A preview of this full-text is provided by American Society for Microbiology.
Content available from Journal of Bacteriology
This content is subject to copyright. Terms and conditions apply.
JOURNAL OF BACTERIOLOGY, Jan. 2004, p. 580–587 Vol. 186, No. 2
0021-9193/04/$08.00⫹0 DOI: 10.1128/JB.186.2.580–587.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Expression and Regulation of a Silent Operon, hyf, Coding for
Hydrogenase 4 Isoenzyme in Escherichia coli†
William T. Self,
1
Adnan Hasona,
2
and K. T. Shanmugam
2
*
Department of Molecular Biology and Microbiology, University of Central Florida, Orlando, Florida 32816,
1
and
Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida 32611
2
Received 24 June 2003/Accepted 20 October 2003
On the basis of hyf-lacZ fusion studies, the hyf operon of Escherichia coli, noted for encoding the fourth
hydrogenase isoenzyme (HYD4), is not expressed at a significant level in a wild-type strain. However, mutant
FhlA proteins (constitutive activators of the hyc-encoded hydrogenase 3 isoenzyme) activated hyf-lacZ. HyfR, an
FhlA homolog encoded by the hyfR gene present at the end of the hyf operon, also activated transcription of
hyf-lacZ but did so only when hyfR was expressed from a heterologous promoter. The HYD4 isoenzyme did not
substitute for HYD3 in H
2
production. Optimum expression of hyf-lacZ required the presence of cyclic AMP
receptor protein-cyclic AMP complex and anaerobic conditions when HyfR was the activator.
Three hydrogenase isoenzymes have been identified, puri-
fied, and characterized from Escherichia coli (6, 10, 16, 27, 37).
The structural subunits and accessory proteins needed for
these three isoenzymes are encoded by the hya, hyb,hyc, and
hyp operons (9–11, 26, 29, 30, 34). The hya operon, hyaABC
DEF (30), encodes the hydrogenase 1 (HYD1) isoenzyme and
other accessory proteins required for processing of these sub-
units into the active form. This operon is induced under an-
aerobic conditions in the presence of formate or fumarate,
repressed in the presence of nitrate, and requires acidic pH,
ArcA, and AppY for optimal expression (12, 21, 32). However,
hya mutants have no detectable phenotype (31). The hyb
operon, hybABCDEFG (29), encodes the structural subunits of
HYD2 as well as the needed accessory proteins (9). Based on
genetic and physiological studies, HYD2 is responsible for
uptake of hydrogen as an electron donor during anaerobic
respiration, with fumarate serving as an electron acceptor (24,
29, 45).
The hyc operon encodes the structural subunits and neces-
sary enzyme components to link HYD3 (36) to a unique for-
mate dehydrogenase isoenzyme (FDH-H, encoded by fdhF)
(46) to produce active formate hydrogenlyase complex (FHL)
(10). This protein complex catalyzes the cleavage of formate to
dihydrogen and carbon dioxide. Transcription of the hyc
operon and fdhF requires the FhlA protein, a formate-depen-
dent transcriptional activator (28, 38). In addition to FhlA-
formate, molybdate is also required for transcription of the hyc
operon, and this requirement is in part due to the need for the
ModE-molybdate complex as a secondary activator (40).
ModE, initially characterized as a molybdate-dependent re-
pressor of the modABC operon carrying high-affinity molyb-
date transport genes (18), has subsequently been shown to act
as a positive transcriptional regulator of the hyc operon
(HYD3) as well as of the narXL operon (40), encoding a
nitrate-responsive two-component regulatory system which ac-
tivates transcription of narGHJI (respiratory nitrate reductase)
(17). Additionally, optimal expression of hyc also requires the
catalytic product of MoeA, a protein implicated in the activa-
tion of Mo during Mo-cofactor biosynthesis (19, 20). Mutated
forms of FhlA that are independent of formate and/or molyb-
date have been described previously (42). These mutations are
localized in the unique N-terminal region of the FhlA protein
(23, 42). Deletion of the N-terminal 350 amino acids also
produced an effector-independent transcriptional activator
(FhlA165) (25, 41).
The E. coli genome sequence (8) revealed a 10-gene cluster
(hyfABCDEFGHIJ), which is recognized as being the hyf
operon (the fourth hydrogenase) based on similarity to corre-
sponding Hyc proteins (2, 3). The proteins encoded by the hyf
operon are proposed to constitute a proton-translocating for-
mate hydrogenlyase (2). In support of this proposal,
Bagramyan et al. (4, 5) reported an H
⫹
-K
⫹
exchange reaction
in osmotically stressed E. coli cells which was absent in a hyf
mutant. On the basis of these and other studies, these inves-
tigators proposed that Hyf catalyzes dihydrogen production
and ion transport when the cells are grown at a starting pH of
7.5. Skibinski et al. (43) reported that hyf-lac was expressed in
wild-type E. coli in a formate-dependent manner, with FhlA
serving as the activator. However, the maximum level of -ga-
lactosidase activity produced by hyfA-lac was less than 100 U.
Only when HyfR was produced from a multicopy plasmid was
hyfA-lac expressed at a high level. It has been observed that
mutant strains lacking all three known hydrogenases failed to
produce hydrogenase activity assayed either by viologen reduc-
tion or by a more sensitive tritium exchange assay (J. C. Wendt
and K. T. Shanmugam, unpublished data). These results sug-
gest that the fourth hydrogenase encoded by the hyf operon is
not produced in E. coli and that the hyf operon is silent in this
organism. In this communication, we report that hyf-lacZ is not
expressed to significant levels in wild-type E. coli, and this fact
is independent of medium and growth conditions. We further
report that hyfA-lacZ can be activated in the presence of ef-
fector-independent mutated forms of FhlA (FhlA132 and
* Corresponding author. Mailing address: Department of Microbi-
ology and Cell Science, Box 110700, University of Florida, Gainesville,
FL 32611. Phone: (352) 392-2490. Fax: (352) 392-5922. E-mail:
shan@ufl.edu.
† Florida Agricultural Experiment Station Journal Series no. R-
09737.
580
FhlA165) or native HyfR produced from a heterologous pro-
moter, even when the gene is at single-copy level. In the pres-
ence of these activators, hyf expression is dioxygen sensitive
and subject to catabolite repression.
Bacterial strains. The bacterial strains, phages, and plasmids
used in this study are listed in Table 1. All strains are deriva-
tives of E. coli K-12.
