Mutations in the MATP Gene in Five German Patients Affected by Oculocutaneous Albinism Type 4

Article (PDF Available)inHuman Mutation 23(2):106-10 · March 2004with54 Reads
DOI: 10.1002/humu.10311 · Source: PubMed
Abstract
Oculocutaneous albinism (OCA) is caused by a deficiency of melanin synthesis and characterized by generalized hypopigmentation of skin, hair, and eyes. Due to the hypopigmentation of the retinal pigment epithelium, OCA is usually associated with congenital visual impairment, in addition to an increased risk of skin cancer. OCA is a genetically heterogeneous disease with distinct types resulting from mutations in different genes involved in the pathway which results in pigmentation. OCA1 is associated with mutations in the TYR gene encoding tyrosinase. OCA2 results from mutations in the P gene encoding the P protein and is the most common form of OCA. OCA3, also known as rufous/red albinism, is caused by mutations in the TYRP1 gene, which encodes the tyrosinase-related protein 1. Recently, OCA4 was described as a new form of OCA in a single patient with a splice site mutation in the MATP gene (or AIM1), the human ortholog of the murine underwhite gene. The similarity of MATP to transporter proteins suggests its involvement in transport functions, although its actual substrate is still unclear. We screened 176 German patients with albinism for mutations within the MATP gene and identified five individuals with OCA4. In this first report on West European patients, we describe 10 so far unpublished mutations, as well as two intronic variations, in addition to two known polymorphisms.
RAPID COMMUNICATION
Mutations in the MATP Gene in Five German
Patients Affected by Oculocutaneous Albinism
Type 4
Uta Rundshagen,
1
Christine Zu
¨
hlke,
1n
Sven Opitz,
1
Eberhard Schwinger,
1
and Barbara Ka
¨
smann-Kellner
2
1
Institut fu
¨
r Humangenetik der Universita
¨
tLu
¨beck,
Lu
¨beck,
Germany;
2
Augenklinik der Universita
¨
t des Saarlandes, Homburg (Saar), Germany
Communicated by Mark H. Paalman
Oculocutaneous albinism (OCA) is caused by a deficiency of melanin synthesis and characterized by generalized
hypopigmentation of skin, hair, and eyes. Due to the hypopigmentation of the retinal pigment epithelium, OCA
is usually associated with congenital visual impairment, in addition to an increased risk of skin cancer. OCA is a
genetically heterogeneous disease with distinct types resulting from mutations in different genes involved in the
pathway which results in pigmentation. OCA1 is associated with mutations in the TYR gene encoding
tyrosinase. OCA2 results from mutations in the P gene encoding the P protein and is the most common form of
OCA. OCA3, also known as rufous/red albinism, is caused by mutations in the TYRP1 gene, which encodes the
tyrosinase-related protein 1. Recently, OCA4 was described as a new form of OCA in a single patient with a
splice site mutation in the MATP gene (or AIM1), the human ortholog of the murine underwhite gene. The
similarity of MATP to transporter proteins suggests its involvement in transport functions, although its actual
substrate is still unclear. We screened 176 German patients with albinism for mutations within the MATP gene
and identified five individuals with OCA4. In this first report on West European patients, we describe 10 so far
unpublished mutations, as well as two intronic variations, in addition to two known polymorphisms. Hum
Mutat 23:106–110, 2004.
r
2003 Wiley-Liss, Inc.
KEY WORDS: albinism; oculocutaneous albinism; OCA; MATP; AIM1; OCA4
DATABASES:
MATP OMIM: 606202, 606574 (OCA4); GenBank: NT
_
006576.13, (genomic contig) AF172849, NM
_
016180.2
(mRNA)
INTRODUCTION
Albinism represents a group of genetically hetero-
geneous hereditary abnormalities of melanin pigment
synthesis that result in a deficiency or complete absence
of melanin in affected individuals.
A reduction of melanin causes hypopigmentation of
hair and skin, leading to an increased sensitivity to
ultraviolet radiation and a predisposition to skin cancer.
In the visual system, the deficiency of melanin during
fetal and postpartum development of the retinal and
cerebral branches of the visual system results in severe
alterations such as foveal dysplasia and abnormal routing
of the optic nerves, which subsequently leads to a
congenital visual impairment, nystagmus, and often
strabismus [Creel et al., 1990]. The lack of melanin
may either be restricted to the eye (ocular albinism,
OA), or it can involve skin, hair, and eyes (oculocuta-
neous albinism, OCA).
