oligoglucuronans. Moreover, glucuronan and its oligomers trigger a rapid and transient accumulation of hydrogen peroxide (H2O2) as well as the activation of antioxidant-related enzymes, namely catalase (CAT) and superoxide dismutase (SOD). These algal saccharides increased also the activities of phenylalanine ammonialyase (PAL), peroxydase (POD), and polyphenoloxydase (PPO) as well as the levels of lignin and phenolic compounds. These results suggest that the protective effects of glucuronan and oligoglucuronans on apple might be due to its ability on activating an onset-related defensive enzymes and metabolites instead of its direct antifungal activity on the pathogens. These findings showed that glucuronan and even more oligoglucuronans treatments could be a promising method to reduce dependency on synthetic fungicides.
    Article · Aug 2016 · Journal of Applied Phycology
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: β-Aminobutyric acid (BABA) is a non-protein amino acid that induces drought tolerance in plants. The mechanisms involved in this tolerance are still poorly understood. In the present study, metabolomic and ionomic profiling performed in flax (Linum usitatissimum) leaves revealed that BABA induces a major reorganization in solute content. This reorganization resulted in increased accumulation of non-structural carbohydrates and proline and a decrease in inorganic solutes. This response has high similarities with that obtained when flax is exposed to an osmotic stress. BABA treatment also induced a decrease in osmotic potential and a change in water status of flax leaves. These modifications are accompanied by an improvement in drought tolerance.
    Full-text Article · Mar 2015 · Metabolomics
  • Source
    Clothilde Bertin · Corinne Pau-Roblot · Josiane Courtois · [...] · François Thiaucourt
    [Show abstract] [Hide abstract] ABSTRACT: Mycoplasmas of the Mycoplasma mycoides cluster are all ruminant pathogens. Mycoplasma mycoides subsp. mycoides is responsible for contagious bovine pleuropneumonia and is known to produce capsular polysaccharide (CPS) and exopolysaccharide (EPS). Previous studies have strongly suggested a role for Mycoplasma mycoides subsp. mycoides polysaccharides in pathogenicity. Mycoplasma mycoides subsp. mycoides-secreted EPS was recently characterized as a β(1→6)-galactofuranose homopolymer (galactan) identical to the capsular product. Here, we extended the characterization of secreted polysaccharides to all other members of the M. mycoides cluster: M. capricolum subsp. capripneumoniae, M. capricolum subsp. capricolum, M. leachii, and M. mycoides subsp. capri (including the LC and Capri serovars). Extracted EPS was characterized by nuclear magnetic resonance, resulting in the identification of a homopolymer of β(1→2)-glucopyranose (glucan) in M. capricolum subsp. capripneumoniae and M. leachii. Monoclonal antibodies specific for this glucan and for the Mycoplasma mycoides subsp. mycoides-secreted galactan were used to detect the two polysaccharides. While M. mycoides subsp. capri strains of serovar LC produced only capsular galactan, no polysaccharide could be detected in strains of serovar Capri. All strains of M. capricolum subsp. capripneumoniae and M. leachii produced glucan CPS and EPS, whereas glucan production and localization varied among M. capricolum subsp. capricolum strains. Genes associated with polysaccharide synthesis and forming a biosynthetic pathway were predicted in all cluster members. These genes were organized in clusters within two loci representing genetic variability hot spots. Phylogenetic analysis showed that some of these genes, notably galE and glf, were acquired via horizontal gene transfer. These findings call for a reassessment of the specificity of the serological tests based on mycoplasma polysaccharides.