Media, growth conditions, and materials. Media used for
bacterial growth were previously described (33). Luria broth
(LB) (1.0% tryptone, 0.5% yeast extract, 0.5% NaCl), which
served as rich medium, was supplemented with glucose (0.3%),
sodium formate (15 mM), or sodium molybdate (1 mM) as
needed. Glucose-minimal medium included 44 mM Na
2
HPO
4
,
5.5 mM KH
2
PO
4
, 34 mM NaCl, 41 MNa
2
MoO
4
,36M
TABLE 1. E. coli strains, phages, and plasmids used in this study
Strain, phage, or plasmid Relevant genotype Source or reference
Bacterial strains
BN4020 fur-1::Tn5CGSC no. 7540
BW25113 lacI
q
rrnB
T14
⌬lacZ
W116
hsdR514 araBAD
AH33
⌬rhaBAD
LD78
B. Wanner
RK4353 ⌬(argF-lac)U169 rpsL150 Laboratory collection
YMC18 endA thi hsdR ⌬lac rpoN::Tn10 B. Magasanik
JW138 ⌬hya ⌬hyb ⌽(hycB⬘-lacZ) Laboratory collection
SE1174 fhlA102::Tn10 Laboratory collection
SE1931 fnr zcj::Tn10 Laboratory collection
SE1265 pfl-1 zba::Tn10 Laboratory collection
SE1910 ⌬(modE-Km)218
SE1989 ⌬cya-Km CRP* Laboratory collection
SE2147 moeA113 zbi::Tn10 19
VJS720 modB247::Tn10 V. Stewart
WS219 RK4353 ⌬(hyfB to hyfG)-Cm This study
WS127 ⌬(srl-fhlA)⌬lac WS1-(hycA-lac)41
⌽(hyfA⬘-⬘lacZ) derivatives
WS222 RK4353 WS4 This study
WS228 WS222 fhlA::Tn10 WS222 ⫻(P1)SE1174
WS229 WS222 rpoN::Tn10 WS222 ⫻(P1)YMC18
WS230 WS222 fnr zcj::Tn10 WS222 ⫻(P1)SE1931
WS231 WS222 moeA113 WS222 ⫻(P1)SE2147
WS232 WS222 ⌬(hyfB to hyfG)-Cm WS222 ⫻(P1)WS219
WS233 WS222 pfl-1 zba::Tn10 WS222 ⫻(P1)SE1265
WS235 WS222 modB247::Tn10 WS222 ⫻(P1)VJS720
WS236 WS222 ⌬(modE-Km)2WS222 ⫻(P1)SE1910
WS266 RK4353 WS10 This study
WS267 WS266 modB247::Tn10 WS222 ⫻(P1)VJS720
WS268 WS266 pfl-1 zba::Tn10 WS266 ⫻(P1)SE1265
WS269 WS266 rpoN::Tn10 WS266 ⫻(P1)YMC18
WS270 WS266 fhlA::Tn10 WS266 ⫻(P1)SE1174
WS271 WS266 ⌬(modE-Km)2WS266 ⫻(P1)SE1910
WS272 WS266 ⌬cya-Km WS266 ⫻(P1)SE1989
WS273 WS266 fnr zcj::Tn10 WS266 ⫻(P1)SE1931
WS274 WS266 moeA113 WS266 ⫻(P1)SE2147
WS275 WS266 ⌬(hyfB to hyfG)-Cm WS266 ⫻(P1)WS219
WS280 WS266 fur::Tn5WS266 ⫻(P1)BN4020
AH266 WS222 ⌬(hyfA to hyfJ), Km This study
AH267 WS222 ⌬(hyfR), Km This study
Phages
P1 Tn9Cm
r
clr-100 Laboratory collection
RZ5 ⬘bla ⬘lacZ lacY
⫹
Laboratory collection
WS4 bla
⫹
⌽(hyfA⬘-lacZ)lacY
⫹
This study
WS10 bla
⫹
lacl
q
hyfR
⫹
⌽(hyfA⬘-lacZ)lacY
⫹
This study
Plasmids
PKD4 FRT-kan
⫹
-FRT bla
⫹
B. Wanner
pWS2 pACYC184-fhlA
⫹
This study
pWS132 pACYC184-fhlA132 This study
pWS165 pACYC184-fhlA165 This study
pWS42 pBR322 bcp hyfABCDEFGHIR⬘This study
pWS43 pBR322 nlpB dapA gcvR bcp hyfA⬘This study
pWS44 pBR322 nlpB dapA gcvR bcp hyfA⬘-lacZ This study
pWTS3 pWS42 ⌬hyf-Cm This study
pWTS36 pBR322-lacI
q
hyfR
⫹
bcp hyfA⬘-lacZ This study
pWTS37 pUC19-hyf promoter region This study
pZCam pZ1918-Cm
r
This study
VOL. 186, 2004 NOTES 581
FeSO
4
, 7.5 mM (NH
4
)
2
SO
4
, 0.8 mM MgSO
4
, and 83 mM
glucose. Antibiotics, when included, were used at the following
concentrations: ampicillin, 100 g/ml; tetracycline, 30 g/ml;
chloramphenicol, 50 g/ml (plates) and 10 g/ml (liquid); and
kanamycin, 50 g/ml.
Transduction with phages P1 and was performed as pre-
viously described (33). Genetic and molecular biological ex-
periments were carried out essentially as previously described
(40). Biochemicals were purchased from Sigma Chemical Co.
Other organic and inorganic chemicals came from Fisher Sci-
entific and were of analytical grade. Restriction endonucleases
and DNA-modifying enzymes were purchased from New En-
gland BioLabs and Promega.
Enzyme assays. -Galactosidase activity assays were carried
out using cells in late exponential phase with cells that were
permeabilized with sodium dodecyl sulfate and chloroform as
previously described (33, 40). Units are expressed as
nanomoles 䡠minute
⫺1
䡠(milligram of cell protein)
⫺1
. Under
our experimental conditions, a ⌬lac mutant of E. coli was
assayed at high cell density and produced enough o-nitrophe-
nol to account for about 20 to 50 U of -galactosidase activity.
Due to this extremely low level of o-nitrophenyl--D-galacto-
pyranoside hydrolysis, we used a value of 50 U of -galactosi-
dase activity as the basal level. Specific activity values represent
the average of at least three independent experiments and
varied by less than 15%. FHL activity of the cultures was
determined by using whole cells to minimize dioxygen inacti-
vation of FHL, with formate used as the electron donor (24).
