Article

Homology dependent gene silencing in plants. Ann Rev Plant Physiol Plant Mol Biol

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

Homology-dependent gene silencing phenomena in plants have received considerable attention, especially when it was discovered that the presence of homologous sequences not only affected the stability of transgene expression, but that the activity of endogenous genes could be altered after insertion of homologous transgenes into the genome. Homology-mediated inactivation most likely comprises at least two different molecular mechanisms that induce gene silencing at the transcriptional or posttranscriptional level, respectively. In this review we discuss different mechanistic models for plant-specific inactivation mechanisms and their relationship with repeat-specific silencing phenomena in other species.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... Various reports describing the inactivation of gene expression have shown that HdGS is the consequence of different control mechanisms acting either at the transcriptional or at the post-transcriptional level [23,35,42,43,47]. In contrast to PTGS, which is characterized by a reduction in steady-state mRNA levels without affecting the nuclear transcription, TGS is defined by the inactivation of (trans)gene-specific nuclear RNA synthesis. ...
... However, this methylation is located in the transcribed region of the silenced genes and its significance is still obscur. In contrast to this, there is a clear idea of the mode of RNA interactions in all the models [6,7,14,17,21,23,43,47,55,66,70] that have been proposed to explain the degradation mechanism of PTGS. To account for the observed de novo methylation, the ectopic pairing model is proceeding from the assumption that this DNA modification is the primary step in PTGS. ...
... This type of silencing presumably reflects the epigenetic state of neighboring host sequences or the relative tolerance of particular chromosome regions to invasion by alien DNA. A separate category of silencing resulting from interactions among multiple copies of transgenes and related endogenous genes involves homology-based mechanisms that act at either the transcriptional or post-transcriptional level (Meyer and Saedler, 1996). Transcriptional silencing is associated with meiotically heritable epigenetic modifications (often, but not always, cytosine methylation). ...
... Although not intended, it is not unusual that attempts to overexpress a transgene may trigger the suppression or reduction of the expression of the endogenous homologous gene along with the transgene (Meyer & Saedler, 1996;Wang et al., 2012). Homology-dependent gene silencing (HDGS) can occur due to multiple gene copies in a genome. ...
... A previous study has shown that transcriptional silencing was mediated by the 35S promoter homologous between transgenes and the T-DNAs (such as the SALK, FLAG, and GABI) used for insertional mutagenesis [3]. Transgene silencing phenomena may occur when there are multiple copies of a particular sequence in a genome and the silencing results from interactions between homologous sequences [50,51]. In our studies, transcriptional silencing was accompanied by hypermethylation in the AP3 promoter in transgenic Arabidiopsis plants, similar to reports that silencing often occurs when the genome existed in the transgene, which was homologous to endogenous sequences [50]. ...
Article
Full-text available
The development of floral organs plays a vital role in plant reproduction. In our research, the APETALA3 (AP3) promoter-transgenic lines showed abnormal developmental phenotypes in stamens and petals. The aim of this study is to understand the molecular mechanisms of the morphological defects in transgenic plants. By performing transgenic analysis, it was found that the AP3-promoted genes and the vector had no relation to the morphological defects. Then, we performed the expression analysis of the class A, B, and C genes. A dramatic reduction of transcript levels of class B genes (AP3 and PISTILLATA) was observed. Additionally, we also analyzed the methylation of the promoters of class B genes and found that the promoter of AP3 was hypermethylated. Furthermore, combining mutations in rdr2-2, drm1/2, and nrpd1b-11 with the AP3-silencing lines rescued the abnormal development of stamens and petals. The expression of AP3 was reactivated and the methylation level of AP3 promoter was also reduced in RdDM-defective AP3-silencing lines. Our results showed that the RdDM pathway contributed to the transcriptional silencing in the transgenic AP3-silencing lines. Moreover, the results revealed that fact that the exogenous fragment of a promoter could trigger the methylation of homologous endogenous sequences, which may be ubiquitous in transgenic plants.
... Nevertheless, currently, it is possible to introduce genes encoding entire metabolic pathway cascades into plants. For this, a number of different promoters are needed, since the introduction of repeating sequences can result in undesirable homology-dependent gene silencing (Meyer and Saedler 1996). Despite the intensive study of plant regulatory elements, strong tissue-specific promoters for specific applications are lacking. ...
Article
Full-text available
Main conclusion The tomato ELIP gene promoter is mainly active in the ripening fruit. Considering its high activity, the promoter could be used for molecular breeding of plants in the future. Abstract The ability to obtain new varieties of transgenic plants with economically valuable traits relies on a high level of target gene expression, which is largely controlled by a gene promoter. Hence, research aimed at finding and characterizing new tissue-specific promoters that direct gene expression in specific plant tissues or at certain developmental stages has become the most important field of plant biotechnology. Here, we cloned and characterized the promoter of the early light-inducible protein (ELIP) gene from tomato (Solanum lycopersicum cv. Yalf). ELIPs are produced in the presence of light and putatively function in the chloroplast-to-chromoplast conversion, playing a photorepairing role in the photosynthetic system. Analysis of the promoter sequence revealed multiple cis-acting elements related to light responsiveness, and other motifs involved in plant hormone response and circadian control. To determine the functionality of the promoter, seven 5′-deletion variants were fused with the β-glucuronidase (GUS) reporter gene and introduced into tomato. Histochemical analysis of transgenic tomato plants revealed different levels of GUS activity in most analyzed tissues, depending on the promoter fragment used. The intensity of staining was considerably higher in ripening fruits than in unripe and non-fruit tissues. Quantitative analysis indicated that the level of GUS activity with the longest (full-length) version of the ELIP promoter in ripened fruits was comparable to that in plants expressing the constitutive CaMV35S promoter. Further, the location of both negative and positive regulatory motifs was identified. The described ELIP promoter is a potential tool for various applications in plant biotechnology.
... Engineering of complex traits requires the expression of multiple stacked transgenes and the repetitive use of genetic parts (e.g. promoters and terminators) is not desirable due to potential problems of T-DNA stability/integrity and gene silencing in future generations (Meyer and Saedler, 1996). Furthermore, such complex traits may also require precise control and accurate regulation of transgene expression, e.g. at the level of individual cells and tissues, and at particular times during development. ...
Article
Full-text available
Plant synthetic biology and cereal engineering depends on the controlled expression of transgenes of interest. Most engineering in plant species to date has relied heavily on the use of a few, well‐established constitutive promoters to achieve high levels of expression; however, the levels of transgene expression can also be influenced by the use of codon optimisation, intron‐mediated enhancement and varying terminator sequences. Most of these alternative approaches for regulating transgene expression have only been tested in small‐scale experiments, typically testing a single gene of interest. It is therefore difficult to interpret the relative importance of these approaches and to design engineering strategies that are likely to succeed in different plant species, particularly if engineering multi‐genic traits where the expression of each transgene needs to be precisely regulated. Here we present data on the characterisation of 46 promoters and 10 terminators in Medicago truncatula, Lotus japonicus, Nicotiana benthamiana and Hordeum vulgare, as well as the effects of codon optimisation and intron‐mediated enhancement on the expression of two transgenes in H. vulgare. We have identified a core set of promoters and terminators of relevance to researchers engineering novel traits in plant roots. In addition, we have shown that combining codon optimisation and intron‐mediated enhancement increases transgene expression and protein levels in barley. Based on our study, we recommend a core set of promoters and terminators for broad use, and also propose a general set of principles and guidelines for those engineering cereal species. This article is protected by copyright. All rights reserved.
... Furthermore, double-stranded RNAs (miRNA, siRNA, shRNA etc), RISH and RITS protein complexes that dominate RNA interference mechanisms [16] [17] were not involved in the GDH-synthesized RNA machinery (Figure 4). Homology-dependent gene silencing has been described [52] but it focused on transgenes without explaining the chemical mechanism of silencing. The fact that total RNA degradation fragments formed RNA:DNA hybrids ( Figure 2) suggested that the degradation mechanism was neither depurination nor depyrimidination of total RNA. ...
... Prediction of transgene performance is complicated by the random insertion of transgenes into the plant genome and interaction among transgene copies with each other or the neighboring chromatin (Assaad et al. 1993;Ingelbrecht et al. 1994Ingelbrecht et al. , 1999Meyer and Saedler 1996;Angell and Baulcombe 1997;Cerutti et al. 1997;Kanno et al. 2000). To enhance the predictability of transgene performance we constructed and characterized a safe harbor transgene locus in sugarcane that is expected to support transgene stacking. ...
Article
Full-text available
Key message A selectable marker free, highly expressed single copy locus flanked by insulators was created as landing pad for transgene stacking in sugarcane. These events displayed superior transgene expression compared to single-copy transgenic lines lacking insulators. Excision of the selectable marker gene from transgenic sugarcane lines was supported by FLPe/FRT site-specific recombination. Abstract Sugarcane, a tropical C4 grass in the genus Saccharum (Poaceae), accounts for nearly 80% of sugar produced worldwide and is also an important feedstock for biofuel production. Generating transgenic sugarcane with predictable and stable transgene expression is critical for crop improvement. In this study, we generated a highly expressed single copy locus as landing pad for transgene stacking. Transgenic sugarcane lines with stable integration of a single copy nptII expression cassette flanked by insulators supported higher transgene expression along with reduced line to line variation when compared to single copy events without insulators by NPTII ELISA analysis. Subsequently, the nptII selectable marker gene was efficiently excised from the sugarcane genome by the FLPe/FRT site-specific recombination system to create selectable marker free plants. This study provides valuable resources for future gene stacking using site-specific recombination or genome editing tools.
... For mannitol treatment, the uidA expression in two lines (lines 18 and 37) was significantly upregulated. The uidA expression in lines 18 and 37 displayed fold increases of 4.43 ± 1.07 (P < 0.05) and 8.47 silencing [29]. Homology-dependent gene silencing can be the result of tran- scriptional gene silencing or post-transcriptional gene silencing. ...
... Several mechanisms lead to the interruption or inhibition of mrNA synthesis in plants, such as the presence of prokaryotic DNA sequences, typical of the plasmid backbone used in genetic transformation, DNA methylation, site-related "position effect" transgene integration into the plant genome, integration site structure, presence of multiple copies or "superfluous" copies of the transgene, sequences with potential for hairpin formation and double-stranded rNA, in addition to negative feedback from promoters -a common event when end products of gene expression are recombinant enzymes (Finnegan and Mcelroy 1994). Some strategies have already proved effective in eliminating or reducing such problems, such as the use of "clean" vectors of prokaryotic sequences, absent from obstacles to the coupling of rNA polymerase II and that may lead to the formation of double-stranded mrNA; techniques for integrating single copies of the transgene into the plant genome; the addition of flanking sequences of the scaffold attachment regions and site-directed integration; the choice of germplasm with low methylation activity; in addition to the reduction of negative feedback from promoters by the expression of the target enzyme in a different cell compartment from which its substrate is found (Meyer and Saedler 1996). ...