Several genes have been found to be associated with
human pigmentation. Mutations of these genes may
cause at least four genetic types of recessively inherited
OCA. Mutations in the tyrosinase encoding gene, the
rate-limiting enzyme in melanin synthesis [Jimbow et al.,
1976], are associated with OCA1 (MIM# 203100)
[Kwon et al., 1987; Giebel et al., 1991]. Mutations in the
human gene encoding the P protein, which probably
functions as a transporter, result in OCA2 (MIM#
203200), the most common form of OCA [Rinchik et al.,
1993; Puri et al., 1997]. OCA3, also known as rufous
or red albinism, is caused by mutations in the gene
encoding the tyrosinase-related protein 1 (TYRP1;
MIM# 115501), and is a rare form of OCA [Boissy
et al., 1996; Jime
´
nez-Cervantes et al., 1994].
In 2001, a mutation analysis of the human membrane-
associated transporter protein (MATP) gene (MIM#
606202), also known as the melanoma antigen named
‘‘altered in melanoma’’ (AIM1) [Harada et al., 2001]
was published by Newton et al. [2001]. Among more
than 100 patients with albinism, a homozygous G4A
Received 15 July 2003; accepted revise d m anuscript 17 October
2003.
n
Corresponden ce to: C hri stine Zˇh l ke, I n stit ut fˇr Hum an geneti k,
RatzeburgerAllee 160, D ^ 23538 Lˇbeck, Germany.
E-mail: zuehlke@uni-luebeck.de
DOI 10.1002/humu.10311
Published on line in Wiley InterScience (www.interscience.wiley.com).
rr
2003 WILEY-LISS, INC.
HUMAN MUTATION 23:106^110 (2004)
transition of the exon 2 splice-acceptor site was found in
a single person with generalized hypopigmentation. The
resulting phenotype was termed OCA type 4 (OCA4;
MIM# 606574) [Newton et al., 2001]. Findings in other
species point to an involvement of the encoded protein
in the pigmentation pathway. For example, the murine
ortholog of the human MATP gene, the ‘‘underwhite’’
gene, is responsible for cases of hypopigmentation in mice
[Sweet et al., 1998]. Furthermore, mutations in a highly
homologous gene reduce the melanin content in
Japanese medaka fish [Fukamachi et al., 2001].
The human MATP gene is located on chromosome 5p
and consists of seven exons spanning a region of
approximately 40 kb. The protein is predicted to span a
lipid bilayer 12 times and probably functions as a
transporter. It shows great similarities to sucrose/proton
symporters in plants [Newton et al., 2001], but the
substrate in the human organism is still unknown.
To look for mutations, we performed molecular
analyses for the MATP gene of 176 German patients
with OCA. The frequency of OCA4 among patients with
OCA has yet to be estimated in different populations.
Furthermore, genotype–phenotype correlations are
highly necessary for adequate counseling of patients
and their families.
MATERIALS AND METHODS
After having obtained written informed consent for genetic
analyses, total genomic DNA was isolated from proteinase K/SDS
digests of blood samples.
PCR primers for the specific amplification of individual exons
from genomic DNA were designed (Table 1). Two overlapping
fragments were synthesized for exons 1, 3, and 7. PCR was
performed at an annealing temperature of 551C in a volume of 25
ml containing 50 ng genomic DNA, 10 pmol of each primer, 5 pmol
dNTP, and 0.5 units Ta q polymerase (Eppendorf, www.eppendorf.
com). Products were separated by agarose (1.5%) gel electrophor-
esis and visualized by ethidium bromide staining.
To search for mutations, SSCP analyses were performed. PCR
products were mixed with one volume formamide and heated for 5
min to 951C, followed by cooling on ice. Samples were resolved on
6% polyacrylamide gels containing 10% urea or glycerol at 30 W
and room temperature for 2 to 4 hr [Sambrook and Russell, 2001].
For individuals with a single mutant OCA4 allele, SSCP analyses
for the complete coding region were performed in parallel with
both gel configurations (10% urea as well as 10% glycerol) and
varying run duration. The SSCP banding pattern was detected by
silver staining.
