Tissue-Specific Regulation of Growth Hormone (GH) Receptor and Insulin-Like Growth Factor-I Gene Expression in the Pituitary and Liver of GH-Deficient ( lit/lit ) Mice and Transgenic Mice that Overexpress Bovine GH (bGH) or a bGH Antagonist

Division of Endocrinology and Metabolism, Department of Internal Medicine, University of Virginia, Charlottesville, Virginia 22908, USA.
Endocrinology (Impact Factor: 4.5). 05/2004; 145(4):1564-70. DOI: 10.1210/en.2003-1486
Source: PubMed
ABSTRACT
GH has diverse biological actions that are mediated by binding to a specific, high-affinity cell surface receptor (GHR). Expression of GHR is tissue specific and a requirement for cellular responsiveness to GH. IGF-I is produced in multiple tissues and regulated in part by GH through GHR. In this study, we evaluated GHR and IGF-I mRNA expression in pituitary gland and compared the levels with those derived from liver of bovine GH transgenic, GH antagonist transgenic, lit/lit mice, and their respective controls using real-time RT-PCR. In liver, both GHR and IGF-I mRNA expressions were regulated in parallel with GH action in all three animal models, and there was a strong correlation between GHR and IGF-I mRNA levels. In the pituitary gland, increased expression of IGF-I mRNA in the pituitary of bovine GH transgenic mice was observed, whereas IGF-I expression in GH antagonist transgenic or lit/lit mice was similar to that observed in control animals. There were no differences of GHR mRNA levels in pituitary gland of any groups we examined. There was also no correlation between GHR and IGF-I mRNA levels in any group in the pituitary gland. In conclusion, we found that hepatic GHR and IGF-I mRNA levels were strongly correlated with each other in chronic GH excess or deficient state, and that regulation and correlation between local GHR and IGF-I mRNA levels induced by GH is different between liver and pituitary gland.

Full-text

Available from: Michael O Thorner
Tissue-Specific Regulation of Growth Hormone (GH)
Receptor and Insulin-Like Growth Factor-I Gene
Expression in the Pituitary and Liver of GH-Deficient
(lit/lit) Mice and Transgenic Mice that Overexpress
Bovine GH (bGH) or a bGH Antagonist
KEIJI IIDA, JUAN P. DEL RINCON, DONG-SUN KIM, EMINA ITOH, RALF NASS,
KAREN T. COSCHIGANO, JOHN J. KOPCHICK, AND MICHAEL O. THORNER
Division of Endocrinology and Metabolism (K.I., J.P.R., D.-S.K., E.I., R.N., M.O.T.), Department of Internal Medicine,
University of Virginia, Charlottesville, Virginia 22908; and Edison Biotechnology Institute (K.T.C., J.J.K.) and Department
of Biomedical Sciences (J.J.K.), College of Osteopathic Medicine, Ohio University, Athens, Ohio 45701
GH has diverse biological actions that are mediated by bind-
ing to a specific, high-affinity cell surface receptor (GHR).
Expression of GHR is tissue specific and a requirement for
cellular responsiveness to GH. IGF-I is produced in multiple
tissues and regulated in part by GH through GHR. In this
study, we evaluated GHR and IGF-I mRNA expression in pi-
tuitary gland and compared the levels with those derived from
liver of bovine GH transgenic, GH antagonist transgenic, lit/lit
mice, and their respective controls using real-time RT-PCR. In
liver, both GHR and IGF-I mRNA expressions were regulated
in parallel with GH action in all three animal models, and
there was a strong correlation between GHR and IGF-I mRNA
levels. In the pituitary gland, increased expression of IGF-I
mRNA in the pituitary of bovine GH transgenic mice was ob-
served, whereas IGF-I expression in GH antagonist transgenic
or lit/lit mice was similar to that observed in control animals.
There were no differences of GHR mRNA levels in pituitary
gland of any groups we examined. There was also no corre-
lation between GHR and IGF-I mRNA levels in any group in
the pituitary gland. In conclusion, we found that hepatic GHR
and IGF-I mRNA levels were strongly correlated with each
other in chronic GH excess or deficient state, and that regu-
lation and correlation between local GHR and IGF-I mRNA
levels induced by GH is different between liver and pituitary
gland. (Endocrinology 145: 1564 –1570, 2004)
G
H HAS DIVERSE biological actions that are mediated
by binding to a specific, high-affinity cell surface re-
ceptor (GHR) (1). Expression of this receptor is a requirement
for cellular responsiveness to GH. Tissue sensitivity to GH
depends, at least in part, upon the abundance of GHR (2). GH
does not only stimulate IGF-I production but also can reg-
ulate GHR expression. GHR mRNA expression in GH-defi-
cient rodents has been found to be down-regulated in white
adipose tissue (3, 4), unchanged in brain, spleen, kidney,
heart, and skeletal muscle (5, 6), and either down-regulated,
up-regulated, or unchanged in liver (2, 4 8).
The pituitary gland is normally exposed to high local con-
centrations of GH. It is thus likely that a mechanism or
mechanisms to decrease responsiveness to GH in the pitu-
itary gland is present. One such mechanism might be a de-
creased level of GHR. The regulation of GHR by GH in
pituitary gland, to the best of our knowledge, has not been
reported before.