The amount of formate-dependent dihydrogen produced was
determined by gas chromatographic methods (Varian gas
chromatography with thermal conductivity detector and a 5-A
˚
molecular sieve column).
Construction of ⌽(hyfA-lacZ). In order to construct a lacZ
operon fusion for transcriptional analysis of the hyf operon, a
4.3-kb EcoRI-HindIII fragment from Kohara clone no. 424
(22), which carries the hyfA⬘gene and 3.7 kb of upstream
DNA, was cloned into plasmid pBR322 within the unique
EcoRI and HindIII sites. The resulting plasmid, pWS43, was
modified by inserting a 3.2-kb HindIII fragment from plasmid
pZ1918 (39), which carries a promoterless lacZ gene, into the
HindIII site. The resulting plasmid, pWS44, carries a hyfA⬘-
lacZ fusion which is adjacent and opposite in orientation to the
bla gene. In this plasmid, the lac fusion is located 296 bp
downstream of the hyfA translation start site. This hyfA⬘-lacZ
fusion was recombined in vivo with RZ5 as previously de-
scribed (33) in order to yield WS4 (Fig. 1).
Construction of ⌽(hyfA-lacZ)hyfR
ⴙ
.For the construction of
WS10, which carries the hyfA⬘-lacZ operon as well as the
hyfR
⫹
gene, the hyfR gene was amplified from plasmid
pLC32-45 (14) by using two primers, 5⬘-ACTGTCCATGGCT
ATGTCAGACGAG-3⬘and 5⬘-AAAAGAAGCTTACAACA
CCTCGCGA-3⬘. This PCR product was engineered to incor-
porate an NcoI site into the start codon (ATG) of the hyfR
gene and a HindIII site past the translation stop codon. After
amplification by Vent polymerase (New England Biolabs) and
hydrolysis by NcoI and HindIII, the PCR product was ligated
into the NcoI-HindIII sites of vector pTrc99A (1). The result-
ing plasmid, pWTS35, which also carries lacI
q
, expressed the
hyfR gene from the trc promoter at low levels even in the
absence of inducers of the lac operon (13). The lacI
q
and hyfR
genes were removed from plasmid pWTS35 as an NsiI-ScaI
fragment (3.5 kb) and ligated to an NsiI-ScaI fragment from
plasmid pWS44, which carries the hyfA⬘-lacZ DNA. This con-
struct, plasmid pWTS36, contains the hyfR
⫹
gene and hyfA⬘-
lacZ as well as 3.7 kb of hyf upstream DNA. In this construct,
hyfR is still expressed from the trc promoter in the absence of
isopropyl--D-thiogalactopyranoside (IPTG). The E. coli DNA
in plasmid pWTS36 was recombined in vivo with RZ5 as
described previously (33) in order to produce WS10 (Fig. 1).
For the construction of a plasmid which expresses hyfR and
is also chloramphenicol resistant (pWTS34), a Cm
r
cartridge
from plasmid pZCam was removed as a 988-bp HincII frag-
ment and cloned into the FspI site of pTrc99A, thus creating
pTrc99A-Cm. As per the construction of plasmid pWTS35, the
PCR-amplified hyfR gene was cloned into the NcoI-HindIII
sites of plasmid pTrc99A-Cm, resulting in plasmid pWTS34.
Construction of ⌬hyf and ⌬hyfR.Two different deletions of
the hyf operon were constructed. The first, with an internal
deletion between hyfB and hyfG, was constructed by starting
with a 12-kb NdeI fragment from Kohara clone no. 424 (22),
which was cloned into the NdeI site in plasmid vector pBR322.
This plasmid, pWS42, which carries hyfABCDEFGHIJR⬘, was
hydrolyzed with restriction enzyme NsiI so as to release a
5.6-kb internal fragment between the hyfB and hyfG genes
(Fig. 1). This fragment was replaced with a 1.0-kb PstI frag-
ment from pZCam carrying a Cm
r
gene cartridge. The result-
ant plasmid, pWTS3, carries the gene for chloramphenicol
resistance in an orientation opposite to that of the hyf operon
FIG. 1. The hyf DNA from E. coli. Individual genes and direction of transcription are indicated above the line. Promoterless lacZ was inserted
into the HindIII site in the hyfA gene in the construction of WS4 and WS10. The extent of deletion in each of the deletions and the corresponding
strain are indicated.
582 NOTES J. BACTERIOL.
transcription between the hyfB and hyfG genes. The Cm
r
gene
cartridge was expected to have a polar effect on the expression
of downstream hyf (hyfHIJ and possibly hyfR) genes. In order
to replace the wild-type hyf DNA in the chromosome with
⌬(hyfB to hyfG)-Cm DNA, an 8.0-kb NdeI fragment from
pWTS3 containing the Cm
r
gene and the neighboring hyf genes
was removed and self-ligated by using T
4
DNA ligase. This
circular DNA lacks the bla gene and the origin of replication.
Approximately 1 g of the self-ligated 8.0-kb NdeI fragment
was transformed into strain RK4353, and Cm
r
transformants
were selected. One stable Cm
r
clone, strain WS219, was used
in further studies. Cotransduction of the Cm
r
gene with a
narQ::Tn10 mutation by P1 phage transduction confirmed that
the gene for Cm
r
had recombined into the hyf operon.
The second deletion, which removed the entire hyf operon,
was constructed as described previously (15). Hybrid primers
that are complementary to E. coli hyfA and hyfJ and to the
kanamycin gene in plasmid pKD4 (Hyf1, 5⬘-CGCTTTGTGG
TGGCCGAACCACTGTGGTGTACAGGATGTAATACG
TGTAGGCTGGAGCTGCTTC-3⬘, and Hyf2, 5-GGTCAAC
AGGGCGGTGTGGCTGGCGTCAATAACAATCTCACC
AACATATGAATATCCTCCTTAG-3⬘) were obtained from
Sigma-Genosys. Plasmid pKD4 was used as the template for
PCR amplifications. About 1 g of PCR product was electro-
porated into E. coli strain BW25113 with plasmid pKD46 pre-
grown in arabinose in order to induce the red recombinase.
The resulting deletion (of hyfA to hyfJ) was confirmed by PCR.
This mutation was transduced into strain WS222 for further
studies (AH266).