PCR products of DNA samples showing irregular patterns in
the SSCP analysis were amplified twice, purified (NucleoSpin
Extract 2 in 1-Kit; Macherey-Nagel, www.macherey-nagel.com),
and sequenced using the dideoxy chain termination method on
double-stranded DNA templates (SequiTherm EXCEL II DNA
Sequencing Kit; Epicentre, www.epicentre.com) in the presence of
IRD800-labeled universal (uni) or reverse (rev) M13 primers on a
Licor 4200 automated sequencer (Licor, www.licor.com). Trace file
analysis was performed using the Seqworks software package by
Sven Opitz (www.humangenetik .uni-luebeck.de).
The sequences obtained were compared to the human MATP
cDNA (NCBI AF172849). Mutation numbering is based on this
sequence, with +1 corresponding to the A of the translation
initiation codon ATG. Exon numbering and boundaries were
obtained by alignment of cDNA NM
_
016180.2 (GenBank 22-
Mar-2001) and the Homo sapiens chromosome 5 genomic contig
NT
_
006576.13 (GenBank 28-Apr-2003).
RESULTS
Molecular investigations of 176 patients with OCA
revealed changes of single nucleotides, deletions, and
insertions within the MATP gene in 11 nonrelated
individuals. Using SSCP and sequencing strategies, we
found 13 different DNA variations in this gene.
Mutations
In five patients, mutations on both alleles were identi-
fied (Table 2). Patient 1 is homozygous for a T4C
transition at position 1082 of the cDNA (c.1082T4C,
p.L361P). Subsequent analysis of the parents’ DNA
TA BLE 1. PCR and Sequencing Primers
Exon Size No. of primer pairs Designation Sequence (5
0
- 3
0
)
1385bp2 AIM1-F1-uni
AIM1-R1-rev
AIM1-F2-uni
AIM1-R2-rev
Uni^AACACAGACCCTAGGACCAC
a
Rev^CACACAATGCTGTACAGGCTG
b
Uni^TATGTGACCCCAGTCCTGCT
Rev ^CTC CTG CAG AGG TAC ACA CTA
2 177 bp 1 AIM2-F-uni
AIM2-R-rev
Uni ^CAG GAT TTA GGA GAC CAATGT
Rev ^CTG AAG GAG AGA CTT TCT GGA
3326bp2 AIM3-F1-uni
AIM3-R1-rev
AIM3-F2-uni
AIM3-R2-rev
Uni ^GGG AGT GTC TAT GCAT GA GG
Rev ^ GAA TGC CCT TTG CAA CCT CTG
Uni ^TCT GTG CAG TAT CTC TGA AGC
Rev^CCCATGAAACTCTTCTCGTC
4 144 bp 1 AIM4-F-uni
AIM4-R-rev
Uni ^GGC TGA GTT TCT GCA GTG AAG
Rev ^ACA GTG A TT GTG TGC ACA GAC
5124bp1 AIM5-F1-uni
AIM5-R1-rev
Uni ^GTA CCT CAA CAG CCT CCA ATC
Rev ^TCC AAG TTG TGC TAG ACC AGA
6 212 bp 1 AIM6-F-uni
AIM6-R-rev
Uni ^GAG GCA CTG CCA GCT GTA ATT
Rev ^ GTT ACC CAA GGC A GA GGT T CA
7225bp2 AIM7-F1-uni
AIM7-R1-rev
AIM7-F2-uni
AIM7-R2-rev
Uni ^CTG ACC TGT GCC CTA AAT GAC
Rev ^CT G TGATCA CCA CGA CGA CAA
Uni ^CCTGGG CTT TCT GGT CAA CAC
Rev ^TCC TGC CAT GTG CTT CAC TGT
a
M13-uni-sequence: 5
0
-TGTAAAACGACGGCCAGT-3
0
.
b
M13-rev-sequence: 5
0
- CAG GAA ACA GCT ATG ACC -3
0
.
MATP MUTATIONS IN OCA4 107
showed the obligate heterozygosity for this allele. The
mutation is localized within the luminal protein loop
between transmembrane domains 7 and 8. Cutaneous
hypopigmentation in the patient was marked, and the
hair was white-yellowish. During life, there was no
increase of pigmentation on the skin and very little
increase of pigmentation in the hair (the patient had
white hair as a child, and is now 42 years old). Visual
acuity is 20/200 in both eyes, and there is distinct
hypopigmentation of the pigment epithelia of the iris and
of the retina. Macular hypoplasia, optic dysplasia, and
nystagmus were found.