Article
Full-text available
The constant demand for new antibiotic drugs has driven efforts by the scientific community to prospect for peptides with a broad spectrum of action. In this context, antimicrobial peptides (AMPs) have acquired great scientific importance in recent years due to their ability to possess antimicrobial and immunomodulatory activity. In the last two decades, plants have attracted the interest of the scientific community and industry as regards their potential as biofactories of heterologous proteins. One of the most promising approaches is the use of viral vectors to maximize the transient expression of drugs in the leaves of the plant Nicotiana benthamiana. Recently, the MagnifectionTM expression system was launched. This sophisticated commercial platform allows the assembly of the viral particle in leaf cells and the systemic spread of heterologous protein biosynthesis in green tissues caused by Agrobacterium tumefaciens “gene delivery method”. The system also presents increased gene expression levels mediated by potent viral expression machinery. These characteristics allow the mass recovery of heterologous proteins in the leaves of N. benthamiana in 8 to 10 days. This system was highly efficient for the synthesis of different classes of pharmacological proteins and contains enormous potential for the rapid and abundant biosynthesis of AMPs.
... The use of many different promoters could prevent homology-dependent gene silencing that can result from repeated use of a constitutive promoter, after multiple generations (Matzke and Matzke 1995;Meyer and Saedler 1996;Matzke et al. 2002). In addition, this upfront design could test a range of promoter strengths without a priori knowledge of expression level predictions using phenotype as the selectable pressure in optimized design. ...
Article
Full-text available
In C3 plants, photorespiration is an energy‐expensive process, including the oxygenation of ribulose‐1,5‐bisphosphate (RuBP) by ribulose 1,5‐bisphosphate carboxylase/oxygenase (Rubisco) and the ensuing multi‐organellar photorespiratory pathway required to recycle the toxic byproducts and recapture a portion of the fixed carbon. Photorespiration significantly impacts crop productivity through reducing yields in C3 crops by as much as 50% under severe conditions. Thus, reducing the flux through, or improving the efficiency of photorespiration has the potential of large improvements in C3 crop productivity. Here, we review an array of approaches intended to engineer photorespiration in a range of plant systems with the goal of increasing crop productivity. Approaches include optimizing flux through the native photorespiratory pathway, installing non‐native alternative photorespiratory pathways, and lowering or even eliminating Rubisco‐catalyzed oxygenation of RuBP to reduce substrate entrance into the photorespiratory cycle. Some proposed designs have been successful at the proof of concept level. A plant systems‐engineering approach, based on new opportunities available from synthetic biology to implement in silico designs, holds promise for further progress toward delivering more productive crops to farmer's fields.
... Although not intended, it is not unusual that attempts to overexpress a transgene may trigger the suppression or reduction of the expression of the endogenous homologous gene along with the transgene (Meyer & Saedler, 1996;Wang et al., 2012). Homology-dependent gene silencing (HDGS) can occur due to multiple gene copies in a genome. ...
Article
Full-text available
Allelopathy involves the release of compounds into the environment that affects the growth and development of other organisms. This phenomenon may lead to the production of compounds less harmful to the environment than traditional herbicides used in weed control. In plants, terpenes have been identified as components of allelochemicals and are synthesized by enzymes named as geranylgeranyl diphosphate synthases (GGPPS). There are about 12 GGPPS genes in Arabidopsis, among which is GGR. This work aims to study the association between the expression levels of GGR and the allelopathic response of sesame seedlings to Arabidopsis leaf extracts. Hence, the GGR gene was inserted into Arabidopsis with the purpose to investigate the allelopathic effects of GGR expression levels on sesame seedlings. GGR expression levels were quantified by RT-PCR in both transgenic and non-transgenic [wild-type (WT)] lines. It has been observed that both wild-type and GGR expressing transgenic lines inhibited the growth of sesame seedlings. However, it is noteworthy that the phytotoxicity of extracts from GGR lines were greater than WT extracts. RT-PCR analysis of GGR expression revealed that WT plants had higher levels of GGR expression than GGR transgenic lines, which suggests that a homologous-dependent gene silencing (HDGS) occurred in GGR lines. GGR is part of an enzyme complex that works as a hub that determines the types of terpenes produced in Arabidopsis chloroplasts. The present data indicates that decreases in GGR expression may have favoured the production of terpenes with stronger allelopathic capacity in Arabidopsis leaves.
... The candidate gene was observed to be transcriptionally and translationally expressed in all the lines. Differential expression pattern of AhcAPX was evident at the level of enzyme activity in independent TR lines, which could be due to the position effect, or homology dependent gene silencing (HDGS) as reported earlier (Matzke and Matzke 1998;Meyer and Saedler 1996). The APX activity was higher in the TR lines than in the UC plants, both under non-stressed condition and stressed conditions. ...
Article
A stress inducible cytosolic ascorbate peroxidase gene (AhcAPX) was ectopically expressed in banana (cv. Grand naine) plants to strengthen their antioxidant capacity. High level of AhcAPX gene transcripts and enzyme suggested constitutive and functional expression of candidate gene in transgenic (TR) plants. The tolerance level of in vitro and in vivo grown TR banana plantlets were assessed against salt and drought stress. The TR banana plants conferred tolerance against the abiotic stresses by maintaining a high redox state of ascorbate and glutathione, which correlated with lower accumulation of H2O2, O 2⋅− and higher level of antioxidant enzyme (SOD, APX, CAT, GR, DHAR and MDHAR) activities. The efficacy of AhcAPX over-expression was also investigated in terms of different physiochemical attributes of TR and untransformed control plants, such as, proline content, membrane stability, electrolyte leakage and chlorophyll retention. The TR plants showed higher photochemical efficiency of PSII (Fv/Fm), and stomatal attributes under photosynthesis generated reactive oxygen species (ROS) stress. The outcome of present investigation suggest that ectopic expression of AhcAPX gene in banana enhances the tolerance to drought and salt stress by annulling the damage caused by ROS.
... Citrus genetic engineering is mainly based on gene constructs containing the promoter CaMV35S for driving both the selection/report and the interest genes (Domínguez et al. 2000;Azevedo et al. 2006a;Boscariol et al. 2006;Cardoso et al. 2010;Yang et al. 2011;Muniz et al. 2012). The public concern about the use of genes from non-crossable species (Lassen et al. 2002) and the risk of homology-based gene silencing because of genes expressed under the same promoter control (Meyer and Saedler 1996;Butaye et al. 2005) encourage activities for the isolation of genetic elements from the species of interest. ...
Article
Full-text available
Key message Regulatory sequences from the citrus constitutive genes cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) were isolated, fused to the uidA gene, and qualitatively and quantitatively evaluated in transgenic sweet orange plants. Abstract The 5′ upstream region of a gene (the promoter) is the most important component for the initiation and regulation of gene transcription of both native genes and transgenes in plants. The isolation and characterization of gene regulatory sequences are essential to the development of intragenic or cisgenic genetic manipulation strategies, which imply the use of genetic material from the same species or from closely related species. We describe herein the isolation and evaluation of the promoter sequence from three constitutively expressed citrus genes: cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1). The functionality of the promoters was confirmed by a histochemical GUS assay in leaves, stems, and roots of stably transformed citrus plants expressing the promoter-uidA construct. Lower uidA mRNA levels were detected when the transgene was under the control of citrus promoters as compared to the expression under the control of the CaMV35S promoter. The association of the uidA gene with the citrus-derived promoters resulted in mRNA levels of up to 60–41.8% of the value obtained with the construct containing CaMV35S driving the uidA gene. Moreover, a lower inter-individual variability in transgene expression was observed amongst the different transgenic lines, where gene constructs containing citrus-derived promoters were used. In silico analysis of the citrus-derived promoter sequences revealed that their activity may be controlled by several putative cis-regulatory elements. These citrus promoters will expand the availability of regulatory sequences for driving gene expression in citrus gene-modification programs.
... Although functional roles for LeTH1, LeTH2, and LeTH3 in tomato are unknown, our silenced transgenic lines showed similar levels of virus resistance. It has been observed that cDNAs with higher than 70% identity are capable of silencing a target gene [27]. Recently, it was reported that silencing the pepper (Capsicum annuum) genes CaTOM1 and CaTOM3, homologs of TOM1 and TOM3, respectively, efficiently inhibited TMV infection [12]. ...
Article
Full-text available
The TOM1/TOM3 genes from Arabidopsis are involved in the replication of tobamoviruses. Tomato homologs of these genes, LeTH1, LeTH2 and LeTH3, are known. In this study, we examined transgenic tomato lines where inverted repeats of either LeTH1, LeTH2 or LeTH3 were introduced by Agrobacterium. Endogenous mRNA expression for each gene was detected in non-transgenic control plants, whereas a very low level of each of the three genes was found in the corresponding line. Small interfering RNA was detected in the transgenic lines. Each silenced line showed similar levels of tobamovirus resistance, indicating that each gene is similarly involved in virus replication.
... To avoid risks of homology-dependent gene silencing (HDGS) (Meyer & Saedler 1996), in this research EgP450 was chosen to transfer into P. mirifica, which directly cultivated in the flowerpots. The contents of isoflavonoids such as daidzein and genistein in transgenic P. mirifica, were higher than the control plants. ...
Article
Isoflavonoids are the main compound in White Kwao Krua (Pueraria mirifica), which is an effective folk medicinal plant endemic to Thailand. It has been widely used for improving human physical and treating diseases. There are substances with estrogenic activities have been isolated from P. mirifica, such as puerarin, daidzein and genistein. Isoflavone synthase (IFS) is one of the key enzymes in Leguminous plants to convert liquiritigenin, liquiritigenin C-glucoside and naringenin chalcone to isoflavonoids. The aim of this research was to enhance the production of isoflavonoids by metabolic engineering. Transgenic plants were constructed by introducing P450 gene (EgP450) which is similar to IFS from oil palm (Elaeis guineensis), into P. mirifica by a biolistic method. After the transgenic plants had proved successfully, isoflavonoids of each group plants were determined by HPLC. The contents of daidzein and genistein in transgenic plants were higher than the control plants.
... Previous studies reported HBGS occurring extensively in transgenic plants (Vaucheret and Fagard 2001). Several mechanisms were suggested to explain the phenomena of HBGS, and all of them propose sequence homology in the promoter as a trigger for cellular recognition mechanisms resulting in silencing of the affected transgenes (Matzke and Matzke 1995;Meyer and Saedler 1996;Fire 1999;Hamilton and Baulcombe 1999;Steimer et al. 2000). ...
Article
Full-text available
The expression profile of a natural bi-directional promoter, derived from the Brassica napus EPSPS-A gene, was studied in transgenic soybean (Glycine max C.V. Maverick) lines. Two constructs, pDAB100331 and pDAB100333, were assembled to test the bi-directionality of the promoter. Two reporter genes, gfp and gusA, were employed and they were interchangeably placed in both constructs, one on each end of the promoter such that both proteins expressed divergently in each construct. In the T0 generation, GUS expression was more uniform throughout the leaf of pDAB100333 transgenic plants, where the gusA gene was expressed from the downstream or EPSPS-A end of the bi-directional promoter. Comparatively, GUS expression was more localized in the midrib and veins of the leaf of pDAB100331 transgenic plants, where the gusA gene was expressed from the upstream end of the bi-directional promoter. These observations indicated a unique expression pattern from each end of the promoter and consistently higher expression in genes expressed from the downstream end (e.g., EPSPS-A end) of the promoter in the tissues examined. The GFP expression pattern followed that of GUS when placed in the same position relative to the promoter. In the T1 generation, transcript analysis also showed higher expression of both gusA and gfp when those genes were located at the downstream end of the promoter. Accordingly, the pDAB100331 events exhibited a higher gfp/gusA transcript ratio, while pDAB100333 events produced a higher gusA/gfp transcript ratio consistent with the observations in T0 plants. These results demonstrated that the EPSPS-A gene bidirectional promoter can be effectively utilized to drive expression of two transgenes for the desired traits.