There are some reports supporting that pituitary IGF-I
expression is also regulated by GH (9, 10). The IGF-I mRNA
expression of GH3 cells and primary rat anterior pituitary
cells was markedly diminished when these cells were grown
in T
3
-depleted medium that decreases GH synthesis (9). Ad
-
dition of T
3
or GH induced IGF-I mRNA transcripts and
protein in a time- and dose-dependent manner (9). In vivo,
administration of T
3
or GH to thyroidectomized rats en
-
hanced expression of pituitary IGF-I (10), and IGF-I expres-
sion was increased in rats harboring somatomammotrope
tumors that had high circulating GH concentrations (11).
If both IGF-I and GHR are regulated by GH action in a
specific tissue, a correlation is likely to be found. We there-
fore studied in vivo: 1) the absolute GHR mRNA level in
pituitary gland and compared it to that in liver; 2) the reg-
ulation of GHR by GH in mouse models with either in-
creased, moderately decreased, and severely decreased GH
action; and 3) the relationship between GHR and IGF-I
mRNA levels in liver and pituitary gland.
Materials and Methods
Animals and tissues
All studies were performed in 3-month-old male mice. Three different
strains of mice, referred to as bGH (giant transgenic mice that overex-
press bovine GH) (12), GHA (dwarf mice that overexpress bovine GH-
G119K antagonist) (12, 13), and lit/lit (dwarf mice with an inactivating
mutation of GHRH receptor) (14) were used in this study. Their respec-
tive nontransgenic littermates or lit/ for lit/lit mice were used as con-
trols. The production and characterization of transgenic mice expressing
either bGH or GH-G119K (GHA) genes have been described in detail (12,
Abbreviations: bGH, Bovine transgenic GH; GHA, GH antagonist
transgenic; GHR, GH receptor; MT, metallothionein I.
Endocrinology is published monthly by The Endocrine Society (http://
www.endo-society.org), the foremost professional society serving the
endocrine community.
0013-7227/04/$15.00/0 Endocrinology 145(4):1564–1570
Printed in U.S.A. Copyright © 2004 by The Endocrine Society
doi: 10.1210/en.2003-1486
1564
Page 1
13). Expression of a transgene encoding either bGH or GHA was directed
by mouse metallothionein I (MT) transcriptional regulatory region. Food
and water were supplied ad libitum. The previously published serum
IGF-I concentrations for bGH, GHA, and lit/lit mice are approximately
200%, 40%, and 20% of normal, respectively (12, 15, 16). Pituitary glands
and livers from the mice (n 5/group) were collected and flash-frozen
in liquid nitrogen and then stored at 80 C for subsequent mRNA
analysis. All animal protocols were approved by the University of Vir-
ginias and the Ohio Universitys Institutional Animal Care and Use
Committees.
Total RNA preparations
The RNA extraction was performed using TRI Reagent (Molecular
Research Center, Inc., Cincinnati, OH) followed by RNeasy Mini Kit
(QIAGEN, Valencia, CA) according to the manufacturers instructions.
To eliminate genomic deoxy-RNA (DNA) from the samples, deoxyri-
bonuclease I treatment (QIAGEN) was included in the RNA isolation
procedure. The quantity of extracted total RNA was determined using
the RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR)
with a Genios multidetection plate reader (Phenix Research Product,
Hayward, CA).
Primer design
All primers were purchased from QIAGEN. Primers for murine GH,
GHR, and IGF-I were designed to produce amplification products which
spanned at least two exons of the protein coding sequence to avoid
amplification of genomic DNA. 18S rRNA was used as an internal
control and was amplified with previously reported primers (17). Primer
sequences and the expected size of real-time RT-PCR products are listed
in Table 1. We also designed primers specific for bGH to confirm that
primers specific for murine and bovine GH did not cross-react. The
primer pairs we used to amplify GHR coded exclusively for GHR and
not for GHBP because they were directed to the intracellular domain
of GHR.
RT
One microgram total RNA from the liver and 100 ng total RNA from
the pituitary were reverse-transcribed in a total volume of 10
l using
the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA).
Reactions were incubated for 5 min at 25 C, 30 min at 42 C, and 5 min
at 85 C. Reaction lacking reverse transcriptase were also performed to
generate controls for assessment of genomic DNA contamination. A 1:20
dilution of the resultant cDNA was prepared, and 4
l of this template
was used in the real-time PCR protocol.
Plasmid construction
A PCR fragment generated using primers listed in Table 1 was cloned
in the pGEM-T vector (Promega, Madison, WI) and introduced in Es-
herichia coli JM109 (Promega). From a selected transformant containing
the desired construct, plasmid DNA was isolated using the Qiaprep Spin
Miniprep Kit (QIAGEN). The DNA concentration of each resulting plas-
mid was measured using a Biomate spectrophotometer (260 nm/280
nm) (Thermo Spectronic, Rochester, NY). A serial dilution of each plas-
mid was used to make a standard curve for quantification.