A deletion which removed the entire hyfR gene was con-
structed by using the same method described above based on
the procedures described by Datsenko and Wanner (15). The
two primers used for PCR amplification of DNA and deletion
of the hyfR gene were HyfR1 (5⬘-AAAAATTGCGTGAGAA
GGATTTCTCATTAATAAGGACTGTTGATGGTGTAGG
CTGGAGCTGCTTC-3⬘) and HyfR2 (5⬘-CCATTGGTTTCT
CGCAATACCTGAACAATGCGCTGACGTTCTTCCATA
TGAATATCCTCCTTAG-3⬘). Upon construction, the ⌬hyfR
was transduced into strain WS222 (strain AH267).
The hyf operon is not expressed to significant levels in wild-
type E. coli.Based on genomic analysis, Andrews et al. (2)
proposed that the Hyf hydrogenase, together with the FDH-H,
couples formate oxidation to proton translocation. Recently,
Bagramyan et al. (4, 5) reported that E. coli produced dihydro-
gen from formate which was Hyf dependent and inhibited by
N,N⬘-dicyclohexylcarbodiimide. Production of dihydrogen, cat-
alyzed by the fourth hydrogenase, required both growth of the
culture at a starting pH of 7.5 and exposure to hyperosmotic
stress before the assay. This hydrogenase activity was also
proposed to be responsible for H
⫹
-K
⫹
exchange. These results
suggest that the hyf operon is expressed and that HYD4 isoen-
zyme is produced by E. coli during anaerobic growth at an
alkaline starting pH.
Although the Hyf proteins are similar to the Hyc proteins,
hyc and fhlA mutants are defective in dihydrogen production
(28, 35, 38). E. coli mutants lacking all three known hydroge-
nase isoenzymes did not produce hydrogenase activity as de-
termined by either dihydrogen-dependent dye reduction or by
a more sensitive tritium exchange assay (Wendt and Shan-
mugam, unpublished). In the present study, E. coli mutants
carrying a deletion within the hyf operon (AH266 and WS232)
were cultured at a constant pH of 7.5 or 6.5, and the level of
FHL activity in the cells was determined (Table 2). The parent
and the deletion strains produced comparable levels of FHL
activity when grown at pH 7.5. Although the FHL activity of
cultures grown at a constant pH of 6.5 was higher, again, no
significant difference in the levels of FHL activity between the
parent and deletion strains could be observed. These results
clearly show that the FHL activity observed in the pH 7.5
culture (constant pH) was derived from the HYD3 isoenzyme.
In this regard, the hyf mutant is similar to the hya mutant,
which also lacks a detectable phenotype (31). However, the
HYD1 produced by the hya operon has been purified and
characterized (16, 37), while a hydrogenase corresponding to
Hyf was not detected in E. coli cells or extracts.
In order to evaluate the possibility that the fourth hydroge-
nase is produced in E. coli when cultured under specific me-
dium composition (5), a hyc mutant (strain WS127) was grown
in rich or minimal medium with or without glucose at a starting
pH value of 6.5, 7.0, 7.5, or 8.0 (⫾0.1 M phosphate buffer)
without pH control under a gas phase N
2
atmosphere. These
and other cultures grown with NaCl (0.2 or 0.3 M) at pH 7.5 or
8.0 did not produce any detectable dihydrogen measured as H
2
by gas chromatography (data not presented). Strain JW138,
lacking the three known hydrogenase isoenzyme genes (hya,
hyb, and hyc), grown under similar conditions (initial medium
pH value of 6.5, 7.0, 7.5, or 8.0 [⫾0.1 M phosphate buffer and
⫾0.3 M NaCl]) also did not produce detectable H
2
.
Maturation of the three known hydrogenases requires chap-
erone-like proteins, and the three proteins are interconnected
at this level (9). It is possible that the inability to detect the
fourth hydrogenase activity in a mutant lacking the other three
hydrogenases is related to a need for such a chaperone-like
protein or a specific protease produced by either the hya,hyb,
or hyc operon for processing the fourth hydrogenase precursor
protein to become the active enzyme. In previous studies, we
TABLE 2. Formate hydrogenlyase activities of E. coli cultures
grown in a pH-stat
a
Strain Relevant
genotype Growth medium
FHL activity
(nmol 䡠min
⫺1
䡠mg
of cell protein
⫺1
)
pH 7.5 pH 6.5
WS222
b
Wild type LB ⫹Glu (0.3%) 15 48
AH266 ⌬(hyfA to
hyfJ)
23 56
AH267 ⌬(hyfR)1524
WS222 Wild type LB ⫹Glu (0.1%) ⫹
formate (15 mM)
40 148
AH266 ⌬(hyfA to
hyfJ)
50 129
WS232 ⌬(hyfB to
hyfG)
66 136
AH267 ⌬(hyfR) 83 103
a
Cultures, in the indicated media, were grown anaerobically under argon gas
phase at the indicated pH in a pH-stat. pH was maintained by the addition of 2
N KOH. FHL activity was determined as formate-dependent dihydrogen pro-
duction by using a gas chromatograph. -Galactosidase activities of all these
cultures were below the detection limit of 50 nmol 䡠min
⫺1
䡠(mg of cell pro-
tein)
⫺1
.
b
Strain WS222 carries ⌽(hyfA-lacZ) via WS4.
VOL. 186, 2004 NOTES 583
have observed that the transcription of hycA-lac is unaffected
by deleting the entire srl-fhlA region of the chromosome, which
includes the hyp and hyc operons (41). By analogy, transcrip-
tion of the hyf operon is expected to be independent of the
ability of the coded proteins to function in the cell and thus
should permit analysis of hyf expression as -galactosidase
activity by using a hyf-lacZ derivative.
In order to evaluate the level of transcription of the hyf
operon, a phage carrying the hyfA⬘-lac fusion was con-
structed and inserted into the E. coli chromosome (strain
WS222). Strain WS222 was cultured in a pH-stat at either pH
7.5 or 6.5, and irrespective of culture pH, -galactosidase ac-
tivity was not detected in these cells (data not presented).
StrainWS222 did not produce detectable levels of -galactosi-
dase activity when cultured in either rich medium or minimal
medium under a variety of anaerobic and aerobic growth con-
ditions, including growth at pH 8.0 and in the presence of 0.3
M NaCl—conditions that, according to Bagramyan et al. (5),
support Hyf-dependent activity (data not shown). Likewise,
plasmid pWS44 (hyfA⬘-lacZ construct) used in the construction
of this phage also did not support production of -galacto-
sidase activity either in the wild type or in various E. coli
mutant strains tested (modE,moeA,fur,fnr, and crp mutants;
data not shown). Attempts to isolate point mutations within
the putative promoter region of hyf, which allowed expression
of hyf-lacZ in a wild-type background, were also unsuccessful.