... These reports and the current study support the conclusion that transgene silencing is not correlated to any specific promoter or transformation method used. The high frequency of gene silencing might occur via homology-dependent silencing [50], tandem insertions, or genomic DNA could be interspersed between transgenic sequences [51][52][53]. Another explanation is the occurrence of promoter methylation, where expression level can be largely linked to the degree of promoter methylation [43,47]. ...
Article
Full-text available
Background The main aim of this study was to improve fungal resistance in bread wheat via transgenesis. Transgenic wheat plants harboring barley chitinase (chi26) gene, driven by maize ubi promoter, were obtained using biolistic bombardment, whereas the herbicide resistance gene, bar, driven by the CaMV 35S promoter was used as a selectable marker. Results Molecular analysis confirmed the integration, copy number, and the level of expression of the chi26 gene in four independent transgenic events. Chitinase enzyme activity was detected using a standard enzymatic assay. The expression levels of chi26 gene in the different transgenic lines, compared to their respective controls, were determined using qRT-PCR. The transgene was silenced in some transgenic families across generations. Gene silencing in the present study seemed to be random and irreversible. The homozygous transgenic plants of T4, T5, T6, T8, and T9 generations were tested in the field for five growing seasons to evaluate their resistance against rusts and powdery mildew. The results indicated high chitinase activity at T0 and high transgene expression levels in few transgenic families. This resulted in high resistance against wheat rusts and powdery mildew under field conditions. It was indicated by proximate and chemical analyses that one of the transgenic families and the non-transgenic line were substantially equivalent. Conclusion Transgenic wheat with barley chi26 was found to be resistant even after five generations under artificial fungal infection conditions. One transgenic line was proved to be substantially equivalent as compared to the non-transgenic control. Electronic supplementary material The online version of this article (doi:10.1186/s13007-017-0191-5) contains supplementary material, which is available to authorized users.
... Multiple genes could also be expressed in the form of multiple expression cassettes linked together, each cassette with its own promoter and terminator (Slater et al., 1999;Belmont, 2016). However multiple copies of the same promoter used for transgenes of interest can lead to gene silencing (Meyer and Saedler, 1996). Co-transformation is another method for multiple gene expression that involves the simultaneous transformation of plants with the transgenes of interest (Zhang and Fauquet, 1998;Ninh et al., 2015). ...
Article
Full-text available
In order to express multisubunit proteins, or to manipulate metabolic pathways in plants it is essential to be able to efficiently express multiple proteins within the same plant cell. To increase the efficiency of multi-protein expression, we demonstrate the use of the Golgi localized Kex2 protease activity in tobacco to process a large polyprotein precursor consisting of four individual protein domains into its individual protein constituents. Four genes encoding enzymes involved in the biosynthesis of S. pneumoniae type 2 polysaccharide were assembled into a single expression cassette as a large polyprotein driven by a single cauliflower mosaic virus (CaMV) 35S promoter. Each of the individual protein domains were separated by three sequential Kex2 protease digestion sites. At the N-terminus a Pr1b signal peptide was incorporated for efficient targeting of the polyprotein to the apoplast. Each individual protein domain was tagged with its own immuno-tag. The construct was used for the transformation of Nicotiana tabacum and stable lines were selected. All four processed proteins could be immunologically detected in protein extracts using Western blotting indicating correct expression and Kex2 processing. Utilisation of the Kex2 protease system represents an efficient way of expressing multiple proteins in the same plant. This method simplifies the transformation procedures, and presents a method for expression of multiple proteins within the same plant.
... In some eukaryotic systems like the budding yeast (S. cerevisiae), the repeated use of the same promoter modules is problematic due to homologous recombination events that decrease the stability of the artificially introduced expression cassettes ( Gibson et al., 2008). In plant systems, the introduction of multiple promoters or transgenes bearing homology to host cis-regulatory modules leads to homology based gene silencing (HBGS) at the transcriptional or post-transcriptional level (Meyer and Saedler, 1996). Native promoter modules also use the natural TF population in the cell, which increases the probability of inducing off-target genes, whose promoters contain the binding sites for the same TF (Siegl et al., 2013). ...
Article
The modular nature of the transcriptional unit makes it possible to design robust modules with predictable input-output characteristics using a ‘parts- off a shelf’ approach. Customized regulatory circuits composed of multiple such transcriptional units have immense scope for application in diverse fields of basic and applied research. Synthetic transcriptional engineering seeks to construct such genetic cascades. Here, we discuss the three principle strands of transcriptional engineering: promoter and transcriptional factor engineering, and programming inducibilty into synthetic modules. In this context, we review the scope and limitations of some recent technologies that seek to achieve these ends. Our discussion emphasizes a requirement for rational combinatorial engineering principles and the promise this approach holds for the future development of this field.
... The multiple copies integration was expected to induce gene silencing so that the transgene was not expressed and plants became susceptible and virus could not develop in the plant tissue. Gene silencing caused by the presence of the multiple copy of the transgene possibly related to the phenomenon of homology-dependent gene silencing in which no expression of one or more genes because of the arrangement of nucleotide similarity (homology) (Meyer and Saedler, 1996). Interestingly, this phenomenon may not occur in transgenic plant No. 46 where the plant had four copies of genes but showed no revealling any symptoms of the virus in plant tissues. ...
Article
Full-text available
p>Genetic transformation of tobacco plant using AV1 gene was conducted at the previously experiment and generated transgenic tobacco plants positively carrying the selectable marker nptII gene. The objectives of this experiment were to (1) analyze the presence of Begomovirus AV1 gene in T0 generation putative transgenic tobacco plants using PCR technique with specific primers and its correlation with resistance phenotype, (2) analyze the integration and copy number of the transgene in T0 generation putative transgenic tobacco plants and its correlation with resistance response, (3) screen the T0 generation putative transgenic tobacco plants with the target virus infection and to detect the presence of the virus in the transgenic plant tissue using universal primers. PCR detection of AV1 gene in tobacco transgenic was conducted by using specific primer for Begomovirus AV1 gene. Meanwhile, Southern Blot analysis was conducted by using the AV1 gene probe. The effectiveness of AV1 gene in tobacco transgenic was tested by inoculation of target virus using whiteflies vector. Result of the experiments showed that there was a positive correlation between the presence of the AV1 transgene in T0 generation putative transgenic tobacco plants and the resistant phenotype. Transgenic plants with a single copy integration of the transgene exhibited more resistant than the multiple copy one. and non transgenic plant. The resistance as a result of AV1 gene expression was indicated with no symptom in T0 generation transgenic tobacco plants and the accumulation of the virus in the transgenic plants tissue. Northern and Western hybridization analysis need to be perfomed for investigating the presence of mRNA or protein accumulation so that the resistance mechanism of the AV1 gene could be explained more detail.</p
... This type of silencing presumably reflects the epigenetic state of neighboring host sequences or the relative tolerance of particular chromosome regions to invasion by alien DNA. A separate category of silencing resulting from interactions among multiple copies of transgenes and related endogenous genes involves homology-based mechanisms that act at either the transcriptional or post-transcriptional level (Meyer and Saedler, 1996). Transcriptional silencing is associated with meiotically heritable epigenetic modifications (often, but not always, cytosine methylation). ...
Article
Full-text available
Interleukin-11 (IL-11) is a cytokine that plays a key regulatory role in the immune system. Recombinant human IL-11 (rhIL-11) exerts a preventative effect against apoptotic cell death and inhibits preadipocyte differentiation. IL-11 also is used to stimulate the bone marrow to produce platelets in order to prevent low platelets that may be caused by chemotherapy. Unfortunately, the high production cost of IL-11 associated. In this study, we investigated the feasibility of transgenic plants for the cost-effective production of rhIL-11. Production of rhIL-11 proteins in whole-plant expression system will be more economical when compared to the current E. coli based expression system. The human rhIL-11 gene was codon optimized to maximize plant host system expression. IL-11 expression vector under the control of a constitutive cauliflower mosaic virus 35S (CaMV 35S) promoter was introduced into tobacco by Agrobacteriummediated transformation. The 5′-leader sequence (called O) of tobacco mosaic virus (TMV) as a translational enhancer was added to construct. Transgenic tobacco plants expressing various levels of rhIL-11 protein were generated. Western blotting of the stably transformed lines demonstrated accumulation of the appropriately sized rhIL-11 protein in leaves. This research demonstrated the efficacy of using tobacco as an expression system for the production of rhIL-11.
... The high levels of transgene expression at all times cause an unnecessary loss of plant energy and increase the possibility of target gene silencing (Elmayan and Vaucheret, 1996;Breitler et al., 2004;Xia et al., 2010;Taha et al., 2012). In addition, strong constitutive promoters have limited value for developing multi-trait transgenic plants (Meyer and Saedler, 1996;Venter, 2007;Liu et al., 2014). These obstacles can be overcome by the use of tissue-or developmental stage-specific or inducible promoters to drive gene expression conditionally. ...
Article
Full-text available
We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.
... Wie sich auch im Nachhinein durch eine genaue Analyse des oben genannten Versuches ergab, unterschieden sich die transgenen Petunien in ihrem Methylierungsmuster im Promotorbereich. Dieser Unterschied führte zu einer veränderten Genexpression, bis hin zur kompletten Genstilllegung [2][3][4]. ...
Article
DNA‐Methylierung ist eine evolutionär hoch konservierte epigenetische Modifikation. Sie ist wichtig für die genomische Stabilität und kann einen Einfluss auf die Transkriptionsaktivität von Genen haben. In Tieren findet man Cytosinmethylierung im symmetrischen CG‐Sequenzkontext, in Pflanzen kann jedes Cytosin potenziell methyliert werden. Die Methylierung im symmetrischen Kontext ist vererbbar, im asymmetrischen Sequenzkontext muss sie jedes Mal neu „geschrieben“ werden. Der Mechanismus hierfür wird als RNA‐dirigierte DNA‐Methylierung bezeichnet. In Pflanzen erfolgt eine Demethylierung unter Zuhilfenahme des DNA‐Reparaturmechanismus. Eine Änderung im Methylierungsmuster kann zu phänotypischen Veränderungen führen. Man spricht hier von Epimutationen. Als Epigenetik wird der Einfluss von stabil vererbbaren Methylierungszuständen ohne DNA‐Sequenzänderung bezeichnet. Die Änderung der Methylierung ist einerseits vererbbar, andererseits jedoch reversibel. Somit besitzt der Organismus mit diesem „5. Element“ die Möglichkeit, eine Mutation sozusagen auszuprobieren oder abgeschwächte Formen einer veränderten Genexpression zu testen. DNA methylation is an evolutonary highly conserved epigenetic modification. It is important for genome stability and can affect the transcriptional activity of genes. In animals, methylation of cytosines is found in the symmetric CG context, while in plants every cytosine can be methylated. Methylation in a symmetric sequence context is heritable. In the asymmetric context is has to be rewritten new in every generation. This plants specific mechanism is called RNA directed DNA Methylation. The removal of methylated cytosines occurs in plants via the DNA repair mechanism. The change in the methylation pattern can lead to a change in the phenotype. This is refered to as epimutations. Epigenetics is dealing with the heritable effect of stable methylation patters without a change in the nucleotide sequence of the DNA. The methylation is a modification which is on the one hand heritable, one the other still reversible. With this “fifth element” the organism has the opportunity to “test” a mutation or to modulate gene expression. Die Methylierung der Nukleinbase Cytosin ist eine wichtige epigenetische Modifikation mit potenziellem Einfluss auf die Genexpression. Bei der Petunie entstehen auf diese Weise etwa unterschiedlich gefärbte, aber genetisch identische Blütenblätter. DNA‐Methylierungen sind einerseits vererbbar, andererseits aber auch reversibel und ermöglichen der Pflanze dadurch ein ”Ausprobieren” von neuen Phänotypen.