Four patients are compound heterozygous for different
mutations in the MATP gene. Patient 2 showed a C4G
transition at position 172 of the cDNA (c.172C4G,
p.P58A) which affects the transmembrane domain 1 of
the protein and the duplication of a 25-bp DNA
fragment (c.1179
_
1203dup; Table 2). The latter muta-
tion results in the stop of translation in exon 6 (p.Y401X)
and the loss of transmembrane domains 9–12 in the
protein. The mutated alleles could be found either in the
DNA of the mother or in the DNA of the patient’s father
(Table 2). Phenotypically, the patient showed white-
silvery hair and severe hypopigmentation of the pigment
epithelia of the eye; macular dysplasia is associated with
atypical choroidal vessels spanning below the presumed
macular area. There was also optic nerve dysplasia, visual
acuity was 20/400 in both eyes, and additionally there
was marked nystagmus. No increase in skin or hair
pigmentation was observed.
Patient 3 carries the loss of a single triplet in exon 3
(c.661
_
663del), which does not alter the reading frame,
but causes the deletion of one amino acid in transmem-
brane domain 6 (p.delF221). The second mutation
is caused by the deletion of a single nucleotide at
position 986 of the cDNA (c.986delC) corresponding to
transmembrane domain 7 of the MATP protein. This
mutation does change the reading frame and leads to a
translation stop in exon 6 (p.T329fsX68). Blood samples
of the parents could not be obtained, so the origin
of both alleles remains unclear. As in Patient 1, this
proband showed white-yellowish hair. Hypopigmentation
of the ocular structures was distinct, but not as severe as
in Patient 2. Optic dysplasia was present. The patient
had a pendular nystagmus and visual acuity of 20/200
in both eyes. The skin was very pale. No increase of
pigmentation of the skin and hairs was noted (age 11
years).
In Patient 4, we found the mutation c.986delC, as was
reported in Patient 3. The second allele showed a C4T
transition at position 1457 of the cDNA (c.1457C4T,
p.A486V) affecting transmembrane domain 11. Analysis
of the parents’ DNA could clarify the origin of both
mutations (Table 2). As was the case in Patients 1 and 3,
the proband showed white-yellowish hair. The skin was
extremely pale and over the last 8 years no increase of
pigmentation was noted. The ocular hypopigmentation
was comparable to that of Patients 1 and 3; there was
also dysplasia of the optic nerve head. Nystagmus was
present, visual acuity was 20/200 in both eyes.
We found a A4G transition at position 950
(c.950A4G, p.Y317C) in the DNA of Patient 5.
The mutation concerns the intracellular protein loop
between domains 6 and 7. On the second allele, this
person showed a G4A transition at position 1429
(c.1429G4A, p.A477T), which affects domain 11 of the
protein. We were able to prove the presence of both
sequence variations either in the patient’s mother or
father (Table 2). This patient was distinctly different
from the other four probands. Now aged 9 years,
he shows dark blonde hair that has become darker since
infancy (the patient had been a medium-to-light blonde,
TABLE 2. DNA Alterations in the OCA4 Gene
DNA Exon Alteration in DNA
a
Alteration in protein Origin of the allele
Patient 1 5 c.1082T4C; c.1082 T 4C p.L361P One allele from each parent
Patient 2 1 c.172C4G p.P58A Mother
6c.1179
_
1 20 3dup p.Y401X Father
Patient 3 3 c.661
_
663del p.F221 del ?
4c.986delCp.T329fsX68?
Patient 4 4 c.986delC p.T329fsX68 Mother
7c.1457C4T p.A486V F ather
Patient 5 4 c.950A4G p.Y317C Father
7 c. 1429G4A p.A477T Mother
Patient 6 4 c.986delC p.T329fsX68 ?
Patient 7 4 c.986delC p.T329fsX68 ?
Patient 8 4 c.986delC p.T329fsX68 ?
Patient 9 3 c.606G4Cp.W202C?
Patient 10 3 c.814G4A
b
p.E 272K
b
?
Patient 11 7 c.1567
_
1574 d up p. F 525 f sX15 ?