PCR
The iCycler iQ Real-Time PCR detection system (Bio-Rad Laborato-
ries, Inc.) was used for sample cDNA quantification. Each reaction
contained cDNA, 200
mol/liter each deoxyribonucleotide triphos-
phate, forward and reverse primers, the concentrations of which are
listed in Table 1, 2 mmol/liter MgCl
2
, 0.5 IU Jumpstar Taq DNA poly
-
merase (Sigma, St. Louis, MO) with supplied buffer, and 10 nm fluo-
resceine calibration dye (Bio-Rad Laboratories, Inc.). In addition, SYBR
Green I (1:75,000 of 10,000 stock solution) (Molecular Probes) was
added and made up to a total volume of 20
l with sterile water. The
real-time PCR protocol was 5 min at 95 C followed by 40 cycles of 15 sec
at 94 C, 40 sec at 62 C, and 45 sec at 72 C. To assess PCR specificity,
melting curves from 5595 C in 0.5 C steps of 10 sec each were generated.
PCR products of each assay were also subjected to agarose gel electro-
phoresis to further confirm amplification specificity. PCR efficiencies of
all reactions were between 95% and 100%. All measurements were
performed in triplicate and repeated a series of experiments twice in-
dependently except for the RNA extraction step. All specific quantities
were corrected for the amount of 18S rRNA amplified.
Quantification
A standard curve was generated by amplifying serial dilutions of a
known quantity of plasmid. The standards in triplicate and cDNA sam-
ples were then coamplified in the same reaction. The standard curve
displayed a linear relationship between cycle threshold values and the
logarithm of input plasmid copy number. The dynamic range of the
standard curve spanned at least five orders of magnitude. The amount
of product in a particular sample is determined by interpolation from a
standard curve of cycle threshold values generated from the plasmid
dilution series.
Statistical analysis
Results are expressed as mean sem. Differences were determined
by unpaired t test. Coefficients of linear correlation (Pearsons) for GHR
and IGF-I mRNA levels were calculated using Prism 3.0 software. P
0.05 was considered significant.
Results
Weights of mice are shown in Table 2. PCR specificity was
confirmed using melting curves and agarose gel electro-
phoresis. Agarose gel electrophoresis demonstrated a single
band with the expected size, and all products showed a single
melting peak on real-time PCR (data not shown). The primer
pairs used to amplify murine GH did not cross-react with
bovine GH (Fig. 1A, lane 7). The pituitaries of GHA and bGH
transgenic mice expressed bovine GH as well as murine GH
(Fig. 1A, lanes 3 6), showing that the transgene driven by MT
TABLE 1. Forward (-F) and reverse (-R) primer sequences, amplification product length, and concentration used to measure gene
expressions by real-time RT-PCR
Primer Sequence (53) Length (bp) Concentration (nM)
GH-F CTACAAAGAGTTCGAGCGTGCCTAC 142 400
GH-R CAATTCCATGTCGGTTCTCTGCT 400
bGH-F CTTCAAAGAGTTTGAGCGCACCTAC 142 400
bGH-R CAGCTCCAAGTCTGATTTCTGCT 400
IGF-I-F GTGTGGACCGAGGGGCTTTTACTTC 146 300
IGF-I-R GCTTCAGTGGGGCACAGTACATCTC 300
GHR-F GATTTTACCCCCAGTCCCAGTTC 198 300
GHR-R GACCCTTCAGTCTTCTCATCCACA 300
18S-F TCAAGAACGAAAGTCGGAGG 489 300
18S-R GGACATCTAAGGGCATCACA 300
Iida et al. Tissue-Specific Regulation of GHR and IGF-I Endocrinology, April 2004, 145(4):1564 1570 1565
Page 2
promoter (MT-bGH) was expressed in the pituitary gland.
Figure 1B shows the expression of MT-bGH (G119K) or MT-
bGH in liver of GHA and bGH mice, respectively, but not in
that of littermate controls.
Hepatic IGF-I mRNA levels of bGH mice were 315% of
those of controls. Those of GHA or lit/lit mice were 37% and
12% of those of control or lit/ mice, respectively (Fig. 2).
Hepatic GHR mRNA levels of bGH mice were 507% of those
of control mice. Those of GHA or lit/lit mice were 34% and
51% of those of control or lit/ mice, respectively (Fig. 3).
In the pituitary gland, murine GH mRNA levels of bGH
mice were markedly suppressed (14% of control). Those of
GHA mice were increased (273% vs. control) and of lit/lit
mice were suppressed (22% of those in lit/ mice) (Fig. 4).
Pituitary IGF-I mRNA levels of bGH mice were significantly
increased (207%) compared with those of control mice. On
the other hand, those of GHA or lit/lit mice were comparable
to those of control or lit/ mice, respectively (Fig. 5). Pituitary
GHR mRNA levels of bGH, GHA, or lit/lit mice were ex-
tremely low and comparable with those of each control mice
(Fig. 6).
We also quantitated the MT-bGH or MT-bGH (G119K)
mRNA levels in liver as well as in pituitary. In bGH mice, the
expressions of MT-bGH /18S rRNA in liver and in pituitary
gland were 0.044 0.005 (copy number) and 0.0031 0.0003
(copy number), respectively. In GHA mice, the expressions
of MT-bGH (G119K)/18S rRNA in liver and in pituitary
gland were 0.032 0.007 (copy number) and 0.0020 0.0005
(copy number), respectively. The relative amount of murine
GH and MT-bGH in pituitary gland was summarized in
Table 3.