    Full-text Article · Jan 2015 · Applied and Environmental Microbiology
  • [Show abstract] [Hide abstract] ABSTRACT: The effects of two algal saccharides, ulvan and oligoulvans (average degree of polymerization = 2), on defense-related responses and decay development in apple fruit (Malus domestica Borkh. cv Golden Delicious) were investigated. Our results show that both ulvan and oligoulvans reduced significantly (P < 0.05) lesion diameter in inoculated fruit. Differently, blue and grey mold decays were inhibited completely (P < 0.01) in oligoulvan-treated fruit. Moreover, ulvan and oligoulvans trigger a rapid and transient accumulation of hydrogen peroxide (H2O2) as well as the activation of antioxidant-related enzymes namely catalase (CAT) and superoxide dismutase (SOD). These algal saccharides increased also the activities of phenylalanine ammonialyase (PAL), peroxydase (POD) and polyphenoloxydase (PPO) as well as the levels of lignin and phenolic compounds, all of which were involved in phenylpropanoid metabolism. Considering all the defense-tested parameters, oligoulvans were more effective than ulvan. The obtained results highlight the efficiency of oligosaccharides with low degree of polymerization (DP) on inducing an onset of defense-related enzymes and metabolites. Together, the data showed that ulvan and even more oligoulvan treatments could be promising method to reduce dependency on synthetic fungicides.
    Article · Nov 2014 · Scientia Horticulturae
  • Source
    Christelle Harscoat · Michel Y Jaffrin · Patrick Paullier · [...] · Josiane Courtois
    Full-text Dataset · Sep 2014
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Plant metabolite profiling is commonly carried out by GC-MS of methoximated trimethylsilyl (TMS) derivatives. This technique is robust and enables a library search for spectra produced by electron ionization. However, recent articles have described problems associated with the low stability of some TMS derivatives. This limits the use of GC-MS for metabolomic studies that need large sets of qualitative and quantitative analyses. The aim of this work is to determine the experimental conditions in which the stability of TMS derivatives could be improved. This would facilitate the analysis of the large-scale experimental designs needed in the metabolomics approach. For good repeatability, the sampling conditions and the storage temperature of samples during analysis were investigated. Multiple injections of one sample from one vial led to high variations while injection of one sample from different vials improved the analysis. However, before injection, some amino acid TMS derivatives were degraded during the storage of vials in the autosampler. Only 10% of the initial quantity of glutamine 3 TMS and glutamate 3 TMS and 66% of α-alanine 2 TMS was detected 48h after derivatization. When stored at 4°C until injection, all TMS derivatives remained stable for 12h; at -20°C, they remained stable for 72h. From the integration of all these results, a detailed analytical procedure is thus proposed. It enables a robust quantification of polar metabolites, useful for further plant metabolomics studies using GC-MS.
    Full-text Article · Sep 2014 · Journal of chromatography. B, Analytical technologies in the biomedical and life sciences
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Plant metabolite profiling is commonly carried out by GC–MS of methoximated trimethylsilyl (TMS) derivatives. This technique is robust and enables a library search for spectra produced by electron ionization. However, recent articles have described problems associated with the low stability of some TMS derivatives. This limits the use of GC–MS for metabolomic studies that need large sets of qualitative and quantitative analyses. The aim of this work is to determine the experimental conditions in which the stability of TMS derivatives could be improved. This would facilitate the analysis of the large-scale experimental designs needed in the metabolomics approach. For good repeatability, the sampling conditions and the storage temperature of samples during analysis were investigated. Multiple injections of one sample from one vial led to high variations while injection of one sample from different vials improved the analysis. However, before injection, some amino acid TMS derivatives were degraded during the storage of vials in the autosampler. Only 10% of the initial quantity of glutamine 3 TMS and glutamate 3 TMS and 66% of α-alanine 2 TMS was detected 48 h after derivatization. When stored at 4 °C until injection, all TMS derivatives remained stable for 12 h; at −20 °C, they remained stable for 72 h. From the integration of all these results, a detailed analytical procedure is thus proposed. It enables a robust quantification of polar metabolites, useful for further plant metabolomics studies using GC–MS.
    Full-text Article · Jan 2014
  • Source
    Anthony Quéro · Roland Molinié · Redouan Elboutachfaiti · [...] · Josiane Courtois
    [Show abstract] [Hide abstract] ABSTRACT: Flax (Linum usitatissimum) is grown for its oil and its fiber. This crop, cultivated in temperate regions, has seen a renewed interest due to the presence of abundant molecules of interest for many applications. Little information is available about the behavior of flax during osmotic stress; yet this is considered a major stress that causes significant yield losses in most crops. To control the presence of this stress better, flax behavior was investigated following the application of osmotic stress and the response was examined by applying increasing concentrations of PEG 8000. This resulted in the reorganization of 32 metabolites and 6 mineral ions in the leaves. The analysis of these two types of solute highlighted the contrasting behavior between a higher metabolite content (particularly fructose, glucose and proline) and a decrease in mineral ions (especially nitrate and potassium) following PEG treatment. However, this reorganization did not lead to a greater accumulation of solutes, with the total amount remaining unchanged in leaves during osmotic stress.