... Theoretically, a higher transgene copy number is related with a higher transgene expression level. However, multiple copy transgene often seem to be associated with low-level expression, which seems to result from the interactions between homologous sequences, and it was therefore termed as homology-6 dependent gene silencing (HDGS) (Meyer and Saedler, 1996). The HDGS may explain why a transgenic line with a higher copy number of FaMBL1 showed a lower expression in this study. ...
Article
Full-text available
White strawberry fruits (Fragaria ×ananassa) are more resistant to anthracnose disease caused by Colletotrichum spp. compared with red fruits. In white fruit infected with C. acutatum, a mannose binding lectin gene named FaMBL1 was found to be the most upregulated gene. In order to discern its role in strawberry resistance to C. acutatum, FaMBL1 silencing and overexpressing strawberry plants were generated through Agrobacterium tumefaciens transformation technique. Transformed strawberry lines were screened by selective media and specific amplicons via PCR. Copy number of target genes in the selected lines was determined by droplet digital PCR. Four overexpressing and three silencing lines, albeit with various copy number, were obtained. RT-PCR assay was conducted on different overexpressing lines, using RNA extracted from young leaves. The relative expressions of FaMBL1, some hormone- related-defence genes (FaAOS1, FaPAD4, FaEDS1, FaNCED1, FaZEP) and other defence- related genes (FaGSL5, FaPR1.2, FaWRKY1, FaPAL1) were quantified. The expression level of FaMBL1 gene in overexpression lines was significantly higher than wild type, while the difference for the defence-related genes was not that obvious. Interestingly, copy number of lectin transgene did not correlate with the level of expression of lectin gene in overexpressing lines.
... There are many other factors that lead to gene silencing. For instance, homology-dependent gene silencing (Meyer and Saedler, 1996), tandem insertion, or the transgene sequences could be separated by endogenous genomic DNA (Kohli et al., 1998;Solomon and Puchta, 1998;Jackson et al., 2001). In addition, gene silencing could also occur due to promoter methylation whereby the degree of methylation influenced the level of gene expression (Anand et al., 2003;Howarth et al., 2005). ...
Article
Basal stem rot (BSR) caused by Ganoderma boninense, a white-rot fungus is the most devastating disease in oil palm. In addition to the available methods that have been used to control this disease, genetic engineering was explored to produce fungal resistant transgenic oil palm. In this study, oil palm embryogenic calli were co-bombarded with a construct carrying the AGLU1 and RCH10 genes and a construct carrying the Basta® resistance gene (bar). After selection with the herbicide Basta®, 25 plants from seven events were regenerated, transferred onto soil and grown in the fully contained biosafety screen house. Polymerase chain reaction (PCR) analysis for the plants demonstrated that only eight plants were positive for the presence of three transgenes, the bar, AGLU1, and RCH10 genes. The quantitative reverse transcription PCR (RT-qPCR) demonstrated the expression of both AGLU1 and RCH10 genes in five out of eight plants tested. The infection of these plants with the G. boninense fungus resulted in only two plants exhibited resistance to the fungus. The results from this study demonstrated that fungal resistant oil palm could be produced via biolistic using alfalfa β-1,3-glucanase (AGLU1) and rice chitinase (RCH10) genes.
... The intricate and meticulous designing of the transgene constructs and intense dissection of transformants at the molecular level are the prerequisites of an efficient technique to avoid transgene silencing (Dewilde et al., 2000). Two dominant classes of transgene silencing, the first one results in position effects (Matzke et al., 2000) and the second one is silencing phenomena or homology-oriented gene silencing, HDGS (Meyer and Saedler, 1996). Some examples reported in plants are tobacco, transgenic tobacco (N. ...
Article
Full-text available
Epigenomics has become a significant research interest at a time when rapid environmental changes are occurring. Epigenetic mechanisms mainly result from systems like DNA methylation, histone modification, and RNA interference. Epigenetic mechanisms are gaining importance in classical genetics, developmental biology, molecular biology, cancer biology, epidemiology, and evolution. Epigenetic mechanisms play important role in the action and interaction of plant genes during development, and also have an impact on classical plant breeding programs, inclusive of novel variation, single plant heritability, hybrid vigor, plant-environment interactions, stress tolerance, and performance stability. The epigenetics and epigenomics may be significant for crop adaptability and pliability to ambient alterations, directing to the creation of stout climate-resilient elegant crop cultivars. In this review, we have summarized recent progress made in understanding the epigenetic mechanisms in plant responses to biotic and abiotic stresses and have also tried to provide the ways for the efficient utilization of epigenomic mechanisms in developing climate-resilient crop cultivars, especially in chickpea, and other legume crops.
... The discovery of RNA-induced gene silencing provided a feasible alternate gene analysis technique by simultaneously knockdown the expression of multiple related gene copies. RNAi or RNA-silencing was discovered in Caenorhabditis elegans and plants during the late '90s as a post-transcriptional gene silencing (PTGS) mechanism that targets specific messenger RNA (mRNA) sequences and downregulates protein expression [29, [82][83][84]. RNA interference involves four main stages (1) double-stranded RNA cleavage by the dicer, (2) silencing complex (RISC) development, (3) silencing complex activation, and (4) mRNA degradation. ...
Preprint
Full-text available
Wheat gluten contains epitopes that trigger celiac disease (CD). A life-long strict gluten-free diet is the only accepted treatment for CD. However, very low-gluten wheat may provide an alternative treatment to CD. Conventional plant breeding methods have not been sufficient to produce celiac-safe wheat. RNA interference technology, to some extent, succeeded in the development of safer wheat varieties. However, these varieties had multiple challenges in their implementation. Clustered Regularly Interspaced Short Palindromic Repeats-associated nuclease 9 (CRISPR/Cas9) is a versatile gene-editing tool that has the ability to edit the immunogenic gluten genes. So far, only a few studies have applied CRISPR/Cas9 to modify the wheat genome. In this article, we reviewed published literature that applied CRISPR/Cas9 in wheat genome editing to investigate the current status of the CRISPR/Cas9 system to produce a low-immunogenic wheat variety. We found that in recent years, the CRISPR/Cas9 system has been continuously improved to edit the complex hexaploid wheat genome. Although some reduced immunogenic wheat varieties have been reported, CRISPR/Cas9 has still not been fully explored in editing the wheat genome. We conclude that further studies are required to apply the CRISPR/Cas9 gene-editing system efficiently for the development of celiac-safe wheat variety and to establish it as a “tool to celiac safe wheat.”
... Another possible explanation might reside in epigenetic silencing mechanisms due to the elevated number of Dx5 promoter in ATI transgenic lines. A silencing mechanism, known as homology-dependent gene silencing (HDGS), can arise when multiple copies of the same or homologous sequences are introduced in a genome [21,22]. Jauvion at al. [23] distinguished two types of HDGS, based on the stage at which it occurs: the first is the transcriptional gene silencing (TGS) that is associated to transcription and promoter modification; the second one is the posttranscriptional gene silencing (PTGS), which occurs after the formation of mRNA. ...
Preprint
Full-text available
Although wheat is used worldwide as a staple food, it can give rise to adverse reactions, for which the triggering factors have not been identified yet. These reactions can be caused mainly by kernel proteins, both gluten and non-gluten proteins. Among these latter, -amylase/trypsin inhibitors (ATI) are involved in baker’s asthma and realistically in Non Celiac Wheat Sensitivity (NCWS). In this paper, we report characterization of three transgenic lines obtained from the bread wheat cultivar Bobwhite silenced by RNAi in three ATI genes CM3, CM16 and 0.28. We have obtained transgenic lines showing an effective decrease of the activity of target genes that, although showing a higher trypsin inhibition as a pleiotropic effect, generate a lower reaction when tested with sera of patients allergic to wheat, accounting for the important role of the three target proteins in wheat allergies. Finally, these lines show unintended changes differences in high molecular weight glutenin subunits (HMW-GS) accumulation, involved in technological performances, but do not show differences in terms of yield. The development of new genotypes accumulating a lower amount of proteins potentially or effectively involved in such pathologies, not only offers the possibility to use them as a basis for the production of varieties with a lower impact on adverse reaction, but also to test if these proteins are actually implicated in those pathologies for which the triggering factor has not been established yet.
... The availability of promoters and gene regulatory sequences derived from citrus is particularly important in the generation of intragenic or cisgenic plants, which use genetic material derived from the same species or from closely related ones. In addition, the availability of different constitutive promoters is important to avoid the risk of homology-dependent gene silencing caused by the use of the same constitutive promoters to express multiple transgenes [100]; Erpen et al. [101] identified the regulatory sequences from the cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) citrus constitutive genes, which exhibited constitutive gene expression in the vegetative tissues of transgenic Hamlin orange. ...
Article
Full-text available
Citrus is one of the most important fruit crops in the world. This review will discuss the recent findings related to citrus transformation and regeneration protocols of juvenile and adult explants. Despite the many advances that have been made in the last years (including the use of inducible promoters and site-specific recombination systems), transformation efficiency, and regeneration potential still represent a bottleneck in the application of the new breeding techniques in commercial citrus varieties. The influence of genotype, explant type, and other factors affecting the regeneration and transformation of the most used citrus varieties will be described, as well as some examples of how these processes can be applied to improve fruit quality and resistance to various pathogens and pests, including the potential of using genome editing in citrus. The availability of efficient regeneration and transformation protocols, together with the availability of the source of resistance, is made even more important in light of the fast diffusion of emerging diseases, such as Huanglongbing (HLB), which is seriously challenging citriculture worldwide.
... Another possible explanation might reside in epigenetic silencing mechanisms due to the elevated number of Dx5 promoters in ATI transgenic lines. A silencing mechanism, known as homology-dependent gene silencing (HDGS), can arise when multiple copies of the same or homologous sequences are introduced in a genome [21,22]. Jauvion et al. [23] distinguished two types of HDGS, based on the stage at which it occurs: the first is the transcriptional gene silencing (TGS) that is associated with transcription and promoter modification; the second one is the post-transcriptional gene silencing (PTGS), which occurs after the formation of mRNA. ...
Article
Full-text available
Although wheat is used worldwide as a staple food, it can give rise to adverse reactions, for which the triggering factors have not been identified yet. These reactions can be caused mainly by kernel proteins, both gluten and non-gluten proteins. Among these latter proteins, α-amylase/trypsin inhibitors (ATI) are involved in baker’s asthma and realistically in Non Celiac Wheat Sensitivity (NCWS). In this paper, we report characterization of three transgenic lines obtained from the bread wheat cultivar Bobwhite silenced by RNAi in the three ATI genes CM3, CM16 and 0.28. We have obtained transgenic lines showing an effective decrease in the activity of target genes that, although showing a higher trypsin inhibition as a pleiotropic effect, generate a lower reaction when tested with sera of patients allergic to wheat, accounting for the important role of the three target proteins in wheat allergies. Finally, these lines show unintended differences in high molecular weight glutenin subunits (HMW-GS) accumulation, involved in technological performances, but do not show differences in terms of yield. The development of new genotypes accumulating a lower amount of proteins potentially or effectively involved in allergies to wheat and NCWS, not only offers the possibility to use them as a basis for the production of varieties with a lower impact on adverse reaction, but also to test if these proteins are actually implicated in those pathologies for which the triggering factor has not been established yet.