Intronic variations
3 Patients IVS3+46C4T??
4 Patients IVS3+59
_
+61dup ? ?
a
DNA variation numbering based on GenBank NM
_
016180.2, with +1 as A of the ATG start codon. Introns based on genomic contig GenBank
NT
_
006576 .1 3 .
b
Polymorphism according to Nakayama et al. [2002].
108 RU NDSHAGE N ET A L.
and his hair was never white). The skin was pale, but he
was able to develop a very slight tan. Compared to
the other patients, ocular hypopigmentation was less.
Additionally, this proband was the only one of the OCA4
patients without optic dysplasia; however the optic nerve
head was unusually small and slightly pale. Macular
structures could not be discriminated, including exam-
ination in red-free light. Visual acuity was surprisingly
good at 20/30 and 20/40; nystagmus had a very low
intensity.
Six patients were found to be heterozygous for
alterations in the MATP gene. As in Patient 3 and 4,
the deletion c.986delC was detected in Patients 6, 7,
and 8. In Patient 9, we identified a G4C transition at
position 606 of the cDNA (c.606G4C, p.W202C);
Patient 10 showed the polymorphism c.814G4A
(p.E272K) described by Newton et al. [2001]. Patient
11 carried a duplication of seven nucleotides between
position 1567 and 1574 of the cDNA (Table 2), resulting
in p.F525fsX15 with 539 amino acid residues, in contrast
to the wild-type protein, which was composed of 530
amino acids.
Comparing the phenotypes, we found that differentia-
tion between patients with a single DNA variation and
individuals homozygous for the SCA4 mutation is not
possible by pure clinical investigations.
Polymorphisms
In addition to the mutations, we were able to reveal
two polymorphisms described by Newton et al. [2001].
Polymorphism c.1122C>G (p.F374L) is rather common
and is present heterozygously in 15 unrelated individuals
(15 out of 352 alleles; 4.3%). Heterozygosity of DNA
polymorphism c.987G4A (silent, affecting codon T329)
was found in four individuals (four out of 352 alleles;
1.1%).
Furthermore, two sequence variations within intron 3
were detected. The insertion IVS3+60
_
+61insTGTwas
seen in four patients and the substitution IVS3+46C4T
was seen in three of our patients.
DISCUSSION
The analysis of 176 unrelated German patients with
symptoms of albinism revealed five individuals with
homozygous (Patient 1) or compound heterozygous
(Patients 2–5) mutations in the MATP gene. Therefore,
we assume that these five patients are affected by OCA4.
The frequency of 2.84% of patients with pigmentation
defects investigated in this study is significantly higher
than expected, according to Newton et al. [2001] (one in
102 patients). Including the five patients with single
OCA4 mutations (Patients 6–9, and 11), our results
suggest that patients with genetically-defined OCA4 are
present in 5% to 6% of all affected persons in the
Caucasian population.
Among the five individuals with OCA4, a single case
was homozygous for one of the mutations, although
consanguinity was not known for this family. Two of the
remaining four patients carried the deletion c.986delC,
which could be identified in a total of five patients
(Patients 3, 4, and 6–8). The high frequency of this
mutation (5 out of 16 DNA alterations) might be caused
by a founder effect in the German population. On the
other hand, the presence of eight different mutations in
five persons with OCA4 points to numerous origins of
this disease. Overall, we detected 10 unrelated and
unknown mutations: one deletion, two frameshifts, and
seven missense mutations.
Clinically, four of the five probands with OCA4
showed very pale skin, and white-yellowish hair with
little or no further pigmentation during life. Visual acuity
was between 20/400 and 20/200, and all but one of the
patients showed optic nerve head dysplasia, which is
found only in 31% of all albinism patients (n = 351
patients, all types of albinism; Barbara Ka
¨
smann-Kellner,
unpublished results). In one patient, cutaneous and
ocular pigmentation was much better, and in spite of
macular hypoplasia as confirmed by examination in red-
free light, a surprisingly good visual acuity was achieved.
For the six individuals with oculocutaneous albinism
(Patients 6–11), alterations have been detected in only
one of the MATP alleles. Mutations within the OCA1
and OCA2 gene have been excluded by molecular
analyses. It seems likely, therefore, that the second
mutation was not detected by the SSCP conditions used,
or it occurs in gene regions not presented in the PCR
products; the promoter and extended intronic parts have
not been investigated. It is well known that mutations in
the splice-acceptor sequences as described by Newton
et al. [2001] for a Turkish patient, are associated with the
disease phenotype. This points to disease-causing DNA
changes localized in untranslated regions and frequently
occurring in patients. In addition, deletions or duplica-
tions of the complete gene or single exons are not seen by
the SSCP procedure, but may be important in mutational
analyses [Hedrich et al., 2001].