The lack of expression of hyfA-lacZ suggests that this operon is
not expressed under the physiological conditions tested and is
apparently a silent operon. Skibinski et al. (43) reported that
E. coli with a hyf-lacZ fusion produced about 15 U
[nanomoles 䡠minute
⫺1
䡠(mg of protein)
⫺1
]of-galactosidase
activity, which was increased to about 50 U in the presence of
formate. Under our experimental conditions, strain WS222
produced less -galactosidase activity (Table 3) than did a lac
deletion mutant without the phage carrying the fusion. These
results show that the hyf operon is not expressed to significant
levels in wild-type E. coli, and thus this operon should be
considered a silent operon. However, the possibility that the
hyf operon is expressed in the presence of an effector(s) which
is not present in the cytoplasm when E. coli is cultured in the
laboratory cannot be ruled out.
FhlA132 and FhlA165 proteins activate expression of the hyf
operon. The lack of expression of the hyf operon in E. coli
could be due to the absence of an appropriate activator pro-
tein. A gene coding for a putative transcriptional activator,
HyfR, is located at the end of the hyf operon (2). HyfR is
similar to the FhlA protein (44% identical and 54% similar),
which is the formate- and molybdenum-dependent activator of
the hyc operon. HyfR, a protein with 663 amino acids, is miss-
ing the amino acids corresponding to the first 43 amino acids of
the FhlA protein, which contains the region similar to the
ABC-ATPases (41). Except for a stretch of about 60 amino
acids (139 to 195 in HyfR and 179 to 234 in FhlA) in which the
two proteins are 56% identical, HyfR and FhlA are dissimilar
in their unique N-terminal regions. This N-terminal segment of
the FhlA protein was proposed to be essential for formate
binding in vivo (23, 41, 42). These differences in the N-terminal
domain of the two proteins may be responsible for the inability
of FhlA to activate hyfA-lacZ since the fhlA gene is constitu-
tively expressed in anaerobic E. coli. Even when the copy
number of fhlA
⫹
was increased by introducing a plasmid car-
rying the fhlA
⫹
gene (plasmid pWS2), the hyfA-lacZ expression
was below the detection limit. It is apparent that the FhlA
protein, either with or without formate and molybdate, is not
an activator for the hyf operon. Although Skibinski et al. (43)
reported that the FhlA activated hyfA-lac, the level of -galac-
tosidase activity produced by these cultures was only about 20
nmol 䡠min
⫺1
䡠(mg of protein)
⫺1
, and this was increased to
about 50 U of activity in the presence of formate in the growth
medium.
Both point mutations and deletions in the N-terminal do-
main of the FhlA protein were found to be effector indepen-
dent, and some of the deletion derivatives activated hyc to a
higher level than did the native protein (23, 25, 41, 42). Fur-
thermore, the N-terminal domain of FhlA has also been re-
ported to inhibit hyc activation by the deletion derivatives of
FhlA (25). Since the central and C-terminal domains of FhlA
and HyfR are more than 60% identical (70% similar), it is
possible that the effector-independent forms of the FhlA pro-
tein would activate hyfA-lacZ. In the presence of FhlA132,
which carries two point mutations (42), hyf-lac was expressed,
and the level of -galactosidase activity produced by the strain
WS222(pWS132) was 330 U. The FhlA165 protein, which lacks
the unique N-terminal region (amino acids 5 to 374) (41),
increased activation of hyf-lac by about eight times, to about
2,500 U of -galactosidase activity (Table 3). Although
FhlA132 and FhlA165 activated hyc-lac expression at compa-
rable levels (2,900 and 3,500 U of -galactosidase activity,
respectively) (41, 42), FhlA132 is only minimally effective with
the hyf operon. This may be a consequence of the N-terminal
domain (although carrying point mutations) significantly af-
fecting the activation of transcription of hyf by the C-terminal
domain of FhlA.
Activation of hyf by HyfR. In a separate experiment, the hyfR
gene was cloned and expressed from a heterologous promoter
TABLE 3. Regulation of expression of ⌽(hyfA-lacZ)inthe
presence of various fhlA alleles and HyfR
Mutated gene
a
-Galactosidase activity
b
FhlA
⫹
FhlA165 HyfR
None (wild type) ⬍50 2,500 8,200
fhlA ⬍50 2,500 9,900
rpoN ⬍50 ⬍50 ⬍50
hyf ND
c
ND 7,200
pfl⬍50 (⬍50)
d
2,700 (2,700)
d
7,000 (7,500)
d
modB ⬍50 (⬍50)
e
3,400 (3,400)
e
9,800 (11,000)
e
modE ⬍50 3,300 12,500
moeA ⬍50 1,800 9,000
fur ⬍50 ND 11,000
fnr ⬍50 2,600 22,000
a
All strains with FhlA plasmids are derivatives of E. coli strain WS222, which
carries ⌽(hyfA-lacZ) via WS4, and all are listed in Table 1. For experiments
with HyfR, mutant derivatives of strain WS266, which carries ⌽(hyfA-lacZ)
hyfR
⫹
via WS10, were used (Table 1). Cultures were grown in LBG (LB with
glucose) medium under anaerobic conditions.
b
-Galactosidase activity is expressed as nanomoles 䡠minute
⫺1
䡠(milligram of
cell protein)
⫺1
.
c
ND, not determined.
d
Formate was added to the growth medium at an initial concentration of 15
mM (values in parentheses).
e
Molybdate was present in the medium at an initial concentration of 1 mM
(values in parentheses).
584 NOTES J. BACTERIOL.
to determine whether HyfR, once produced within the cell,
would activate the expression of hyfA-lacZ. In this experiment,
the hyfR gene was cloned into phage , which also carries the
hyfA-lacZ fusion (WS10), in order to minimize the copy num-
ber effect. The HyfR protein, produced independent of its
native control system, activated the hyf operon, and the level of
-galactosidase activity produced by strain WS266 (with
WS10) was about 8,000 U (Table 3). This level of expression
is more than threefold higher than the value obtained with a
strain carrying multiple copies of plasmid pWS165 coding for
FhlA165. These results also confirm that the lack of transcrip-
tion of hyf in wild-type E. coli is due to the absence of HyfR,
the activator protein. Once produced in the cell, HyfR is an
effective activator of the hyf operon (Table 3). However, HyfR
failed to activate the hyc operon coding for the HYD3 isoen-
zyme, as evidenced by the lack of -galactosidase activity from
hyc-lacZ (strain WS127) or by dihydrogen production by a fhlA
mutant (strain SE1174) carrying a plasmid expressing the
hyfR
⫹
gene (plasmid pWTS35) (data not presented). This dif-
ference is apparently due to the differences in the unique
N-terminal domains of the two proteins. These results are in
agreement with those of Skibinski et al. (43).