... Another possible explanation might reside in epigenetic silencing mechanisms due to the elevated number of Dx5 promoters in ATI transgenic lines. A silencing mechanism, known as homology-dependent gene silencing (HDGS), can arise when multiple copies of the same or homologous sequences are introduced in a genome [21,22]. Jauvion et al. [23] distinguished two types of HDGS, based on the stage at which it occurs: the first is the transcriptional gene silencing (TGS) that is associated with transcription and promoter modification; the second one is the post-transcriptional gene silencing (PTGS), which occurs after the formation of mRNA. ...
Article
Full-text available
Although wheat is used worldwide as a staple food, it can give rise to adverse reactions, for which the triggering factors have not been identified yet. These reactions can be caused mainly by kernel proteins, both gluten and non-gluten proteins. Among these latter proteins, �-amylase/trypsin inhibitors (ATI) are involved in baker’s asthma and realistically in Non Celiac Wheat Sensitivity (NCWS). In this paper, we report characterization of three transgenic lines obtained from the bread wheat cultivar Bobwhite silenced by RNAi in the three ATI genes CM3, CM16 and 0.28. We have obtained transgenic lines showing an e�ective decrease in the activity of target genes that, although showing a higher trypsin inhibition as a pleiotropic e�ect, generate a lower reaction when tested with sera of patients allergic to wheat, accounting for the important role of the three target proteins in wheat allergies. Finally, these lines show unintended di�erences in high molecular weight glutenin subunits (HMW-GS) accumulation, involved in technological performances, but do not show di�erences in terms of yield. The development of new genotypes accumulating a lower amount of proteins potentially or e�ectively involved in allergies to wheat and NCWS, not only o�ers the possibility to use them as a basis for the production of varieties with a lower impact on adverse reaction, but also to test if these proteins are actually implicated in those pathologies for which the triggering factor has not been established yet.
... The discovery of RNA-induced gene silencing provided a feasible alternate gene analysis technique through the simultaneous knockdown of the expression of multiple related gene copies. RNAi or RNA-silencing was discovered in Caenorhabditis elegans and plants during the late1990s as a post-transcriptional gene silencing (PTGS) mechanism that is able to target specific messenger RNA (mRNA) sequences and to downregulates protein expression [29,[81][82][83]. RNA interference involves four main stages: (1) doublestranded RNA cleavage by the Dicer, (2) silencing complex (RISC) development, (3) silencing complex activation, and (4) mRNA degradation. ...
Article
Full-text available
Wheat gluten contains epitopes that trigger celiac disease (CD). A life-long strict gluten-free diet is the only treatment accepted for CD. However, very low-gluten wheat may provide an alternative treatment to CD. Conventional plant breeding methods have not been to produce celiac-safe wheat. RNA interference technology, to some extent, has succeeded in the development of safer wheat varieties. However, these varieties have multiple challenges in terms of their implementation. Clustered Regularly Interspaced Short Palindromic Repeats-associated nuclease 9 (CRISPR/Cas9) is a versatile gene-editing tool that has the ability to edit immunogenic gluten genes. So far, only a few studies have applied CRISPR/Cas9 to modify the wheat genome. In this article, we reviewed the published literature that applied CRISPR/Cas9 in wheat genome editing to investigate the current status of the CRISPR/Cas9 system to produce a low-immunogenic wheat variety. We found that in recent years, the CRISPR/Cas9 system has been continuously improved to edit the complex hexaploid wheat genome. Although some reduced immunogenic wheat varieties have been reported, CRISPR/Cas9 has still not been fully explored in terms of editing the wheat genome. We conclude that further studies are required to apply the CRISPR/Cas9 gene-editing system efficiently for the development of a celiac-safe wheat variety and to establish it as a “tool to celiac safe wheat.”
... In study of epigenetics, there are two main classes of transgene silencing in which first position effects related to expression of a foreign gene that is negatively regulated by flanking host DNA (Matzke et al., 2000). And the second main type of transgene silencing phenomena is related to epigenetic regulation and inactivation mechanism that can uptake multiple copies of same or homologous sequence inserted in a genome and it is also known as homology dependent gene silencing (Meyer and Saedler, 1996). ...
Article
Full-text available
: The introduction of transgenes in genetically modified plants can be silenced and also cause the silencing of endogenous plant genes. In this mechanism, silencing can occur transcriptional level and post transcriptional level but in case of silencing the endogenous genes seems predominantly post�transcriptionally. A major factor of this research to dissect the process of these sequence homology dependent gene silencing phenomena and different factors plays a role such as DNA methylation, transgene copy number as well as gene expression factors and possible modification of RNAs. Undesired transgene silencing is one of major concern in transgene technology used in crop improvements and this review gives the relationship between these factors and the bridge between transcriptional and post transcriptional gene silencing and discuss various observation correlated with silencing of gene.
... We detected only GFP but not ZmBBM-ZmWUS in T2 generation seeds, effectively mitigating the impact of ZmBBM-ZmWUS. High-copy-number transgenes are associated with functional and structural instability [44,45]. Based on the T2 generation seeds of transgenic Zheng58, the progeny segregation ratio was low. ...
Article
Full-text available
Maize is an important grain crop with high nutritional value. An effective transformation system is crucial for the genetic improvement of maize traits, but many important maize inbred lines remained recalcitrant to transformation. In this study, we developed a bivector transformation system that worked well in two recalcitrant maize inbred lines. This system included an induction vector (ZmBBM-ZmWUS) and an indicator vector (GFP), using microprojectile bombardment technology combined with Agrobacterium-mediated transformation. We found that the Zheng58 and Mo17 recalcitrant inbred lines could be transformed with this system. The whole transformation cycle lasted only 52 days, 38 days less than the traditional transformation cycle. Additionally, it was possible to eliminate inference of the induction vector and obtained progenies with only the target gene. Our results suggested that the bivector system was an optimization of the current maize transformation methods and could potentially be used in genetic improvement of maize inbred lines.
... Secondly, stable gene expression of all six genes of the pathway can be achieved by introducing all transgenes into the same T-DNA and selecting the transgenic event where gene expression is optimal. This would require using six different promoters with the same expression pattern to reduce homologydependent gene silencing (Meyer et al. 1996). An alternative to using different promoters is the use of the self-procession polypeptide using the 2A oligonucleotide linking coding sequences of the transgenes under the control of one single promoter (de Felipe et al. 2006). ...
Article
Full-text available
In traditional, small-scale agriculture in the Andes, potatoes are frequently co-cultivated with the Andean edible tuber Tropaeolum tuberosum, commonly known as mashua, which is believed to exert a pest and disease protective role due to its content of the phenylalanine-derived benzylglucosinolate (BGLS). We bioengineered the production of BGLS in potato by consecutive generation of stable transgenic events with two polycistronic constructs encoding for expression of six BGLS biosynthetic genes from Arabidopsis thaliana. First, we integrated a polycistronic construct coding for the last three genes of the pathway (SUR1, UGT74B1 and SOT16) into potato driven by the cauliflower mosaic virus 35S promoter. After identifying the single-insertion transgenic event with the highest transgene expression, we stacked a second polycistronic construct coding for the first three genes in the pathway (CYP79A2, CYP83B1 and GGP1) driven by the leaf-specific promoter of the rubisco small subunit from chrysanthemum. We obtained transgenic events producing as high as 5.18 pmol BGLS/mg fresh weight compared to the non-transgenic potato plant producing undetectable levels of BGLS. Preliminary bioassays suggest a possible activity against Phytophthora infestans, causing the late blight disease and Premnotrypes suturicallus, referred to as the Andean potato weevil. However, we observed altered leaf morphology, abnormally thick and curlier leaves, reduced growth and tuber production in five out of ten selected transgenic events, which indicates that the expression of BGLS biosynthetic genes has an undesirable impact on the potato. Optimization of the expression of the BGLS biosynthetic pathway in potato is required to avoid alterations of plant development. Graphical abstract
Chapter
Cassava is the primary staple crop for over 500 million people, primarily living in the tropical regions of the world. Among crops directly eaten by humans, cassava ranks fifth in consumption. Cassava is a shrubby, perennial, root crop native to Brazil. Under ideal conditions, cassava is capable of producing up to 90 ton roots per hectare containing 20–30% starch by fresh weight. Cassava has one of the highest photosynthetic rates for a C3 plant, and the highest rate of sucrose production of any known plant. Due to its high drought tolerance, ability to grow in poor soils, resistance to generalized herbivores, and ability to harvest roots piecemeal for up to 3 years after planting; cassava has become an important food security crop for many subsistence farmers in the tropics. Cassava has shortcomings, however. Roots deteriorate 2–3 days after harvest and roots and leaves harbor cyanogenic glucosides rendering cassava toxic when not properly processed. Since many cultivars do not flower, cassava is propagated by stem cuttings. Because cassava is clonally propagated, it is an ideal crop for improvement through genetic engineering. Efforts are underway to biofortify cassava to provide a more balanced staple food.
Chapter
The production of transgenic plants is increasingly becoming an important component of agricultural biotechnology. For commercial success of plant transgenics, however, the questions need to be addressed which are related to the stable integration of transgenes and faithful transmission of introduced traits through successive generations in predictable manner. The transgene incorporated into the plant genome is integrated randomly and in unpredictable copy numbers, often in the form of repeats abolishing the expression of transgene (Stam et al. 1997, Kohli et al. 1999, Kooter et al. 1999, Kumar and Fladung 2001a) and sometimes may lead to excision of the transgene (Fladung 1999). The integration site also has a profound effect on expression of the transgene which is affected by inherent and extrinsic factors that may trigger methylation and reduce stability of the expression (Kumar and Fladung 200la). Furthermore, insertion of the transgene in or near another gene may cause an undesired phenotype.
Chapter
In leaf cells, the nuclear DNA codes for a large number of chloroplast proteins that are synthesized as precursors in the cytoplasm (1). After removal of the transit peptide at the chloroplast envelope, the mature polypeptide refolds and assembles as the functional entity. The paradigm for proteins imported by chloroplasts, the small subunit of Rubisco, exists as a multigene family in most of the plants examined; e.g. transcripts of RbcS1 and RbcS2 were found at high levels in bundle sheat cells of maize seedlings indicating that both genes are expressed in the C4-type plants (2). However, it remains unknown whether other important stromal proteins follow a similar trend; e.g. light-modulated enzymes of the Benson-Calvin cycle (3).
Chapter
The content and composition of gluten proteins are the major factors determining the breadmaking quality of wheat flour. Although gluten is a complex mixture of many proteins, one group (called the HMW subunits of glutenin) is particularly important in determining dough strength. Technologies for the genetic transformation of wheat (including gene editing) are now well established and have been used to explore the role of individual gluten proteins in determining quality and to demonstrate that improvements can be made by manipulating protein composition. However, these have not been used to develop lines for commercial production due to regulatory restrictions.