Furthermore, pathologic effects of heterozygous muta-
tions in nonallelic genes must be discussed. Recently, in
cases of OA and Waardenburg syndrome, digenic
mutation types have been described [Ming and Muenke,
2002]. Thus, it seems quite possible that heterozygous
mutations in nonallelic genes encoding proteins or
enzymes involved in pigment synthesis and transport
might produce an additional negative effect, resulting in
OCA phenotypes.
The distribution of mutations in the MATP gene
revealed that 10 of 11 (490%) DNA variations are
localized in the last two-thirds of the protein (Fig. 1). It is
not yet known whether changes in the amino terminal
part of the protein are associated with more severe or
unrelated phenotypes. Patient 2 carries a missense
mutation in exon 1. Her ocular findings resemble those
of probands 1, 3, and 4 in all aspects apart from a slight
difference in hair color. Patients 1, 3, and 4 have white-
yellowish hair; Patient 2 has silvery-white hair. Hypo-
pigmentation of the ocular structures was similar, and
Patient 2 showed optic nerve head dysplasia along with
the other probands. Visual acuity was slightly worse in
this patient (20/400 versus 20/200), which could be
MATP MUTATIONS IN OCA4 109
correlated to age and cooperation, as Proband 2 was 4
years old—the youngest of our OCA patients.
Newton et al. [2001] identified the DNA polymorph-
ism c.987G>A in 18 individuals (17.6% of alleles). In
contrast, this polymorphism is rare, with 2.3 % in the
German population (four alleles out of 352). The
polymorphism p.F374L was found in 15 of our patients
in the heterozygous condition (8.5%), representing the
most frequent sequence variation in the study reported
here. Newton et al. [2001] detected this polymorphism
in 67 individuals, mainly in the heterozygous state. As
the reported sample includes 102 patients as well as some
control samples, the precise frequency remains uncertain,
but should be higher than 50%.
The significantly higher frequency of both polymorph-
isms in Newton et al. [2001] may be caused by
population-specific differences. In addition, polymorph-
ism p.F374L might show a positive correlation to skin
color variations among major human populations [Na-
kayama et al., 2002].
The detection of the 10 mutations we have described
underlines the important role of the MATP protein in
general pigmentation and is the first evidence for OCA4
for patients in Western Europe.
ACKNOWLEDGMENTS
We thank all patients and their families for providing
blood samples for scientific research. We thank J. Atici
and U. Gehlken for excellent technical help, and Mrs. C.
Menzel-Dowling, Institut fuer Anatomie and Zellbiologie,
Universitaet des Saarlandes for reading the manuscript.
REFERENCES
Boissy RE, Zhao H, Oetting WS, Austin LM, Wildenberg SC,
Boissy YL, Zhao Y, Sturm RA, Hearing VJ, King RA, Nordlund
JJ. 1996. Mutation in and lack of expression of tyrosinase-related
protein-1 (TRP-1) in melanocytes from an individual with
brown oculocutaneous albinism: a new subtype of albinism
classified as ‘‘OCA3’’. Am J Hum Genet 58:1145–1156.
Creel DJ, Summer CG, King RA. 1990. Visual anomalies
associated with albinism. Ophthalmic Pediatr Genet 11:193–200.
Fukamachi S, Shimada A, Shima A. 2001. Mutations in the gene
encoding B, a novel transporter protein, reduce melanin content
in medaka. Nat Genet 28:381–385.
Giebel LB, Tripathi RK, Strunk KM, Hanifin JM, Jackson CE, King
RA, Spritz RA. 1991. Tyrosinase gene mutations associated with
type 1B (‘‘yellow’’) oculocutaneous albinism. Am J Hum Genet
48:1159–1167.
Harada M, Li YF, El-Gamil M, Rosenberg SA, Robbins PF. 2001.
Use of an in vitro immunoselected tumor line to identify shared
melanoma antigens recognized by HLA
n
0201-restricted T cells.
Cancer Res 61:1089–1094.