Because the mRNA changes of IGF-I and GHR appeared
to correlate with GH action in the liver, we examined the
correlation between IGF-I and GHR mRNA in liver and
pituitary gland. Despite the small size of the groups, there
FIG. 2. IGF-I mRNA levels in liver. n 5/each group. **, P 0.01 vs.
respective control mice.
FIG. 3. GHR mRNA levels in liver. n 5/each group. *, P 0.05; **,
P 0.01 vs. respective control mice.
TABLE 2. Weights of animals
Animal Control for bGH bGH
a
Control for GHA GHA
b
lit/ lit/lit
b
Weight (g) 29.9 1.0 42.7 1.6 27.2 1.3 19.8 0.8 24.7 1.7 13 0.6
a
P 0.0005,
b
P 0.005 vs. respective control.
FIG. 1. A, Agarose gel electrophoresis of RT-PCR products derived
from the pituitary of wild-type mice (wild), GHA, bGH, or bovine
pituitary RNA with specific primers for murine (m) or bGH. Because
RT-PCR was performed with 40 cycles of amplification, the results
were qualitative but not quantitative. B, Agarose gel electrophoresis
of RT-PCR products derived from the liver of wild, GHA, and bGH
mice with primer pair specific for bGH (b).
1566 Endocrinology, April 2004, 145(4):1564 1570 Iida et al. Tissue-Specific Regulation of GHR and IGF-I
Page 3
were significant linear correlations between IGF-I and GHR
mRNA levels in liver of the lit/lit and GHA mice, and there
was a trend toward correlation in the control group for GHA
(r 0.823, P 0.087), and in the control group for bGH (r
0.870, P 0.055). In bGH group, the GHR expression was
high, and this was associated with high IGF-I mRNA (Fig. 7).
In contrast, there was no significant correlation in any group
between the same variables in the pituitary gland (Fig. 8).
Discussion
In this study, we used three mouse models with different
levels of GH action. We have investigated the regulation of
IGF-I and GHR mRNAs in pituitary gland of these mice and
compared these results with those in liver. Interestingly, we
found that there was a strong correlation in the mRNA levels
between IGF-I and GHR in liver, but not in pituitary. In
addition, we believe this is the first report concerning the
regulation of GHR mRNA by GH in pituitary gland.
GH enhances IGF-I transcription (18) and increases IGF-I
mRNA abundance in most tissues (19). In liver, our results
confirmed increased levels of IGF-I mRNA in bGH mice and
decreased levels in GHA and lit/lit mice, which are consistent
with circulating IGF-I levels. There are conflicting results
concerning the regulation of hepatic GHR by GH (2). Chronic
GH therapy to a normal, wild-type animal increases GH
binding in hepatic tissue (2022). On the other hand, a single
GH injection to GH-deficient mice resulted in down-regu-
lation of GH binding to hepatic GHR (23), suggesting that the
effect of GH on hepatic GHR expression might depend on the
duration of exposure to GH. Alternatively, it might depend
on the concentration of circulating GH or pulsatility. Hepatic
GHR increased more in response to continuous than to pul-
satile administration of GH (24, 25). Our data in bGH mice
demonstrated that hepatic GHR mRNA levels were mark-
edly increased compared with those of control mice. The
chronic exposure to high GH levels and/or the nonpulsatile
pattern of exposure might enhance the up-regulation of he-
patic GHR. Alternatively, insulin might play a role in the
up-regulation of hepatic GHR because bGH mice are known
to have elevated insulin concentrations (26). In this report,
hepatic GHR mRNA levels in GHA or lit/lit mice were de-
creased, in parallel with GH action. In GHA mice, Chen et al.
(12) reported that the binding properties of GH to the hepatic
membranes increased. On the other hand, Sotelo et al. (27)
FIG. 4. Murine GH mRNA levels in pituitary gland. n 5/each group.
*, P 0.05 vs. control mice; **, P 0.01 vs. respective control mice.
FIG. 5. IGF-I mRNA levels in pituitary gland. n 5/each group. *,
P 0.05 vs. respective control mice. NS, Not significant.
FIG. 6. GHR mRNA levels in pituitary gland. n 5/each group. NS,
Not significant.
TABLE 3. Comparison of the local expression between murine
GH and MT-bGH in pituitary gland
Murine GH mRNA/18S
rRNA (copy no.)
MT-bGH mRNA/18S
rRNA (copy no.)
Control for bGH 1.0 0.3 ND
bGH 0.14 0.08
a
0.0031 0.0003
Control for GHA 1.1 0.2 ND
GHA 3.0 0.3
b
0.0020 0.0005
a
P 0.01,
b
P 0.05 vs. control; ND, not detected.