Article
Full-length and 5′ deletion fragments of three constitutively expressed gene promoters identified from the Citrus sinensis L. genome (cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1)) were evaluated for their ability to express the uidA gene in leaf, stem, and root tissues of transgenic N. benthamiana plants. According to the fluorometric GUS assays, the CsGAPC2 promoter activity was significantly reduced in the leaves when the sequence between position − 1090 and − 497 was removed, while the activity remained unchanged in the roots. The CsCYP promoter activity was not affected by the different deletions, and even the smallest evaluated fragment was sufficient to maintain the expression of the uidA gene in N. benthamiana leaves and roots. Truncated promoter fragments of CsEF1 conferred higher GUS activity in leaves compared with the full-length promoter, while GUS activity was not affected in the roots. The removal of the intron in the 5′ UTR of the CsEF1 promoter reduced gene expression in the roots, although it did not cause any reduction in the gene expression level in the leaves. These results indicate that any of the three deletions of the CsCYP promoter can be utilized for efficient gene expression. In addition, the full-length CsGAPC2 promoter and two of the truncated CsEF1 promoter fragments were sufficient for efficient uidA gene expression.
Article
Innate immunity in plants relies on the recognition of pathogen-associated molecular patterns (PAMPs) by pattern-recognition receptors (PRRs) located on the plant cell surface. CaLecRK-S.5, a pepper L-type lectin receptor kinase, has been shown to confer broad-spectrum resistance through priming activation. To further elucidate the molecular mechanism of CaLecRK-S.5, transgenic tobacco plants were generated in this study. Interestingly, hemizygous transgenic plants exhibited a high accumulation of CaLecRK-S.5, but this accumulation was completely abolished in homozygous transgenic plants by a cosuppression mechanism. Gain-of-function and loss-of-function analyses revealed that CaLecRK-S.5 plays a positive role in Phytophthora elicitin-mediated defense responses.
Article
Full-text available
Tobacco plants transformed with the RNA polymerase (RdRp) gene of potato virus X (PVX) that are extremely resistant to infection by potato virus X have previously been described. The PVX-resistant plants accumulated the RdRp protein at a lower level than fully susceptible plants transformed with the same RdRp construct. In this paper the difference between the PVX-resistant and susceptible transformed plants is investigated and it is demonstrated that there are three associated phenotypes of the RdRp transgene that vary in parallel between transformed lines. These phenotypes are: accumulation of the transgenic RdRp RNA at a low level; strain-specific resistance to PVX; and the ability of the transgene to trans-inactivate homologous transgenes. This gene-silencing potential of the transgenes conferring PVX resistance was illustrated by analysis of progeny from a cross between a transformant that was extremely resistant to PVX and a second PVX-susceptible transformant. In other transformants, in which the resistance was less extreme, the same three phenotypes were associated but in a transgene dosage-dependent manner. The same association of strain-specific resistance and low-level accumulation of the transgenic RdRp RNA was observed with plants that were transformed with mutant or wild-type versions of the RdRp gene. Strain-specific resistance was also produced in plants transformed with untranslatable versions of the RdRp transgene. Based on these data it is proposed that homology-dependent gene silencing and transgenic resistance to PVX may be due to the same RNA-based mechanism. An undefined genomic feature is proposed to account for the variation in the resistance and trans-inactivation phenotypes of different transformants. It is further proposed that this genome feature influences a cytoplasmic mechanism that degrades RNA with sequence homology to the silencing transgene.
Article
Full-text available
The class I chitinases are vacuolar proteins implicated in the defense of plants against pathogens. Leaves of transgenic Nicotiana sylvestris plants homozygous for a chimeric tobacco (Nicotiana tabacum) chitinase gene with Cauliflower Mosaic Virus (CaMV) 35S RNA expression signals usually accumulate high levels of chitinase relative to comparable leaves of non-transformed plants. Unexpectedly, some transgenic plants accumulated lower levels of chitinase than nontransformed plants. We call this phenomenon silencing. The incidence of silencing depends on the early rearing conditions of the plants. When grown to maturity in a greenhouse, 25% of plants raised as seedlings in closed culture vessels were of the silent type; none of the plants raised from seed in a greenhouse showed this phenotype. Silencing is also developmentally regulated. Plants showed three patterns of chitinase expression: uniformly high levels of expression in different leaves, uniformly low levels of expression in different leaves, and position-dependent silencing in which expression was uniform within individual leaves but varied in different leaves on the same plant. Heritability of the silent phenotype was examined in plants homozygous for the transgene. Some direct descendants exhibited a high-silent-high sequence of activity phenotypes in successive sexual generations, which cannot be explained by simple Mendelian inheritance. Taken together, the results indicate that silencing results from stable but potentially reversible states of gene expression that are not meiotically transmitted. Gene-specific measurements of chitinase and chitinase mRNA showed that silencing results from co-suppression, i.e. the inactivation of both host and transgene expression in trans. The silent state was not correlated with cytosine methylation of the transgene at the five restriction sites investigated.
Article
Full-text available
30000 transgenic petunia plants carrying a single copy of the maize A1 gene, encoding a dihydroflavonol reductase, which confers a salmon red flower colour phenotype on the petunia plant, were grown in a field test. During the growing season plants with flowers deviating from this salmon red colour, such as those showing white or variegated phenotypes and plants with flowers exhibiting only weak pigmentation were observed with varying frequencies. While four white flowering plants were shown at the molecular level to be mutants in which part of the A1 gene had been deleted, other white flowering plants, as well as 13 representative plants tested out of a total of 57 variegated individuals were not mutants but rather showed hypermethylation of the 35S promoter directing A1 gene expression. This was in contrast to the homogeneous fully red flowering plants in which no methylation of the 35S promoter was observed. While blossoms on plants flowering early in the season were predominantly red, later flowers on the same plants showed weaker coloration. Once again the reduction of the A1-specific phenotype correlated with the methylation of the 35S promoter. This variation in coloration seems to be dependent not only on exogenous but also on endogenous factors such as the age of the parental plant from which the seed was derived or the time at which crosses were made.
Article
Full-text available
Homologous recombination between a pair of directly repeated transgenes was studied in Arabidopsis. The test construct included two different internal, non-overlapping deletion alleles of npt (neomycin phosphotransferase) flanking an active HPT (hygromycin phosphotransferase) gene. This construct was introduced into Arabidopsis by agrobacterium-mediated transformation with selection for resistance to hygromycin, and two independent single-insert lines were analyzed. Selection for active NPT by resistance to kanamycin gave both fully and partly (chimeric) recombinant seedlings. Rates for one transgenic line were estimated at less than 2 x 10(-5) events per division for germinal and greater than 10(-6) events per division for somatic recombination, a much smaller difference than between meiotic and mitotic recombination in yeast. Southern analysis showed that recombinants could be formed by either crossing over or gene conversion. A surprisingly high fraction (at least 2/17) of the recombinants, however, appeared to result from the concerted action of two or more independent simple events. Some evolutionary implications are discussed.
Article
Full-text available
Linkage relationships were determined among 85 maize low copy number nuclear DNA probes and seven isozyme loci in an F2 population derived from a cross of Sorghum bicolor ssp. bicolor x S. bicolor ssp. arundinaceum. Thirteen linkage groups were defined, three more than the 10 chromosomes of sorghum. Use of maize DNA probes to produce the sorghum linkage map allowed us to make several inferences concerning processes involved in the evolutionary divergence of the maize and sorghum genomes. The results show that many linkage groups are conserved between these two genomes and that the amount of recombination in these conserved linkage groups is roughly equivalent in maize and sorghum. Estimates of the proportions of duplicated loci suggest that a larger proportion of the loci are duplicated in the maize genome than in the sorghum genome. This result concurs with a prior estimate that the nuclear DNA content of maize is three to four times greater than that of sorghum. The pattern of conserved linkages between maize and sorghum is such that most sorghum linkage groups are composed of loci that map to two maize chromosomes. This pattern is consistent with the hypothesized ancient polyploid origin of maize and sorghum. There are nine cases in which locus order within shared linkage groups is inverted in sorghum relative to maize. These may have arisen from either inversions or intrachromosomal translocations. We found no evidence for large interchromosomal translocations. Overall, the data suggest that the primary processes involved in divergence of the maize and sorghum genomes were duplications (either by polyploidy or segmental duplication) and inversions or intrachromosomal translocations.
Article
Full-text available
A chimeric construct containing the Nicotiana plumbaginifolia beta-1,3-glucanase gn1 gene was introduced into Nicotiana tabacum SR1 to produce high levels of the enzyme constitutively. We determined that the GN1 protein represents a basic beta-1,3-glucanase isoform which accumulates into the vacuoles of the transgenic plants. Analysis of the progeny of the transgenic plant with the highest levels of gn1 expression revealed an unexpected phenomenon of gene suppression. Plants hemizygous for the T-DNA locus contained high levels of gn1 mRNA and exhibited a 14-fold higher beta-1,3-glucanase activity than untransformed plants. However, the expression of gn1 was completely suppressed in the homozygous plants: no corresponding mRNA or protein could be detected. This suppression mechanism occurs at a post-transcriptional level and is under developmental control. In addition, by generating haploid plants we found that this silencing phenomenon is not dependent on allelic interaction between T-DNA copies present at the same locus of homologous chromosomes, but rather is correlated with the transgene dose in the plant genome. We postulate that high doses of GN1 protein relative to the level(s) of other still unknown plant products could trigger the cellular processes directed to suppress gn1 expression.
Article
Full-text available
We investigate the use of markers to hasten the recovery of the recipient genome during an introgression breeding program. The effects of time and intensity of selection, population size, number and position of selected markers are studied for chromosomes either carrying or not carrying the introgressed gene. We show that marker assisted selection may lead to a gain in time of about two generations, an efficiency below previous theoretical predictions. Markers are most useful when their map position is known. In the early generations, it is shown that increasing the number of markers over three per non-carrier chromosome is not efficient, that the segment surrounding the introgressed gene is better controlled by rather distant markers unless high selection intensity can be applied, and that selection on this segment first can reduce the selection intensity available for selection on non-carrier chromosomes. These results are used to propose an optimal strategy for selection on the whole genome, making the most of available material and conditions (e.g., population size and fertility, genetic map).
Article
Full-text available
A common mutation causing thalassemia in Mediterranean populations is an amber (UAG) nonsense mutation at the 39th codon of the human beta-globin gene, the beta-39 mutation. Studies of mRNA metabolism in erythroblasts from patients with beta-39 thalassemia and studies using heterologous transfection systems have suggested the possibility that this mutation not only affects protein synthesis but also alters mRNA metabolism. The effects of this mutation on several steps in the metabolism of mRNA have been investigated by transfection of the gene into permanent cell lines bearing a temperature-sensitive RNA polymerase II. Several RNA expression studies were performed, including analysis of transcription, mRNA stability, mRNA splicing accuracy, and mRNA polyadenylation. The results suggest that the defect in expression of the beta-39 mRNA occurs at a step prior to the accumulation of mRNA in the cytoplasm.
Book
In recent years several different gene silencing phenomena have been discovered in plants. The book summarizes the most recent data on gene silencing phenomena such as trans-, inactivation, paramutation and co-suppression. Plant researchers will find this edition a valuable help in differentiating between a number of puzzling and partly contradictory gene silencing events. Those not familiar with plant molecular biology are introduced into the relevant methods and scientific models. In addition examples and models of gene silencing in flamentous fungi, Drosophila and mammalian systems are presented. By providing a comparative update on gene silencing effects in different eukaryotes, this book should stimulate communication among scientists working in diverse areas of eukaryotic gene regulation.