Hedrich K, Kann M, Lanthaler AJ, Dalski A, Eskelson C, Landt O,
Schwinger E, Vieregge P, Lang AE, Breakefield XO, Ozelius LJ,
Pramstaller PP, Klein C. 2001. The importance of gene dosage
studies: mutational analysis of the parkin gene in early-onset
parkinsonism. Hum Mol Genet 10:1649–1656.
Jimbow K, Quevedo WC, Fitzpatrick TB, Szabo G. 1976. Some
aspects of melanin biology: 1950–1975. J Invest Dermatol
67:72–89.
Jime
´
nez-Cervantes C, Solano F, Kobayashi T, Urabe K, Hearing VJ,
Lozano JA, Garce
´
a-Borre
´
n JC. 1994. A new enzymatic function
in the melanogenic pathway: the DHICA oxidase activity
of tyrosinase-related protein-1 (TRP-1). J Biol Chem 269:
17993–18001.
Kwon BS, Haq AK, Pomerantz SH, Halaban R. 1987. Isolation
and sequence of a cDNA clone for human tyrosinase that
maps at the mouse c-albino locus. Proc Natl Acad Sci USA 84:
7437–7477.
Ming JE, Muenke M. 2002. Multiple hits during early embryonic
development: digenic diseases and holoprosencephaly. Am J
Hum Genet 71:1017–1032.
Nakayama K, Fukamachi S, Kimura H, Koda Y, Soemantri A,
Ishida T. 2002. Distinctive distribution of AIM1 polymorphism
among major human populations with different skin colour. J
Hum Genet 47:92–94.
Newton JM, Cohen-Barak O, Hagiwara N, Gardner JM, Davisson
MT, King RA, Brilliant MH. 2001. Mutations in the human
orthologue of the mouse underwhite gene (uw) underlie a new
form of oculocutaneous albinism, OCA4. Am J Hum Genet
69:981–988.
Puri N, Durbam-Pierre D, Aquaron R, Lund PM, King RA,
Brilliant MH. 1997. Type 2 oculocutaneous albinism (OCA2) in
Zimbabwe and Cameroon: distribution of the 2.7-kb deletion
allele of the P gene. Hum Genet 100:651–656.
Rinchik EM, Bultman SJ, Horsthemke B, Lee ST, Strunk KM,
Spritz RA, Avidano KM, Jong MTC, Nicholls RD. 1993. A gene
for the mouse pink-eyed dilution locus and for human type II
oculocutaneous albinism. Nature 361:72–76.
Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory
manual, Vol. 2. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Sweet HO, Brilliant MH, Cook SA, Johnson KR, Davisson MT.
1998. A new allelic series for the underwhite gene on mouse
chromosome 15. J Hered 89:546–551.
530
Transmembrane Domains 1 to 12
107 131
TM 3
503 526
TM 12
366 387
TM 8
399 418
TM 9
475 496
TM 11
423 441
TM 10
323 347
TM 7
183 205
TM 5
218 235
TM 6
137 155
TM 4
36 66
TM 1
70
TM 2
81
58 m
202 m
221 d
272 m*
317 m
401 X
361 m
486 m
477 m
329 fsX
525 fsX
FIGURE 1. Distribution of DNA variations within the MATP protein. Schematic presentation of the 530^amino acid protein with trans-
membrane domains, according Newton et al. [2001].The ¢rst and last amino acid of each domain is given. Positions of DNAvariations
are marked by plus the number of the a ¡ected amino acid. m: missense mutations; d: deletions; m
n
: polymorphisms; X: nonsense
mutations; fsX: frame shift mutations.
110 R U N D S H A G E N E T A L .
    • "The P protein has 12 putative transmembrane domains and transports proteins in the melanosomes that are necessary for melanin biosynthesis. Disease associated mutations identified in the SLC45A2 in Turkish, German, Japanese, and Korean OCA patients [16][17][18][19][20], resulted in loss of function of P protein in OCA2 that might disturb the availability of tyrosinase in the melanosomes during melanogenesis [7]. "
    [Show abstract] [Hide abstract] ABSTRACT: Oculocutaneous albinism (OCA) is a genetic disorder of melanin synthesis that results in hypopigmentation in hair, skin and eyes. OCA has been reported in individuals from all ethnic backgrounds but it is more common among those with Europeans ancestry. OCA is heterogeneous group of disorders and seven types of OCA are caused by mutations in TYR (OCA1), OCA2 (OCA2), TYRP1 (OCA3), SLC45A2 (OCA4), SLC24A5 (OCA6) and C10oRF11 (OCA7) genes. However, MC1R gene variants have been reported that modify OCA2 phenotype but the knowledge about the function of MC1R gene in melanogenesis, and genotype-phenotype association, in case of OCA, is limited. In this review article we present a comprehensive description of classification of OCA, role of MSH-R in melanin synthesis, the sequence variations in MC1R and their association with OCA. This review will enhance our understanding of MC1R gene variants involved in human OCA2 phenotype.