    Full-text Article · Aug 2013 · Journal of plant physiology
  • Source
    Clothilde Bertin · Corinne Pau-Roblot · Josiane Courtois · [...] · Patrice Gaurivaud
    [Show abstract] [Hide abstract] ABSTRACT: Contagious bovine pleuropneumonia is a severe respiratory disease of cattle that is caused by a bacterium of the Mycoplasma genus, namely Mycoplasma mycoides subsp. mycoides (Mmm). In the absence of classical virulence determinants, the pathogenicity of Mmm is thought to rely on intrinsic metabolic functions and specific components of the outer cell surface. One of these latter, the capsular polysaccharide galactan has been notably demonstrated to play a role in Mmm persistence and dissemination. The free exopolysaccharides (EPS), also produced by Mmm and shown to circulate in the blood stream of infected cattle, have received little attention so far. Indeed, their characterization has been hindered by the presence of polysaccharide contaminants in the complex mycoplasma culture medium. In this study, we developed a method to produce large quantities of EPS by transfer of mycoplasma cells from their complex broth to a chemically defined medium and subsequent purification. NMR analyses revealed that the purified, free EPS had an identical β(1->6)-galactofuranosyl structure to that of capsular galactan. We then analyzed intraclonal Mmm variants that produce opaque/translucent colonies on agar. First, we demonstrated that colony opacity was related to the production of a capsule, as observed by electron microscopy. We then compared the EPS extracts and showed that the non-capsulated, translucent colony variants produced higher amounts of free EPS than the capsulated, opaque colony variants. This phenotypic variation was associated with an antigenic variation of a specific glucose phosphotransferase permease. Finally, we conducted in silico analyses of candidate polysaccharide biosynthetic pathways in order to decipher the potential link between glucose phosphotransferase permease activity and attachment/release of galactan. The co-existence of variants producing alternative forms of galactan (capsular versus free extracellular galactan) and associated with an antigenic switch constitutes a finely tuned mechanism that may be involved in virulence.
    Full-text Article · Jul 2013 · PLoS ONE
  • Source
    Dataset: Figure S2
    Clothilde Bertin · Corinne Pau-Roblot · Josiane Courtois · [...] · Patrice Gaurivaud
    [Show abstract] [Hide abstract] ABSTRACT: Schematic representation of the predicted membrane topology of Mmm EpsG (MSC_0108) glycosyltransferase. Numbers indicate the localization of transmembrane helices. DxD (red) and RxxQW (blue) motifs are showed. (TIF)
    Full-text Dataset · Jul 2013
  • Source
    Dataset: Figure S1
    Clothilde Bertin · Corinne Pau-Roblot · Josiane Courtois · [...] · Patrice Gaurivaud
    [Show abstract] [Hide abstract] ABSTRACT: Northern blot hybridization of total RNA of the opaque (OP) and translucent (TR) colony variants of Mmm strain Afadé with a cps (MSC_0109) or rDNA 16S probe. Total RNA extraction and northern blot hybridization was performed as previously described [1]. The rDNA 16S probe was obtained by PCR [2]. Transcription of the rDNA 16S was used to normalize the hybridization. The cps gene probe was obtained by PCR with specific primers (5′ TGATGGATCAACAGATAACACCA 3′ and 5′ TTTGGGCGTGAGTATCAATAAG 3′). (DOC)
    Full-text Dataset · Jul 2013
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: The bacterium Enterobacter ludwigii Ez-185-17, member of the family Enterobacteriaceae, was isolated from the root nodules of plants harvested in the nuclear power region of Chernobyl. Under batch culture conditions, the bacteria produce a high-molecular-mass exopolysaccharide (EPS). After purification, the structure of this EPS was determined using a combinatory approach including monosaccharide composition (GC-FID, HPAEC-PAD) and branching structure determination (GC-MS), as well as 1D/2D NMR (H, C) and ESI-MS (HR, MS/MS) studies of oligosaccharides obtained from mild acid hydrolysis. The EPS was found to be a charged hexasaccharide with a repeating unit composed of d-galactose, d-glucose, l-fucose, d-glucuronic acid (2:1:2:1) and substituted with acyl and pyruvyl groups. The metal-binding properties of the exopolysaccharide were then investigated, and the results seem to indicate that the EPS decreased Cd sequestration in flax seeds.