Article
DST elements are highly conserved sequences located in the 3′ untranslated regions (UTRs) of a set of unstable soybean transcripts known as the small auxin-up RNAs (SAURs). To test whether DST sequences could function as mRNA instability determinants in plants, a model system was developed to facilitate the direct measurement of mRNA decay rates in stably transformed cells of tobacco. Initial experiments established that the chloramphenicol acetyltransferase (CAT) and β-glucuronidase (GUS) transcripts degraded with similar half-lives in this system. In addition, their decay kinetics mirrored the apparent decay kinetics of the corresponding transcripts produced in transgenic plants under the control of a regulated promoter (Cab-1). The model system was then used to measure the decay rates of GUS reporter transcripts containing copies of the DST sequence inserted into the 3′ UTR. An unmodified CAT gene introduced on the same vector served as the internal reference. These experiments and a parallel set utilizing a β-globin reporter gene demonstrated that a synthetic dimer of the DST sequence was sufficient to destabilize both reporter transcripts in stably transformed tobacco cells. The decrease in transcript stability caused by the DST sequences in cultured cells was paralleled by a coordinate decrease in transcript abundance in transgenic tobacco plants. The implications of these results for the potential function of DST sequences within the SAUR transcripts are discussed.
Article
The gene silencing effects triggered by foreign DNA inserted at a single locus in a particular transgenic tobacco plant have been characterized. The insertional locus refered as the 'silencing locus' carries two chimeric genes. The first of these genes, 35S-RiN, consists of a tobacco nitrite reductase (NiR) cDNA cloned in the antisense orientation downstream of the promoter of the 35S mRNA of the cauliflower mosaic virus (CaMV), and the second, 19S-npt II, consists of the bacterial neomycin phosphotransferase (npt II) gene cloned downstream of the promoter of the 19S mRNA of CaMV. Previous analysis showed that no expression of host NiR genes was detected in plants carrying the 'silencing locus', suggesting a true antisense effect of the 35S-RiN transgene. In addition, no expression of the 19S-npt II gene which allowed initially the selection of the kanamycin-resistant callus was detected in the regenerated plant and in its progeny. Southern blot analysis revealed that multiple copies of the resistance gene were inserted and that sequences carried by the 'silencing locus' were highly methylated. Reactivation of the 19S-npt II gene occurred at low frequency when leaf protoplasts of plants homozygous for the 'silencing locus' were induce to divide and plated on medium containing the antibiotic. Expression of 'target' transgenes expressed from the 19S promoter or the 35S promoter was silenced when brought into the presence of the 'silencing locus', independent of the coding sequence being expressed and independent of the position of insertion in the genome. Transgenes expressed from a 90 bp fragment of the 55S promoter were also silenced in trans. Southern blot analysis revealed that 'target' loci became methylated in the presence of the 'silencing locus'. Segregation of the 'silencing locus' and 'target locus' in the progeny led to a progressive rather than an immediate re-expression of silenced genes at the 'target locus'. These results suggest that the 'silencing locus' which inhibits the expression of the host NiR genes and which carries silent copies of the 19S-npt II gene also acts as a general silencer for 19S and 35S promoters and that modifications imprint a silent state to transgenes expressed from these promoters.
Chapter
Somatic cells can undergo mitotically transmitted changes in state that do not result from permanent changes in genetic constitution. These alterations in cellular heredity are called epigenetic changes to emphasize their role in the somatic transmission of developmental (i.e. epigenetic) information and to distinguish them from rare, spontaneous mutations (Nanney 1958). Epigenetic changes are defined operationally as directed cell-heritable, phenotypic changes that are potentially reversible and not transmitted meiotically (Meins 1980& Lutz 1980). It is likely that the earlier distinction made between mitotic and meiotic transmission, particularly in plants, is artificial. Forms of heritable variation such as paramutation (Brink 1973), phases of transposable-element activity (Fedoroff et al. 1989), and genomic imprinting (Surani 1991) have the properties typical of epigenetic changes, but are inherited both mitotically and meiotically. More recently, Holliday (1987) coined the term epimutation to denote heritable variation resulting from modifications of DNA due to methylation of cytosines. Jorgensen (1993) has suggested applying this term more broadly to meiotically transmitted states with a developmental basis.
Article
A shooty tumor induced by a shooter mutant of an octopine strain of Agrobacterium tumefaciens was cloned. One clone obtained (TS038) behaved aberrantly in that it grew as a shooty tumor tissue on phytohormone free medium, but did not contain octopine synthase activity. In line TS038 the genes for octopine synthase and for the enzymes involved in agropine and mannopine synthesis were present, but were not transcribed. However, the above genes became active in TS038 tumor shoots after grafting as well as after treatment with the hypomethylating agent 5-azacytidine. After an unusually long incubation period in the growth cabinet shoot cultures appeared to have developed small shoots from the top of the leaves. This unusual form of differentiation was found to be accompanied by the induction of octopine synthase activity.
Article
Two experimental approaches demonstrate that different types of RNA complementary to α-amylase mRNA are present in barley. S1 nuclease assays identify an RNA that is complementary to essentially the full length of both the type A and type B α-amylase mRNAs. Complementarity, however, is imperfect: the S1 nuclease-resistant products can only be identified if they are electrophoresed as RNA-DNA hybrids. This RNA is present in developing endosperm + aleurone tissue and in mature aleurone tissue cultured in the absence of hormonal treatment or in the presence of abscisic acid, but not in shoot or root tissue. In mature aleurone tissue treated with abscisic acid, its steady-state abundance is similar to that of α-amylase mRNA. Northern blot analysis indicated the presence of a second type of antisense RNA. Under conditions of moderate stringency, antisense-specific probes detect discrete hybridizing species of 1.6, 1.4, and 1.0 kilobases in mature aleurone and shoot tissues that do not represent spurious "hybridization" to rRNA, α-amylase mRNA, or the abundant, G+C-rich mRNA for a probable amylase/protease inhibitor. The different results are consistent with the fact that the hybridization assay can tolerate relatively short regions of complementarity separated by large, nonhomologous sequences, while the nuclease protection assay cannot.
Article
Guidelines for submitting commentsPolicy: Comments that contribute to the discussion of the article will be posted within approximately three business days. We do not accept anonymous comments. Please include your email address; the address will not be displayed in the posted comment. Cell Press Editors will screen the comments to ensure that they are relevant and appropriate but comments will not be edited. The ultimate decision on publication of an online comment is at the Editors' discretion. Formatting: Please include a title for the comment and your affiliation. Note that symbols (e.g. Greek letters) may not transmit properly in this form due to potential software compatibility issues. Please spell out the words in place of the symbols (e.g. replace “α” with “alpha”). Comments should be no more than 8,000 characters (including spaces ) in length. References may be included when necessary but should be kept to a minimum. Be careful if copying and pasting from a Word document. Smart quotes can cause problems in the form. If you experience difficulties, please convert to a plain text file and then copy and paste into the form.
Article
A new method of detecting chromosomal rearrangements in Drosophila melanogaster has been applied to the problem of measuring the biological effects of ionizing radiations from nuclear detonations. The method, itself, is an outgrowth of studies of the bithorax pseudoallelic genes near the middle of the right arm of the third chromosome (Lewis, 1951). It will be called the bithorax method. Results of applying it to the detection of X-ray induced rearrangements will be considered first.
Article
Germinally transmissible variants that arise by the anomalous imposition of developmental information on the genome are not uncommon in plant genetics, although they are often ignored. Better understanding of such variants is believed to be important because they appear to reflect basic features of developmental control processes. This paper briefly reviews classical genetic studies of such variants in plants, then discusses recent work on the genetic behaviour of plant transgenes, the results of which parallel and extend the classical genetic studies of these phenomena. An attempt is made to explain the molecular basis of these phenomena in terms of modern hypotheses on the dynamic organization of chromatin.
Article
We have attempted to explain co-suppression in terms of a hypothesis whereby homologous sequences are able to interact somatically in trans, in a manner influenced by sequence context or location. We have speculated that there might be mechanistic similarities between co-suppression and some other trans interaction and epigenetic phenomena in plants, fungi and animals; and that it might be the sequence context in which a gene lies, or its location in the genome that influences the likelihood that it will participate in these phenomena. We suspect that elucidation of the mechanisms behind these phenomena will play a role in developing a better understanding of the relationship between nuclear architecture and gene expression. This, in turn, will be helpful in understanding the developmental regulatory mechanisms that exert control over somatic trans interactions in plants, and perhaps in understanding some aspects of the basis of cellular differentiation in development.
Article
DNA methylation is believed to be involved in the control of gene expression1,2. In higher plants, up to 30% of the cytosine residues can be methylated—at C-X-G trinucleotides as well as C-G dinucleotides—compared with only 2–8% of total cytosines appearing exclusively as 5-methyl-C-5-methylcytosine in higher animals1–4. We have used the genomic sequencing technique of Church and Gilbert5 to study the methylation of an alcohol dehydrogenase gene, Adhl, from maize. Adhl is one of two unlinked maize alcohol dehydrogenase genes6,7 and appears in several tissues, including the scutellum of the kernel and the primary root of the seedling. It is further induced in primary roots subjected to anaerobiosis8–10. However, this gene is totally repressed in maize leaves11. Nonetheless, we have now found that a 900-base-pair (bp) region 5′ to the ATG is not methylated in leaves, even though it is rich in potential methylation sites. The first methylations occur 965 bp 5′ to the ATG. Thus, methylation does not appear to be involved in repressing this plant gene.
Article
The unstable recurrens alleles of nivea and pallida have been compared for sensitivity to temperature during development. Previous work showed that the palrec allele mutates germinally and somatically with a greater frequency at 15° than at 25° C. The nivrec allele is less sensitive to temperature but somatic instability is still inversely correlated with temperature. There is no difference in germinal instability at the two temperatures for nivrec.The genetic stabiliser controls for palrec and nivrec are independent.Chemical mutagens and X-rays are ineffective in inducing changes in instability of either allele.Plants doubly homozygous for the two rec alleles and for the aurone producing sulfurea gene show that nivrec usually mutates prior to palrec; instances of palrec mutating first have possibly been seen but the flush that frequently occurs in plants homozygous for nivrec prevents a definite conclusion as to whether there is an obligate mutational sequence.An example of paramutation is described. Results vary according to the temperature at the time of the cross and during seed maturation, and depend on the direction of the cross; paramutagenic female parents induce a higher frequency of paramutants.Lines of varying paramutability and paramutagenicity have been established.Somatic paramutation in homozygous nivrec regularly occurs and varies with plant development.
Article
Information about the structure, function and regulation of the maize Suppressormutator (Spm) transposable element has emerged from the genetic and molecular characterization of both deletion mutations and an unconventional type of reversible genetic change (epimutation). The element is subject to an epigenetic mechanism that can either stably inactivate it or specify one of a variety of heritable programs of differential element expression in development. The essay explores the relationship between the Spm element's epigenetic developmental programming mechanism and the determinative events central to plant development and differentiation.