Iida et al. Tissue-Specific Regulation of GHR and IGF-I Endocrinology, April 2004, 145(4):1564 1570 1567
Page 4
showed that hepatic uptake of injected labeled bGH in GHA
mice was reduced to 1/5 of the values measured in normal
animals. Taken together with our results, hepatic GHR
mRNA levels in GHA mice parallel GH action; GHR protein
levels on the cell surface do not change in parallel because
recruitment of hepatic GHR might be impaired because the
GH antagonist inhibits proper GHR dimerization and deg-
radation in this model. Interestingly, we observed a strong
correlation between hepatic IGF-I and GHR mRNA levels in
groups with normal, partially reduced (GHA) and severely
reduced (lit/lit) GH action. It was not surprising that there
was no correlation in bGH group because the GHR and
IGF-mRNA levels were already high. Furthermore, GHR/
IGF-I ratio appeared to decrease in parallel with GH action
(Fig. 7). These results suggest that a common factor or factors,
including GH per se, may regulate both IGF-I and GHR
mRNA levels in liver.
In the pituitary gland, our results showed that murine GH
mRNA levels in bGH mice were extremely reduced. This
decrease of murine GH expression can be explained by the
effect of negative feedback of increased circulating IGF-I
concentration at the pituitary and/or by feedback by circu-
lating GH at the hypothalamus (28). Stefaneanu et al. (29)
found that GH-immunoreactive cells were markedly re-
duced in size and moderately decreased in number in a bGH
mouse model, suggesting that reduced GH mRNA is accom-
panied by hypoplasia of somatotropes. On the other hand,
our results showed that murine GH mRNA levels in GHA
mice were significantly increased compared with control
littermates. The increase of murine GH could be explained by
reduced negative feedback of low concentration of circulat-
ing IGF-I and is in agreement with a previous report de-
scribing protein levels of GH in these mice (12). The local
expression of MT-bGH or MT-bGH (G119K) in pituitary
gland should also be taken into account in bGH or GHA
mice. However, the expression of MT-bGH or MT-bGH
(G119K) in pituitary was small compared with murine GH
(Table 3). As expected, our results showed that expression of
GH in lit/lit mice was reduced compared with lit/ mice. Lin
et al. (30) found that somatotropes of lit/lit mice were reduced
FIG. 7. There was a correlation between IGF-I
and GHR mRNA levels in a group of lit/lit,or
GHA mice (lit/lit:r 0.970, P 0.006; GHA: r
0.987, P 0.002), and there was a trend toward
correlation in the control group for GHA (r
0.823, P 0.087), and in the control group for
bGH (r 0.870, P 0.055). There was also a
significant linear correlation between GHR and
IGF-I mRNA levels in liver if all groups are an-
alyzed together (r 0.912, P 0.0001).
FIG. 8. No correlation was observed between IGF-I
and GHR mRNA levels in any group in pituitary
gland.
1568 Endocrinology, April 2004, 145(4):1564 1570 Iida et al. Tissue-Specific Regulation of GHR and IGF-I
Page 5
in size and number, also suggesting that reduced GH mRNA
is accompanied by hypoplasia of somatotropes in this model.
Taken together with the results from bGH mice, diminished
GHRH receptor signaling seems to be responsible for both
reduced murine GH mRNA expression and hypoplasia of
somatotropes.
We showed that the expression of IGF-I in pituitary of
GHA was comparable to those of control littermates despite
low GH action and low concentrations of circulating IGF-I.
It should be noted that murine GH mRNA levels were in-
creased (Fig. 4) and locally produced MT-bGH (G119K) was
negligible in pituitary gland (Table 3). Unexpectedly, pitu-
itaries of lit/lit mice and lit/ mice also showed comparable
levels of IGF-I mRNA in pituitary gland despite reduced
expression of local GH as well as circulating GH in lit/lit mice.
One possible explanation is that GH-independent factors
may maintain local production of IGF-I in chronic state of
reduced GH action such as lit/lit or GHA mice. It is inter-
esting that pituitaries of other animal models with low cir-
culating IGF-I levels induced by streptozotocin (31) or food-
deprived (32) also demonstrated no changes of IGF-I mRNA
in pituitary gland. In contrast, we showed that IGF-I mRNA
levels in pituitary of bGH mice were increased significantly,
suggesting that excessive GH played an additive role to
stimulate IGF-I expression in pituitary gland. Our results
also confirmed the previous report demonstrating that GH
stimulates the IGF-I expression in pituitary gland in an en-
docrine rather than autocrine/paracrine fashion (11). Fagin
et al. (11) evaluated pituitary IGF-I gene expression in rats
harboring sc implanted somatomammotropic tumors. The
pituitary IGF-I gene expression was stimulated in these an-
imals despite reduced pituitary GH mRNA expression.
Therefore, they concluded that stimulated pituitary IGF-I
mRNA appeared to be dependent on endocrine, and not
paracrine, pituitary GH concentrations. Our results using
bGH mice also demonstrated that pituitary IGF-I mRNA
levels in bGH mice were approximately twice as high as
those in control mice, whereas pituitary GH mRNA levels in
bGH mice were 14% of those in control mice.