    Full-text Article · Mar 2013
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Trehalose is a non-reducing disaccharide involved in stress tolerance in plants. To understand better the role of trehalose in the osmotic stress response in linseed (Linum usitatissimum), trehalose content in leaves was studied. First, the method commonly used for sugar determination, high performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD), gave unsatisfactory results and the separation efficiency could not be improved by varying the elution conditions. The same problem was also found in the model plant: Arabidopsis thaliana. After clearly highlighting a co-elution of trehalose in these two species by a trehalase assay and liquid chromatography-high resolution mass spectrometry analysis, gas chromatography-mass spectrometry (GC-MS) was used as the analytical method instead. These results confirmed that trehalose content is currently overestimated by HPAEC-PAD analysis, approximately 7 and 13 times for A. thaliana and linseed respectively. Thus GC-MS gave more satisfactory results for trehalose quantification in plants. With this method, trehalose accumulation was observed in linseed during an osmotic stress (-0.30 MPa), the quantity (31.49 nmol g(-1) dry weight after 48 h) appears too low to assign an osmoprotector or osmoregulator role to trehalose in stressed linseed.
    Full-text Article · Aug 2012 · Physiologia Plantarum
  • Source
    Anthony Quéro · Ophélie Fliniaux · Redouan Elboutachfaiti · [...] · Josiane Courtois
    Full-text Conference Paper · May 2012
  • Cherkaoui El Modafar · Mohamed Elgadda · Redouan El Boutachfaiti · [...] · Josiane Courtois
    [Show abstract] [Hide abstract] ABSTRACT: Poly- and oligosaccharides isolated from the green algae Ulva lactuca were tested for their capacity elicitor of natural defences in tomato seedlings. After internodal infiltration of the bioelicitor solution in the midstem of tomato seedlings, the elicitor capacities were evaluated by determining the activity of phenylalanine ammonia-lyase (PAL) in the leaves located above and below the elicitation site. The results obtained showed that the crude extract of U. lactuca polysaccharides expressed an elicitor capacity of PAL activity in leaves. This expression level was similar and even higher than the ones due to other algae polysaccharides (carrageenan, laminarin and alginate). The crude extract of polysaccharides contained two polysaccharides, the glucuronan (unsulfated homopolymer) and the ulvan (sulfated heteropolymer). The glucuronan had no significant elicitor effect whereas the ulvan induced an elicitor capacity higher than that of the crude polysaccharidic extract. The desulfation of the ulvan caused a suppression of its elicitor capacity of PAL activity. The oligoulvans (sulfated β-Δ-(4,5)-oligorhamnoglucuronans, degree of polymerization average = 2) and the oligoglucuronans (β-Δ-(4,5)-oligoglucuronans, degree of polymerization average = 3) were prepared from the ulvan and the glucuronan using two specific enzymes a ulvan lyase and a glucuronan lyase, purified from the bacterial strain Ochrobactrum sp. PEC2. The treatment of tomato seedlings with the oligoulvans was accompanied by a strong stimulation of PAL activity, reaching a maximum activity of 2–2.5 times higher than that of the ulvan polymer. Although the oligoglucuronans expressed an elicitor capacity in PAL activity twice higher than that of the glucuronan polymer, its induction was less important than the oligoulvans. The high elicitor capacity of these saccharides seemed to be related to sulfate substituents and the rhamnose residues. The stimulation of PAL activity was accompanied by an increase of phenolic compounds content and an induction of salicylic acid in the leaves located above and below the elicitation site. The treatments of tomato seedlings with U. lactuca elicitors significantly reduced wilt development caused by Fusarium oxysporum f. sp. lycopersici. The percent of wilting and mortality after 45 days was markedly reduced when plants were treated with oligoulvans, respectively 44% and 54% compared to the control plants.The whole of these results showed clearly those U. lactuca elicitors, particularly the ulvan and the oligoulvans, induced in tomato seedlings the stimulation of natural systemic defences accompanied by a systemic acquired resistance that seems to be salicylic acid-dependent.