Article
Unusual gene interactions were observed in several doubly transformed tobacco plants which were obtained following sequential transformation steps using two T-DNAs encoding different selection and screening markers. The expression of T-DNA-I, which encoded kanamycin resistance (Kanr) and nopaline synthase (NOS), was suppressed in some, but not all, of the double transformants after the introduction of T-DNA-II, which encoded hygromycin resistance (Hygr) and octopine synthase (OCS). Double transformants in which T-DNA-I had been inactivated could produce KanrNOS+ progeny, but these were shown to lack T-DNA-II, thus establishing the role of this T-DNA in the suppression of T-DNA-I. Reversible cytosine methylation of the promoters of T-DNA-I genes was shown to correlate with their activation/inactivation cycle. In this paper we pursue further the questions of the mechanism of suppression of T-DNA-I genes by T-DNA-II, and also the timing and extent of demethylation of T-DNA-I promoters in Kanr progeny following the loss of T-DNA-II. We propose that the suppression is due to the competition between homologous regions on each T-DNA for binding to nuclear sites with fixed locations. We further suggest that incomplete demethylation patterns of T-DNA-I promoters in Kanr progeny reflect the existence in the shoot apex meristem of two cell populations, which have either methylated or unmethylated T-DNA-I promoters, respectively. Thus, Kanr progeny are epigenetic chimeras with respect to the expression of T-DNA-I genes.
Article
Developmental and physiological factors can impose heritable metastable changes on the plant genome, a fact that was established by maize geneticists during the 1950s and 1960s, largely through the efforts of R. Alexander Brink and Barbara McClintock. This paper describes a transgenic reporter system that monitors genomic impositions as changes in morphogenetically-determined flower color patterns. The observations reported here on the metastable properties of plant transgenes illustrate the proposals of Brink and McClintock that chromosomal impositions occur during normal development as ordered sequences of events which contribute to the elaboration of complex developmental patterns. The relationship between this process and some recent findings about the control of gene expression in transgenic plants is also discussed. © 1994 Wiley-Liss, Inc.
Article
Co-suppression of the pigmentation gene chalcone synthase (chs) in Petunia hybrida by chs transgenes leads to white or variegated flowers and is characterized by a reduction in steady-state mRNA levels. To determine the level at which suppression occurs different petunia transformants were analysed containing CaMV-35S RNA promoter-driven hybrid genes consisting of the β-glucuronidase gene (uidA) linked to the full-length chsA cDNA, the 5′ half or to the 3′ half. With these transgenes one out of 12–15 primary transformants showed suppression of the transgenes and of the resident chs genes throughout the flower or in sectors. The reduction in steady-state chs mRNA was not the result of a transcriptional inactivation event. As determined by nuclear run-on experiments, transcription of suppressed chs genes was similar to that of non-suppressed genes. This indicates that co-suppression occurs post-transcriptionally. Among individual transformants the transgenes were transcribed at different levels but neither a high nor a low level correlated with a particular degree or pattern of suppression. Surprisingly, even a promoterless chs transgene construct was found to suppress the endogenous chs genes in three out of 15 transformants. It remains, however, unknown whether or not transcription of the transgene locus is required to induce co-suppression. The data suggest that properties of the chs transgene locus other than the expression level are important for inducing co-suppression. The possible role of antisense RNA, which was detected in all transformants, ectopic pairing and the structure of the integrated T-DNAs in the mechanism of the selective increase in chs RNA turnover are discussed.
Article
Plant cells growing in an artificial culture environment make numerous genetic mistakes. These alterations are manifested as increased frequencies of single-gene mutations, chromosome breakages, transposable element activations, quantitative trait variations, and modifications of normal DNA methylation patterns. Evidence is presented that indicates a high frequency of DNA hypomethylation as the result of the tissue culture process. Fifteen percent of the methylation changes appear to have been homozygous in the original regenerated plants. A hypothesis is advanced that relates DNA methylation to the variety of genetic alterations found among maize tissue culture regenerants and their progenies. The epigenetic nature of DNA methylation raises questions concerning the stability of tissue culture-induced changes in self-pollinations and crosses.
Article
Paramutation is observed when the Antirrhinum majus lines 44 and 53 are crossed. These two lines both have insertions at the nivea locus, which encodes chalcone synthase (chs). The allele niv-53 carries the transposable element Tam1 in the promoter region of the chs gene; niv-44 carries the element Tam2 within the gene. The Tam1 element has previously been extensively characterised. Here the Tam2 element is further characterised, and the arrangement of the nivea locus in paramutant plants is analysed. The complete sequence of Tam2, and that of a partial cDNA complementary to it, have been determined. The cDNA is probably transcribed from a different copy of Tam2 from that present at the nivea locus, and does not encode a functional protein. Genomic Southerns of F1 plants from the 53/44 cross show that no major rearrangements are consistently associated with paramutation at the nivea locus of A. majus. The isolation from a paramutant plant arising from a 53/44 cross of an allele (niv-4432) resulting from the excision of Tam2 is reported. The excision of Tam2 resulted in a 32 bp deletion of chs gene sequences. Plants homozygous for the new niv-4432 allele have white flowers and are still paramutagenic, demonstrating that Tam2 need not be present at the nivea locus for paramutation to occur. Different interactions between Tam1 and Tam2 are discussed, and a possible model for paramutation is presented.
Article
The bz2-mu1 allele contains a 1.4 kb Mu element insertion in the open reading frame of the bronze-2 locus. This insertion suppresses gene activity. In an active Mutator line, however, the bz2-mu1 allele shows high somatic instability resulting in numerous purple spots of full gene activity against a beige background in the aleurone tissue of the kernel; restoration of gene activity results from excision of the Mu element. In contrast, in plants with an inactive Mutator system, uniformly bronze kernels are found, and the Mu element at bz2-mu1 is stabilized. Accompanying a loss of somatic instability, this Mu element, as well as the Mu elements elsewhere in the genome, have an increased level of DNA modification. Spontaneous reactivation of somatic instability in inactive Mutator lines rarely occurs; however, reactivation can be induced with gamma irradiation. Reactivated plants regain both the spotted kernel phenotype indicative of element excision from the bz2-mu1 reporter allele and diagnostic restriction sites within the Mu elements indicative of a hypomethylated state. The reactivated plants transmit these characters to their progeny. These data support the hypothesis that genomic shock can elicit cryptic transposable element activities in maize. Possible mechanisms for inactivation and reactivation of the Mutator transposable element system are also discussed.
Article
In several plant systems expression of structurally intact genes may be silenced epigenetically when a transgenic construct increases the copy number of DNA sequences. Here we report epigenetic silencing inArabidopsis lines containing transgenic inserts of defined genetic structure, all at the same genomic locus. These comprise an allelic series that includes a single copy of the primary insert, which carries repeated drug resistance transgenes, and a set of its derivatives, which as a result of recombination within the insert carry different numbers and alleles of resistance genes. Although the drug resistance genes remained intact, both the primary and some recombinant lines nevertheless segregated many progeny that were partly or fully drug-sensitive because of silencing. As in other systems silencing was reversible, and correlated with decreased steady-state mRNA and increased DNA methylation. Each different number and combination of genes, on the same or different (i.e., homologous) chromosomes, conditioned its own idiosyncratic segregation pattern. Strikingly, lines with a single gene segregated only a few slightly drug-sensitive progeny whereas multi-gene lines segregated many highly sensitive progeny, indicating dependence of silencing at this locus on repeated sequences. This argues strongly against explanations based on antisense RNA, but is consistent with explanations based on ectopic DNA pairing. One possibility is that silencing reflects the interaction of paired homologous DNA with flanking heterologous DNA, which induces condensation of chromatin into a non-transcribable state.
Article
The maize controlling element activator, Ac, is capable of self-transposition. We isolated a spontaneously arisen derivative, (wx-m9Ds-cy) of the Ac element present in the wx-m9Ac mutant which does not itself transpose but can be induced to transpose by the presence of an Ac element elsewhere in the genome. The wx-m9Ds-cy derivative reverts to an active Ac form. A comparison of cloned isolates of the three forms of the element shows no differences in restriction enzyme pattern. Southern analysis of the genome organization of the elements shows marked differences in the methylation pattern. The active Ac element is methylated at one end of the element while the inactive derivative wx-m9Ds-cy is completely methylated at all HpaII sites in the element. The revertant Ac is partially demethylated. Reversion of the mutants to the active form appears to be at least a two-step process.
Article
Rapid genomic changes accompanied by heritable phenotypic changes can be induced in flax by environmental stress. The DNA changes are confined to a specific subset of the genome and may affect the phenotype by virtue of their position in the genome rather than by their specific nucleotide sequence.
Article
Agrobacterium-transformed Arabidopsis plants were generated and the stability of their T-DNA-encoded resistance to kanamycin was examined. Of seven families, each homozygous for a single insertion event, two showed progressive inactivation of resistance over four generations of inbreeding. Loss of resistance was associated with methylation of an Sst II site in the nos promoter of the kanamycin resistance gene. Treatment of plant roots from inactive lines with the demethylating agent 5-azacytidine restored the ability of such lines to form callus on kanamycin-containing media. These observations are consistent with the view that methylation is a factor in the progressive inactivation of transgenes in Arabidopsis.
Article
After epigenetic loss of Mutator activity, the family of Mu elements in Zea mays becomes immobile and highly methylated; in addition, Mu9, the presumptive autonomous regulatory element, is transcriptionally silent and its copy number decreases in successive crosses to non-Mutator lines. Spontaneous reactivation, scored as restoration of somatic instability of potentially mutable alleles of Bronze-2, of such cryptic Mutator lines is rare, occurring with a frequency of about 10(-4). Irradiation of pollen with 254 nm ultraviolet light increases reactivation rate in the progeny kernels by up to 40-fold. Accompanying reactivation, the copy number of Mu9 elements increased, two-fold in one line and 20 to 40-fold in a second line. Reactivation may involve direct DNA damage or immediate physiological stress in the treated pollen.
Article
The regions of integration of a transferred DNA-fragment from three transgenic Petunia hybrida plants were analysed for their influence on the expression of the foreign DNA. Each of the three transformants, lines 16, 17 and 24, contained a fragment of a plasmid on which two genes were located, an npt-II gene which renders the plants resistant to kanamycin and the A1 gene from Zea mays, a visible marker gene that leads to the production of a brick red anthocyanin pigment in the flowers. Inactivation of both genes in line 16 is associated with integration into a region of highly repetitive DNA, while the integration sites of the other two lines were essentially unique. The integration regions of lines 17 and 24, both of which show expression of the foreign genes at characteristically different intensities, showed a distinct methylation pattern that was stably conserved for these regions in both transgenic and wild-type plants. The characteristic methylation pattern of the two integration regions was also imposed on the border region of the integrated fragments and might thus be responsible for the differences in the intensity of gene expression observed among the two lines.
Article
Variegated phenotypes often result from chromosomal rearrangements that place euchromatic genes next to heterochromatin. In such rearrangements, the condensed structure of heterochromatin can spread into euchromatic regions, which then assume the morphology of heterochromatin and become transcriptionally inactive. In position-effect variegation (PEV) therefore, gene inactivation results from a change in chromatin structure. PEV has been intensively investigated in the fruitfly Drosophila, where the phenomenon allows a genetic dissection of chromatin components. Consequently, many genes have been identified which, when mutated, act as dominant modifiers (suppressors or enhancers) of PEV. Data available already demonstrate that genetic, molecular and developmental analysis of these genes provides an avenue to the identification of regulatory and structural chromatin components, and hence to fundamental aspects of chromosome structure and function.