In contrast to the results from liver, GHR mRNA levels in
pituitary were not statistically different in all three animal
models we used. In addition, we confirmed that GHR mRNA
levels in pituitary were extremely low compared with 18S
rRNA (Fig. 6). Low levels of GHR mRNA may be responsible
for reduced GH responsiveness, and for unaltered IGF-I
mRNA levels in pituitary of all mice we used except of bGH
mice. Moreover, our results showed that there was no cor-
relation between IGF-I and GHR mRNA levels in pituitary
gland in any mice group (Fig. 8), in contrast with the results
from liver (Fig. 7). The physiological significance of GHR in
pituitary is still unclear. The pituitary cells of GHR-disrupted
mice exhibited normal ultrastructural morphology except for
hyperplasia of somatotropes (33). However, Honda et al. (34)
detected the GHR mRNA using in situ hybridization tech-
nique on somatotropes, lactotropes, and some gonadotropes,
but not corticotropes or thyrotropes in mice. Moreover, they
demonstrated that GH stimulated IGF-I mRNA expression
directly in cultured mouse anterior pituitary cells, suggesting
that GHR mRNA detected in pituitary cells was translated
into the functional protein. The localizations of GHR in pi-
tuitary gland suggest that GHR might play a role in the cell
biology of somatotropes, lactotropes, and/or gonadotropes
although disrupted GHR signaling causes no morphological
changes on these cells (33).
There are several distinct 5 untranslated region variants
in mouse GHR (35, 36). Expression of each transcript is reg-
ulated in a tissue- and developmental stage-specific manner.
The difference of regulation of GHR expression between liver
and pituitary may be explained by use of different tran-
scripts. Further investigation is required to clarify the reg-
ulation of GHR in pituitary gland.
In conclusion, our results showed that regulation of GHR
as well as IGF-I mRNA levels are tissue specific. There was
a significant correlation in the mRNA levels between hepatic
GHR and IGF-I. The local expression of GHR may play a role
to regulate GHR signaling in a tissue-specific manner to
maintain the local homeostasis.
Acknowledgments
We are grateful to Dr. Bruce Gaylinn, Amy Holland, and Pattie
Hellmann for their excellent technical assistance.
Received November 3, 2003. Accepted January 7, 2004.
Address all correspondence and requests for reprints to: M. O. Thor-
ner, Box 800466, Department of Internal Medicine, University of Vir-
ginia, Charlottesville, Virginia 22908. E-mail: mot@virginia.edu.
This work was supported in part by a grant from Foundation for
Growth Science in Japan (to K.I.) and by a grant from Pharmacia Corp
(to M.O.T.) and a gift to the laboratory by Mr. and Mrs. Sal Ranieri. J.J.K.
is supported, in part, by the state of Ohios Eminent Scholar Program that
includes a gift by Milton and Lawrence Goll and by DiAthegen, LLC.
References
1. Baumann G 1991 Growth hormone heterogeneity: genes, isohormones, vari-
ants, and binding proteins. Endocr Rev 12:424 449
2. Schwartzbauer G, Menon RK 1998 Regulation of growth hormone receptor
gene expression. Mol Genet Metab 63:243253
3. Vikman K, Carlsson B, Billig H, Eden S 1990 Expression and regulation of
growth hormone (GH) receptor messenger ribonucleic acid (mRNA) in rat
adipose tissue, adipocytes, and adipocyte precursor cells: GH regulation of GH
receptor mRNA. Endocrinology 129:11551161
4. Frick GP, Leonard JL, Goodman HM 1990 Effect of hypophysectomy on
growth hormone receptor gene expression in rat tissues. Endocrinology 126:
30763082
5. Hull KL, Harvey S 1998 Autoregulation of growth hormone receptor and
growth hormone binding protein transcripts in brain and peripheral tissues of
the rat. Growth Horm IGF Res 8:167173
6. Butler AA, Funk B, Breier BH, LeRoith D, Roberts Jr CT, Gluckman PD 1996
Growth hormone (GH) status regulates GH receptor and GH binding protein
mRNA in a tissue- and transcript-specific manner but has no effect on insulin-
like growth factor-I receptor mRNA in the rat. Mol Cell Endocrinol 116:181189
7. Mathews LS, Enberg B, Norstedt G 1989 Regulation of rat growth hormone
receptor gene expression. J Biol Chem 264:99059910
8. Maiter D, Walker JL, Adam E, Moatsstaats B, Mulumba N, Ketelslegers JM,
Underwood LE 1992 Differential regulation by growth hormone (GH) of
insulin-like growth factor I and GH receptor/binding protein gene expression
in rat liver. Endocrinology 130:32573264
9. Fagin JA, Fernandez-Mejia C, Melmed S 1989 Pituitary insulin-like growth
factor-I gene expression: regulation by triiodothyronine and growth hormone.