    Full-text · Article · Aug 2016
    • "The function of SLC45A2 is still unknown, but studies from Medaka fish show that the SLC45A2 protein plays an important role in pigmentation and probably functions as a membrane transporter in melanosomes [53]. Mutations in SLC45A2 were found for the first time in a Turkish OCA patient [52] and have since been found in German, Japanese, and Korean OCA patients [20,555657. Mutations in SLC45A2 cause misrouting of tyrosinase similar to the cellular phenotype of OCA-2 [58, 59]. "
    [Show abstract] [Hide abstract] ABSTRACT: Oculocutaneous albinism (OCA) is an autosomal recessive disorder caused by either complete lack of or a reduction of melanin biosynthesis in the melanocytes. The OCA1A is the most severe type with a complete lack of melanin production throughout life, while the milder forms OCA1B, OCA2, OCA3, and OCA4 show some pigment accumulation over time. Mutations in TYR, OCA2, TYRP1, and SLC45A2 are mainly responsible for causing oculocutaneous albinism. Recently, two new genes SLC24A5 and C10orf11 are identified that are responsible to cause OCA6 and OCA7, respectively. Also a locus has been mapped to the human chromosome 4q24 region which is responsible for genetic cause of OCA5. In this paper, we summarized the clinical and molecular features of OCA genes. Further, we reviewed the screening of pathological mutations of OCA genes and its molecular mechanism of the protein upon mutation by in silico approach. We also reviewed TYR (T373K, N371Y, M370T, and P313R), OCA2 (R305W), TYRP1 (R326H and R356Q) mutations and their structural consequences at molecular level. It is observed that the pathological genetic mutations and their structural and functional significance of OCA genes will aid in development of personalized medicine for albinism patients.
    Full-text · Article · Jun 2014
    • "The prevalence of all known forms of albinism in the best-studied Western populations, mostly in North America and Europe, appears to be 1:17 000 newborns (within a range of 1:10 000–20 000) (Gargiulo et al., 2011; Grønskov et al., 2007, 2009; Hutton and Spritz, 2008a,b; King and Oetting, 2006; Oetting and King, 1999; Rooryck et al., 2008; Rundshagen et al., 2004; Z€ uhlke et al., 2007). Different frequencies of several types of albinism have been also reported from Asia (Inagaki et al., 2004; Lin et al., 2006; Suzuki and Tomita, 2008; Wei and Li, 2013; Wei et al., 2010, 2011), whereas the highest prevalence is found in some countries in Africa, mostly due to consanguinity issues and founder effects (Aquaron et al., 2007; Cruz-Inigo et al., 2011; Spritz et al., 1995) (Figure 1). "
    [Show abstract] [Hide abstract] ABSTRACT: Albinism is a rare genetic condition globally characterized by a number of specific deficits in the visual system, resulting in poor vision, in association with a variable hypopigmentation phenotype. This lack or reduction of pigment might affect the eyes, skin and hair (oculocutaneous albinism, OCA), or only the eyes (ocular albinism, OA). In addition, there are several syndromic forms of albinism (e.g., Hermansky-Pudlak and Chediak-Higashi syndromes, HPS and CHS, respectively) in which the described hypopigmented and visual phenotypes coexist with more severe pathological alterations. Recently, a locus has been mapped to the 4q24 human chromosomal region and thus represents an additional genetic cause of OCA, termed OCA5, while the gene is eventually identified. In addition, two new genes have been identified as causing OCA when mutated: SLC24A5 and C10orf11, and hence designated as OCA6 and OCA7, respectively. This consensus review, involving all laboratories that have reported these new genes, aims to update and agree upon the current gene nomenclature and types of albinism, while providing additional insights from the function of these new genes in pigment cells. This article is protected by copyright. All rights reserved.
    Full-text · Article · Sep 2013
Show more