Even upon activation by either the FhlA165 or the HyfR
protein, a hyc mutant that is hyf
⫹
failed to produce detectable
dihydrogen under any of the growth conditions tested. These
results show that the Hyf proteins, although similar to the Hyc
proteins, could not substitute for the HYD3 isoenzyme and
other proteins of the FHL complex.
Formate and molybdate are not needed for hyf expression.
As expected, in the presence of FhlA165 as the activator,
hyf-lac expression was not significantly affected by the presence
or absence of either formate or molybdate (Table 3). Similar
results were also obtained with HyfR, indicating that the hyf
operon expression was not affected in strains carrying muta-
tions in the production of formate (pfl) or molybdate transport
(modB). A slight increase in hyf-lac expression in a modB
mutant (8,200 versus 9,800 U of -galactosidase activity) and a
further increase when molybdate was added to the medium
(9,800 to 11,000 U) both suggest that the observed effect is
physiological. If molybdate is required for hyf-lac expression,
the level is expected to be lower in a modB mutant and re-
stored by molybdate addition, as was seen with other operons
such as hyc-lac (40–42). A modest increase in the level of
expression of hyf-lac occurred in a modE mutant compared to
that of the wild-type parent, suggesting a potential repression
by ModE. However, the upstream region of the hyf operon
lacks a ModE consensus sequence (Fig. 2), and the observed
effect is apparently physiological. A mutation in moeA had a
minimal effect on hyf-lac expression with FhlA165 and no ef-
fect with HyfR as the activator. These results suggest that
molybdenum apparently had a minimal indirect effect on hyf
expression (Table 3). Although a consensus sequence for the
iron-dependent control protein Fur can be found upstream of
the transcription start site, a fur mutation had only a minimal
effect on the level of expression of hyf-lac (Table 3). However,
a mutation in fnr increased the level of -galactosidase activity
produced by the culture about threefold with HyfR as the
activator (Table 3) but had no significant effect on expression
activated by the mutant FhlA protein. A putative FNR con-
sensus sequence (44) in the hyf upstream DNA can be detected
between positions ⫺111 and ⫺98 (Fig. 2). It is possible that
binding of FNR at this site may not have an impact on binding
of the smaller constitutive activator FhlA165 but may minimize
the ability of the larger HyfR protein to bind at the target
sequence, which is only about 25 bases upstream of the pre-
dicted FNR site. This possibility will be tested in future exper-
iments by using purified HyfR, FhlA, and FhlA165 proteins.
CRP-cAMP is required for activation of hyf operon. A cyclic
AMP receptor protein-cyclic AMP complex (CRP-cAMP)
consensus sequence is also present in the hyf upstream se-
quence centered at position ⫺160.5 (Fig. 2), which is 30 bp
upstream of the HyfR/FhlA consensus. In order to evaluate the
significance of this sequence, the level of expression of hyf was
determined in wild-type and cya mutant strains in the absence
of added glucose to evaluate the role of CRP-cAMP with HyfR
as the activator (Table 4). When the culture was grown in LB
without glucose, the level of -galactosidase activity increased
3.5-fold to about 28,000 U from a value of 8,200 U of activity
in the presence of glucose (Table 4). In the presence of the cya
mutation, the level of -galactosidase activity produced by the
LB culture of strain WS272 decreased ninefold to about 3,000
U, and the addition of 3 mM cAMP restored hyf-lac expression
to a level higher than that observed with the wild type grown in
the same medium. These results show that hyf expression is
FIG. 2. The hyf operon upstream DNA. The putative consensus sequences for the CRP, FNR, Fur, and FhlA/HyfR proteins are enclosed by
rectangles. A possible stem-loop between the stop codon of the upstream bcp gene and hyf promoter is shown in boldface type. The transcription
start site is in reverse type. The ⫺12 and ⫺24 positions are also in shown in boldface type. A putative start codon for hyfA is both underlined and
enclosed within a rectangle.
VOL. 186, 2004 NOTES 585
subject to catabolite repression. It should be noted that al-
though FhlA132 and FhlA165 activated hyf-lac expression and
apparently bind to the hyf upstream DNA at the same location
as does HyfR, the cya mutation had a slightly positive effect on
hyf-lacZ-dependent -galactosidase activity produced in the
presence of FhlA165 (data not presented). This difference in
the responses between FhlA165 and HyfR to CRP-cAMP is
probably related to the absence of N-terminal domain in the
smaller protein, FhlA165.
HyfR does not activate transcription of hyf-lacZ in aerobi-
cally grown cultures. Although strain WS266, with HyfR as the
activator, produced more than 25,000 U of -galactosidase
activity when grown anaerobically in LB medium, aerobic cul-
tures produced less than 200 U of -galactosidase activity
(Table 4). However, FhlA132 and FhlA165 did activate tran-
scription of hyf-lacZ under aerobic conditions to levels com-
parable to those of the anaerobically grown cultures (data not
presented). These mutant proteins have previously been shown
to activate hyc transcription aerobically, so their activation of
hyf is not unexpected (41). The lack of expression of hyf-lac by
HyfR when the cells were grown aerobically demonstrated that
when activated by HyfR, expression of hyf is oxygen sensitive.
In the unique N-terminal domain of HyfR, a cysteine-rich
amino acid sequence can be detected (200-CSDLSASHCAC
LPRC-214). This segment of the protein may potentially play a
role in redox-dependent regulation of the hyf operon, as has
been shown previously for the well-studied FNR protein (7).
Although FhlA165 successfully activated transcription of hyf-
lacZ in an in vitro transcription-translation experiment, aero-
bically purified HyfR protein was unable to activate transcrip-
tion in vitro (data not shown), a finding that was in agreement
with the putative oxygen sensitivity of the protein. Biochemical
experiments with HyfR protein purified under aerobic and
anaerobic conditions will help identify the oxygen-sensitive
nature of hyf expression.