Endocrinology 125:23852391
10. Matsuo K, Yamashita S, Niwa M, Kurihara M, Harakawa S, Izumi M, Na-
gataki S, Melmed S 1990 Thyroid hormone regulates rat pituitary insulin-like
growth factor-I receptors. Endocrinology 126:550554
11. Fagin JA, Brown A, Melmed S 1988 Regulation of pituitary insulin-like growth
factor-I messenger ribonucleic acid levels in rats harboring somatomammo-
tropic tumors: implications for growth hormone autoregulation. Endocrinol-
ogy 122:22042210
12. Chen WY, White ME, Wagner TE, Kopchick JJ 1991 Functional antagonism
between endogenous mouse growth hormone (GH) and a GH analog results
in dwarf transgenic mice. Endocrinology 129:14021408
13. Chen WY, Wight DC, Mehta BV, Wagner TE, Kopchick JJ 1991 Glycine 119
Iida et al. Tissue-Specific Regulation of GHR and IGF-I Endocrinology, April 2004, 145(4):1564 1570 1569
Page 6
of bovine growth hormone is critical for growth-promoting activity. Mol En-
docrinol 5:18451852
14. Godfrey P, Rahal JO, Beamer WG, Copeland NG, Jenkins NA, Mayo KE 1993
GHRH receptor of little mice contains a missense mutation in the extracellular
domain that disrupts receptor function. Nat Genet 4:227232
15. Donahue LR, Beamer WG 1993 Growth hormone deficiency in little mice
results in aberrant body composition, reduced insulin-like growth factor-I and
insulin-like growth factor-binding protein-3 (IGFBP-3), but does not affect
IGFBP-2, -1 or -4. J Endocrinol 136:91104
16. Nissley SP, Knazek RA, Wolff GL 1980 Somatomedin activity in sera of
genetically small mice. Horm Metab Res 12:158 164
17. Selvey S, Thompson EW, Matthaei K, Lea RA, Irving MG, Griffiths LR 2001
-Actinan unsuitable internal control for RT-PCR. Mol Cell Probes 15:
307311
18. Mathews LS, Norstedt G, Palmiter RD 1986 Regulation of insulin-like growth
factor I gene expression by growth hormone. Proc Natl Acad Sci USA 83:
93439347
19. Daughaday WH, Rotwein P 1989 Insulin-like growth factors I and II. Peptide,
messenger ribonucleic acid and gene structures, serum, and tissue concentra-
tions. Endocr Rev 10:6891
20. Baxter RC, Zaltsman Z 1984 Induction of hepatic receptors for growth hor-
mone (GH) and prolactin by GH infusion is sex independent. Endocrinology
115:20092014
21. Baxter RC, Zaltsman Z, Turtle JR 1982 Induction of somatogenic receptors in
livers of hypersomatotropic rats. Endocrinology 111:1020 1022
22. Chung CS, Etherton TD 1986 Characterization of porcine growth hormone
(pGH) binding to porcine liver microsomes: chronic administration of pGH
induces pGH binding. Endocrinology 119:780786
23. Maiter D, Underwood LE, Maes M, Ketelslegers JM 1988 Acute down-
regulation of the somatogenic receptors in rat liver by a single injection of
growth hormone. Endocrinology 122:12911296
24. Bick T, Hochberg Z, Amit T, Isaksson OG, Jansson JO 1992 Roles of pulsa-
tility and continuity of growth hormone (GH) administration in the regulation
of hepatic GH-receptors, and circulating GH-binding protein and insulin-like
growth factor-I. Endocrinology 131:423429
25. Maiter D, Underwood LE, Maes M, Davenport ML, Ketelslegers JM 1988
Different effects of intermittent and continuous growth hormone (GH) ad-
ministration on serum somatomedin-C/insulin-like growth factor I and liver
GH receptors in hypophysectomized rats. Endocrinology 123:10531059
26. Dominici FP, Cifone D, Bartke A, Turyn D 1999 Loss of sensitivity to insulin
at early events of the insulin signaling pathway in the liver of growth hormone-
transgenic mice. J Endocrinol 161:383392
27. Sotelo AI, Bartke A, Kopchick JJ, Knapp JR, Turyn D 1998 Growth hormone
(GH) receptors, binding proteins and IGF-I concentrations in the serum of
transgenic mice expressing bovine GH agonist or antagonist. J Endocrinol
158:5359
28. Giustina A, Veldhuis JD 1998 Pathophysiology of the neuroregulation of
growth hormone secretion in experimental animals and the human. Endocr
Rev 19:717797
29. Stefaneanu L, Kovacs K, Bartke A, Mayerhofer A, Wagner TE 1993 Pituitary
morphology of transgenic mice expressing bovine growth hormone. Lab Invest
68:584591
30. Lin SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE, Rosenfeld MG 1993
Molecular basis of the little mouse phenotype and implications for cell type-
specific growth. Nature 364:208213
31. Olchovsky D, Bruno JF, Gelato MC, Song J, Berelowitz M 1991 Pituitary
insulin-like growth factor-I content and gene expression in the streptozotocin-
diabetic rat: evidence for tissue-specific regulation. Endocrinology 128:923928
32. Olchovsky D, Song J, Gelato MC, Sherwood J, Spatola E, Bruno JF, Bere-
lowitz M 1993 Pituitary and hypothalamic insulin-like growth factor-I (IGF-I)
and IGF-I receptor expression in food-deprived rats. Mol Cell Endocrinol
93:193198
33. Asa SL, Coschigano KT, Bellush L, Kopchick JJ, Ezzat S 2000 Evidence for
growth hormone (GH) autoregulation in pituitary somatotrophs in GH an-
tagonist-transgenic mice and GH receptor-deficient mice. Am J Pathol 156:
10091015
34. Honda J, Manabe Y, Matsumura R, Takeuchi S, Takahashi S 2003 IGF-I
regulates pro-opiomelanocortin and GH gene expression in the mouse pitu-
itary gland. J Endocrinol 178:7182
35. Menon RK, Shaufl A, Yu JH, Stephan DA, Friday RP 2001 Identification and
characterization of a novel transcript of the murine growth hormone receptor
gene exhibiting development- and tissue-specific expression. Mol Cell Endo-
crinol 172:135146
36. Edens A, Talamantes F 1998 Alternative processing of growth hormone re-
ceptor transcripts. Endocr Rev 19:559582
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.