    Article · May 2012 · Scientia Horticulturae
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: From green tea leaves, two distinct pectin fractions were obtained based on their solubility in water. Polyphenols were detected only in the easily water soluble fraction (P1). The estimated uronic acids/neutral sugars ratio was 1.7 in the easily water soluble pectin fraction (P1), and 1.0 in the less water soluble fraction (P2). Homogalacturonan sequences (HGAs) corresponded to about 62% of the P1 pectin fraction but only 47% of the P2 fraction. After degradation of the two pectin fractions by pectin lyase, chemical studies revealed rhamnogalacturonan RG I and RG II regions present in the P1 pectin fraction, whereas only RG I sequences were detected in the P2 pectin fraction. The degree of substitution was lower for HGAs of the P1 pectin fraction than P2. Different acetylation patterns for the two fractions were observed. Polyphenols extracted simultaneously with pectins were present only in HGA fractions from P1.
    Full-text Article · Jan 2011 · Carbohydrate Polymers
  • [Show abstract] [Hide abstract] ABSTRACT: In wheat, little is known about disease resistance inducers and, more specifically, about the biological activities from those derived from endogenous elicitors, such as oligogalacturonides (OGAs). Therefore, we tested the ability of two fractions of OGAs, with polymerization degrees (DPs) of 2-25, to induce resistance to Blumeria graminis f. sp. tritici and defense responses in wheat. One fraction was unacetylated (OGAs-Ac) whereas the second one was 30% chemically acetylated (OGAs+Ac). Infection level was reduced to 57 and 58% relative to controls when OGAs-Ac and OGAs+Ac, respectively, were sprayed 48 h before inoculation. Activities of various defense-related enzymes were then assayed in noninoculated wheat leaves infiltrated with OGAs. Oxalate oxidase, peroxidase, and lipoxygenase were responsive to both OGAs-Ac and OGAs+Ac, which suggests involvement of reactive oxygen species and oxilipins in OGAs-mediated responses in wheat. In inoculated leaves, both fractions induced a similar increase in H₂O₂ accumulation at the site of fungal penetration. However, only OGAs+Ac led to an increase in papilla-associated fluorescence and to a reduction of formed fungal haustoria. Our work provides the first evidence for elicitation and protection effects of preventive treatments with OGAs in wheat and for new properties of acetylated OGAs.
    Article · Dec 2010 · Phytopathology
  • Source
    Xavier Guillot · Laurence Mercier · Brigitte Sangwan · [...] · Fabienne Maupas
    Full-text Conference Paper · Nov 2010
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Raoultella terrigena strain Ez-555-6, isolated from a root nodule of Medicago sativa harvested in the Chernobyl exclusion zone, produces a non-referenced high-molecular-mass exopolysaccharide (EPS). The structure of this EPS was determined using a combination approach including monosaccharide composition (GLC-FID, HPAEC-PAD), determination of glycosylation sites (GLC-EIMS) and 1D/2D NMR ((1)H, (13)C) and ESIMS (HR, MS/MS) studies of oligosaccharides obtained from mild acid hydrolysis. The EPS was found to be a charged pentasaccharide with a repeating unit composed of D-galactose, D-glucose, D-mannose and D-glucuronic acid (1:2:1:1). Lactic acid and O-acetyl substituents were localized on galactose and glucose residues, respectively, as presented in the following structure:
    Full-text Article · Jun 2010 · Carbohydrate research
  • Source
    Full-text Conference Paper · Jun 2010