Although the hyf operon is apparently silent in wild-type E.
coli, two mutant FhlA proteins (FhlA132 and FhlA165) and
constitutively expressed HyfR protein were able to activate
transcription of hyf. The ability of mutated forms of FhlA
proteins to activate this operon represents a unique way to
activate transcription of what seems to be a vestigial, unex-
pressed operon. Appropriate altered forms of known regula-
tory proteins may help activate corresponding silent genes or
operons in E. coli or other organisms in order to elucidate the
potential physiological role(s) of these proteins in the cell.
We thank P. Kiley, V. Stewart, and B. Magasanik for providing
various strains used in this study. We thank Ken Rudd for providing
the Kohara phages used in this study.
This work was supported by funds from the Florida Agricultural
Experiment Station.
REFERENCES
1. Amann, E., J. Brosius, and M. Ptashne. 1983. Vectors bearing a hybrid
trp-lac promoter useful for regulated expression of cloned genes in Esche-
richia coli. Gene 25:167–178.
2. Andrews, S. C., B. C. Berks, J. McClay, A. Ambler, M. A. Quail, P. Golby,
and J. R. Guest. 1997. A 12-cistron Escherichia coli operon (hyf) encoding a
putative proton-translocating formate hydrogenlyase system. Microbiology
143:3633–3647.
3. Andrews, S. C., P. M. Harrison, and J. R. Guest. 1991. A molecular analysis
of the 53.3 minute region of the Escherichia coli linkage map. J. Gen.
Microbiol. 137:361–367.
4. Bagramyan, K., N. Mnatsakanyan, A. Poladian, A. Vassilian, and A. Trchou-
nian. 2002. The roles of hydrogenases 3 and 4, and the F0F1-ATPase, in H
2
production by Escherichia coli at alkaline and acidic pH. FEBS Lett. 516:
172–178.
5. Bagramyan, K., A. Vassilian, N. Mnatsakanyan, and A. Trchounian. 2001.
Participation of hyf-encoded hydrogenase 4 in molecular hydrogen release
coupled with proton-potassium exchange in Escherichia coli. Membr. Cell
Biol. 14:749–763.
6. Ballantine, S. P., and D. H. Boxer. 1986. Isolation and characterisation of a
soluble active fragment of hydrogenase isoenzyme 2 from the membranes of
anaerobically grown Escherichia coli. Eur. J. Biochem. 156:277–284.
7. Bates, D. M., B. A. Lazazzera, and P. J. Kiley. 1995. Characterization of
FNR* mutant proteins indicates two distinct mechanisms for altering oxygen
regulation of the Escherichia coli transcription factor FNR. J. Bacteriol.
177:3972–3978.
8. Blattner, F. R., G. Plunkett, 3rd, C. A. Bloch, N. T. Perna, V. Burland, M.
Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor,
N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y.
Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science
277:1453–1474.
9. Blokesch, M., A. Magalon, and A. Bock. 2001. Interplay between the specific
chaperone-like proteins HybG and HypC in maturation of hydrogenases 1, 2,
and 3 from Escherichia coli. J. Bacteriol. 183:2817–2822.
10. Bock, A., and G. Sawers. 1996. Fermentation, p. 262–282. In F. C. Neidhardt
et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology,
2nd ed. ASM Press, Washington, D.C.
11. Bohm, R., M. Sauter, and A. Bock. 1990. Nucleotide sequence and expres-
sion of an operon in Escherichia coli coding for formate hydrogenlyase
components. Mol. Microbiol. 4:231–243.
12. Brondsted, L., and T. Atlung. 1994. Anaerobic regulation of the hydrogenase
1(hya) operon of Escherichia coli. J. Bacteriol. 176:5423–5428.
13. Brosius, J., M. Erfle, and J. Storella. 1985. Spacing of the ⫺10 and ⫺35
regions in the tac promoter. Effect on its in vivo activity. J. Biol. Chem.
260:3539–3541.
14. Clarke, L., and J. Carbon. 1976. A colony bank containing synthetic Col El
hybrid plasmids representative of the entire E. coli genome. Cell 9:91–99.
15. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-
somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.
Sci. USA 97:6640–6645.
16. Francis, K., P. Patel, J. C. Wendt, and K. T. Shanmugam. 1990. Purification
and characterization of two forms of hydrogenase isoenzyme 1 from Esche-
richia coli. J. Bacteriol. 172:5750–5757.
17. Gennis, R. B., and V. Stewart. 1996. Respiration, p. 217–261. In F. C.
Neidhardt et al. (ed.), Escherichia coli and Salmonella: cellular and molec-
ular biology, 2nd ed. ASM Press, Washington, D.C.
18. Grunden, A. M., R. M. Ray, J. K. Rosentel, F. G. Healy, and K. T. Shan-
mugam. 1996. Repression of the Escherichia coli modABCD (molybdate
transport) operon by ModE. J. Bacteriol. 178:735–744.
19. Hasona, A., R. M. Ray, and K. T. Shanmugam. 1998. Physiological and
genetic analyses leading to identification of a biochemical role for the moeA
(molybdate metabolism) gene product in Escherichia coli. J. Bacteriol. 180:
1466–1472.
20. Hasona, A., W. T. Self, R. M. Ray, and K. T. Shanmugam. 1998. Molybdate-
dependent transcription of hyc and nar operons of Escherichia coli requires
MoeA protein and ModE molybdate. FEMS Microbiol. Lett. 169:111–116.
21. King, P. W., and A. E. Przybyla. 1999. Response of hya expression to external
pH in Escherichia coli. J. Bacteriol. 181:5250–5256.
22. Kohara, Y., K. Akiyama, and K. Isono. 1987. The physical map of the whole
E. coli chromosome: application of a new strategy for rapid analysis and
sorting of a large genomic library. Cell 50:495–508.
23. Korsa, I., and A. Bock. 1997. Characterization of fhlA mutations resulting in
ligand-independent transcriptional activation and ATP hydrolysis. J. Bacte-
riol. 179:41–45.
24. Lee, J. H., P. Patel, P. Sankar, and K. T. Shanmugam. 1985. Isolation and
TABLE 4. Regulation of HyfR-dependent expression of ⌽(hyfA-
lacZ) requires cAMP for maximal activation and is repressed in
aerobically grown cells
Strain Relevant
genotype
a
-Galactosidase activity
b
LBG LB LB ⫹cAMP
WS266 Wild type 8,200 27,800 26,200
WS272 cya 5,100 3,260 39,800
WS266 (aerobic) Wild type ND 180 ND
a
All strains are derivatives of WS266, which carries ⌽(hyfA-lacZ)hyfR
⫹
via
WS10. Cultures were grown under anaerobic conditions, except where indi-
cated. cAMP, when present, was added at a final concentration of 3 mM.
b
-Galactosidase activity is expressed as nanomoles 䡠minute
⫺1
䡠(milligram of
cell protein)
⫺1
. ND, not determined.