1570 Endocrinology, April 2004, 145(4):1564 1570 Iida et al. Tissue-Specific Regulation of GHR and IGF-I
Page 7
  • Source
    • "A recent study by our group using an Alfp-Cre-mediated STAT5 knockout in the settings of systemic GH overexpression provided an additional hint that STAT5 signaling in liver is essential for GH-stimulated body growth (Friedbichler et al., 2012 ). Overexpression of GH in mice leads to an alteration of body proportions resulting in an acromegaly-like phenotype and differential enlargement of internal organs (Eisen et al., 1998; Iida et al., 2004 ). In contrast , up to 9 weeks of age mice overexpressing GH but lacking hepatic STAT5 display body growth identical to that of wild type (wt) littermates. "
    Full-text · Dataset · Dec 2012
  • Source
    • "The analysis was carried out according to the standard procedures , as described in the Extended Experimental Procedures. Pituitary Gh mRNA was quantified as reported (Iida et al., 2004 ). To assess expression levels of Igf1, Igfals, Igfbp3, Ghr, and Igf1r mRNA in tissues and fibroblasts , we used the comparative Ct (delta delta Ct) method to normalize target gene mRNA to Gapdh mRNA, as reported (Kohsaka et al., 2007). "
    [Show abstract] [Hide abstract] ABSTRACT: The growth hormone (GH)-insulin-like growth factor 1 (IGF1) axis mediates postnatal body growth. The GH receptor has been regarded as the sole receptor that mediates the Janus kinase 2 (JAK2)/signal transducers and activators of the transcription 5B (STAT5B) signal toward IGF1 synthesis. Here, we report a signaling pathway that regulates postnatal body growth through EphA4, a member of the Eph family of receptor tyrosine kinases and a mediator of the cell-cell contact-mediated signaling. EphA4 forms a complex with the GH receptor, JAK2, and STAT5B and enhances Igf1 expression predominantly via the JAK2-dependent pathway, with some direct effect on STAT5B. Mice with a defective Epha4 gene have a gene dose-dependent short stature and low plasma IGF1 levels. Igf1 messenger RNA (mRNA) in the liver and many other tissues was also significantly reduced in Epha4-knockout mice, whereas pituitary Gh mRNA and plasma GH levels were not. These findings suggest that the local cell-cell contact-mediated ephrin/EphA4 signal is as important as the humoral GH signal in IGF1 synthesis and body size determination
    Full-text · Article · Sep 2012 · Cell Reports
  • Source
    • "In addition, IGF-I mRNA levels were increased in the liver but not the muscle or brain of rainbow trout after GH injection (Gahr et al., 2008). Conversely, a study by Iida et al. (2004) on GH transgenic mice suggested that IGF-I mRNA levels in the pituitary do increase when exposed to chronically higher GH, and that IGF-I is regulated differently between the pituitary and liver. There appears to be induction of IGF-I in non-hepatic tissues of GH transgenic coho salmon in the present study (which measured all IGF-I forms in total) but the manner by which various IGF-I transcripts may be involved needs to be determined and compared among species and transgenic strains. "
    [Show abstract] [Hide abstract] ABSTRACT: Non-transgenic (wild-type) coho salmon (Oncorhynchus kisutch), growth hormone (GH) transgenic salmon (with highly elevated growth rates), and GH transgenic salmon pair fed a non-transgenic ration level (and thus growing at the non-transgenic rate) were examined for plasma hormone concentrations, and liver, muscle, hypothalamus, telencephalon, and pituitary mRNA levels. GH transgenic salmon exhibited increased plasma GH levels, and enhanced liver, muscle and hypothalamic GH mRNA levels. Insulin-like growth factor-I (IGF-I) in plasma, and growth hormone receptor (GHR) and IGF-I mRNA levels in liver and muscle, were higher in fully fed transgenic than non-transgenic fish. GHR mRNA levels in transgenic fish were unaffected by ration-restriction, whereas plasma GH was increased and plasma IGF-I and liver IGF-I mRNA were decreased to wild-type levels. These data reveal that strong nutritional modulation of IGF-I production remains even in the presence of constitutive ectopic GH expression in these transgenic fish. Liver GHR membrane protein levels were not different from controls, whereas, in muscle, GHR levels were elevated approximately 5-fold in transgenic fish. Paracrine stimulation of IGF-I by ectopic GH production in non-pituitary tissues is suggested by increased basal cartilage sulphation observed in the transgenic salmon. Levels of mRNA for growth hormone-releasing hormone (GHRH) and cholecystokinin (CCK) did not differ between groups. Despite its role in appetite stimulation, neuropeptide Y (NPY) mRNA was not found to be elevated in transgenic groups.
    Full-text · Article · Sep 2008 · General and Comparative Endocrinology
Show more