586 NOTES J. BACTERIOL.
characterization of mutant strains of Escherichia coli altered in H
2
metabo-
lism. J. Bacteriol. 162:344–352.
25. Leonhartsberger, S., A. Ehrenreich, and A. Bock. 2000. Analysis of the
domain structure and the DNA binding site of the transcriptional activator
FhlA. Eur. J. Biochem. 267:3672–3684.
26. Lutz, S., A. Jacobi, V. Schlensog, R. Bohm, G. Sawers, and A. Bock. 1991.
Molecular characterization of an operon (hyp) necessary for the activity of
the three hydrogenase isoenzymes in Escherichia coli. Mol. Microbiol. 5:123–
135.
27. Maier, T., and A. Bock. 1996. Generation of active [NiFe] hydrogenase in
vitro from a nickel-free precursor form. Biochemistry 35:10089–10093.
28. Maupin, J. A., and K. T. Shanmugam. 1990. Genetic regulation of formate
hydrogenlyase of Escherichia coli: role of the fhlA gene product as a tran-
scriptional activator for a new regulatory gene, fhlB. J. Bacteriol. 172:4798–
4806.
29. Menon, N. K., C. Y. Chatelus, M. Dervartanian, J. C. Wendt, K. T. Shan-
mugam, H. D. Peck, Jr., and A. E. Przybyla. 1994. Cloning, sequencing, and
mutational analysis of the hyb operon encoding Escherichia coli hydrogenase
2. J. Bacteriol. 176:4416–4423.
30. Menon, N. K., J. Robbins, H. D. Peck, Jr., C. Y. Chatelus, E. S. Choi, and
A. E. Przybyla. 1990. Cloning and sequencing of a putative Escherichia coli
[NiFe] hydrogenase-1 operon containing six open reading frames. J. Bacte-
riol. 172:1969–1977.
31. Menon, N. K., J. Robbins, J. C. Wendt, K. T. Shanmugam, and A. E.
Przybyla. 1991. Mutational analysis and characterization of the Escherichia
coli hya operon, which encodes [NiFe] hydrogenase 1. J. Bacteriol. 173:4851–
4861.
32. Richard, D. J., G. Sawers, F. Sargent, L. McWalter, and D. H. Boxer. 1999.
Transcriptional regulation in response to oxygen and nitrate of the operons
encoding the [NiFe] hydrogenases 1 and 2 of Escherichia coli. Microbiology
145:2903–2912.
33. Rosentel, J. K., F. Healy, J. A. Maupin-Furlow, J. H. Lee, and K. T. Shan-
mugam. 1995. Molybdate and regulation of mod (molybdate transport),
fdhF, and hyc (formate hydrogenlyase) operons in Escherichia coli. J. Bac-
teriol. 177:4857–4864.
34. Sankar, P., J. H. Lee, and K. T. Shanmugam. 1985. Cloning of hydrogenase
genes and fine structure analysis of an operon essential for H
2
metabolism in
Escherichia coli. J. Bacteriol. 162:353–360.
35. Sankar, P., J. H. Lee, and K. T. Shanmugam. 1988. Gene-product relation-
ships of fhlA and fdv genes of Escherichia coli. J. Bacteriol. 170:5440–5445.
36. Sauter, M., R. Bohm, and A. Bock. 1992. Mutational analysis of the operon
(hyc) determining hydrogenase 3 formation in Escherichia coli. Mol. Micro-
biol. 6:1523–1532.
37. Sawers, R. G., and D. H. Boxer. 1986. Purification and properties of mem-
brane-bound hydrogenase isoenzyme 1 from anaerobically grown Esche-
richia coli K12. Eur. J. Biochem. 156:265–275.
38. Schlensog, V., and A. Bock. 1990. Identification and sequence analysis of the
gene encoding the transcriptional activator of the formate hydrogenlyase
system of Escherichia coli. Mol. Microbiol. 4:1319–1327.
39. Schweizer, H. P. 1993. Two plasmids, X1918 and Z1918, for easy recovery of
the xylE and lacZ reporter genes. Gene 134:89–91.
40. Self, W. T., A. M. Grunden, A. Hasona, and K. T. Shanmugam. 1999.
Transcriptional regulation of molybdoenzyme synthesis in Escherichia coli in
response to molybdenum: ModE-molybdate, a repressor of the modABCD
(molybdate transport) operon is a secondary transcriptional activator for the
hyc and nar operons. Microbiology 145:41–55.
41. Self, W. T., A. Hasona, and K. T. Shanmugam. 2001. N-terminal truncations
in the FhlA protein result in formate- and MoeA-independent expression of
the hyc (formate hydrogenlyase) operon of Escherichia coli. Microbiology
147:3093–3104.
42. Self, W. T., and K. T. Shanmugam. 2000. Isolation and characterization of
mutated Fh1A proteins which activate transcription of the hyc operon (for-
mate hydrogenlyase) of Escherichia coli in the absence of molybdate. FEMS
Microbiol. Lett. 184:47–52.
43. Skibinski, D. A., P. Golby, Y. S. Chang, F. Sargent, R. Hoffman, R. Harper,
J. R. Guest, M. M. Attwood, B. C. Berks, and S. C. Andrews. 2002. Regu-
lation of the hydrogenase-4 operon of Escherichia coli by the
54
-dependent
transcriptional activators FhlA and HyfR. J. Bacteriol. 184:6642–6653.
44. Spiro, S., and J. R. Guest. 1990. FNR and its role in oxygen-regulated gene
expression in Escherichia coli. FEMS Microbiol. Rev. 6:399–428.
45. Wendt, J. C. 1989. Regulation of the hydrogen uptake (hup) gene of Esch-
erichia coli. M.S. thesis. University of Florida, Gainesville.
46. Zinoni, F., A. Birkmann, T. C. Stadtman, and A. Bock. 1986. Nucleotide
sequence and expression of the selenocysteine-containing polypeptide of
formate dehydrogenase (formate-hydrogen-lyase-linked) from Escherichia
coli. Proc. Natl. Acad. Sci. USA 83:4650–4654.
VOL. 186, 2004 NOTES 587
