Interaction kinetics of the copper-responsive CopY repressor with the cop promoter of Enterococcus hirae

Division of Biochemistry, Freie Universität Berlin, Berlín, Berlin, Germany
JBIC Journal of Biological Inorganic Chemistry (Impact Factor: 2.54). 07/2004; 9(4):396-402. DOI: 10.1007/s00775-004-0536-1
Source: PubMed
ABSTRACT
In Enterococcus hirae, copper homeostasis is controlled by the cop operon, which encodes the copper-responsive repressor CopY, the copper chaperone CopZ, and two copper ATPases, CopA and CopB. The four genes are under control of CopY, which is a homodimeric zinc protein, [Zn(II)CopY]2. It acts as a copper-responsive repressor: when media copper is raised, CopY is released from the DNA, allowing transcription to proceed. This involves the conversion of [Zn(II)CopY]2 to [Cu(I)2CopY]2, which is no longer able to bind to the promoter. Binding analysis of [Zn(II)CopY]2 to orthologous promoters and to control DNA by surface plasmon resonance analysis defined the consensus sequence TACAnnTGTA as the repressor binding element, or " cop box", of Gram-positive bacteria. Association and dissociation rates for the CopY-DNA interaction in the absence and presence of added copper were determined. The dissociation rate of [Zn(II)CopY]2 from the promoter was 7.3 x 10(-6) s(-1) and was increased to 5 x 10(-5) s(-1) in the presence of copper. This copper-induced change may be the underlying mechanism of copper induction. Induction of the cop operon was also assessed in vivo with a biosensor containing a lux reporter system under the control of the E. hirae cop promoter. Half-maximal induction of this biosensor was observed at 5 microM media copper, which delineates the ambient copper concentration to which the cop operon responds in vivo.

Full-text

Available from: Marc Solioz
ORIGINAL ARTICLE
Reto Portmann Æ David Magnani Æ Jivko V. Stoyanov
Ariane Schmechel Æ Gerd Multhaup Æ Marc Solioz
Interaction kinetics of the copper-responsive CopY repressor
with the
cop
promoter of
Enterococcus hirae
Received: 14 January 2004 / Accepted: 26 February 2004 / Published online: 1 April 2004
SBIC 2004
Abstract In Enterococcus hirae, copper homeostasis is
controlled by the cop operon, which encodes the copper-
responsive repressor CopY, the copper chaperone
CopZ, and two copper ATPases, CopA and CopB. The
four genes are under control of CopY, which is a ho-
modimeric zinc protein, [Zn(II)CopY]
2
. It acts as a
copper-responsive repressor: when media copper is
raised, CopY is released from the DNA, allowing tran-
scription to proceed. This involves the conversion of
[Zn(II)CopY]
2
to [Cu(I)
2
CopY]
2
, which is no longer able
to bind to the promoter. Binding analysis of [Zn(II)-
CopY]
2
to orthologous promoters and to control DNA
by surface plasmon resonance analysis defined the con-
sensus sequence TACAnnTGTA as the repressor bind-
ing element, or ‘‘cop box’’, of Gram-positive bacteria.
Association and dissociation rates for the CopY–DNA
interaction in the absence and prese nce of added copper
were determined. The dissociation rate of [Zn(II)CopY]
2
from the promoter was 7.3·10
-6
s
-1
and was increased to
5·10
-5
s
-1
in the presence of copper. This copper-induced
change may be the underlying mechanism of copper
induction. Induction of the cop opero n was also assessed
in vivo with a biosensor containing a lux reporte r system
under the control of the E. hirae cop promoter. Half-
maximal induction of this biosensor was observed at
5 lM media copper, which delineates the ambient cop-
per concentration to which the cop operon responds in
vivo.
Keywords Copper homeostasis Æ DNA–repressor
interaction Æ Surface plasmon resonance Æ Enterococcus
hirae Æ Gene regu lation
Abbreviations TCEP: tris(2-carboxyethyl)phosphine Æ
RU: response units Æ TG: buffer 50 mM tris-SO
4
,pH
7.8, 5% (v/v) glycerol
Introduction
Copper is fundamental to all living organisms, from
bacteria to humans. While deficiency in copper is criti-
cal, excessive accumulation of the metal is toxic to cells.
This makes it crucial for organisms to regulate the up-
take, intracellular routing, and excretion of copper
accurately. In the Gram-positive bacterium E. hirae,
copper homeostasis is apparently controlled by the
chromosomal cop operon. The operon consists of the
four genes, copY, copZ, copA, and copB. CopY encodes
a copper-responsive repressor, copZ encodes a copper
chaperone, and copA and copB are the code for CPx-
type membrane copper ATPases which are involved in
copper uptake and secretion, respectively [1, 2, 3, 4].
The cop operon is under control of CopY, which acts
as a copper-responsive repressor: at low ambient copper
concentrations, the operon is repressed; in rich growth
media, maximal induction of transcription is observed
by media copper concent rations ab ove 1 mM. CopY is a
homodimeric zinc protein of the form [Zn(II)CopY]
2
[5].
It binds to two distinct sites of the promoter region, as
shown by DNaseI footprinting. The two CopY binding
sites feature an inverted repeat and flank the start of
transcription (Fig. 1 [6, 7]). The N-terminal ha lf of
CopY shows 30% sequence similarity to the bacterial
repressors of ß-lactamases, PenI, of Bacillus lichenifor-
mis [8] and related proteins and probably corresponds to
the domain that recognizes the DNA promoter se-
quences [9]. The C-terminal region of CopY harbors a
CxCxxxxCxC metal-binding motif. In its DNA-binding
form, a zinc ion is complexed to the four cysteine resi-
dues. Upon induction of the cop operon by copper, two
Cu(I) ions displace the zinc and provoke the release of
CopY from the DNA [5, 10]. Copper is delivered to
R. Portmann Æ D. Magnani Æ J. V. Stoyanov Æ M. Solioz (&)
Department of Clinical Pharmacology, University of Berne,
Murtenstrasse 35, 3010 Berne, Switzerland
E-mail: marc.solioz@ikp.unibe.ch
Tel.: +41-31-6323268
Fax: +41-31-6324997
A. Schmechel Æ G. Multhaup
Department for Chemistry/Biochemistry, Free University
of Berlin, Thielallee 63, 14195 Berlin, Germany
J Biol Inorg Chem (2004) 9: 396–402
DOI 10.1007/s00775-004-0536-1
Page 1
CopY by the CopZ copper chaperone, a 69-amino acid
protein belonging to the family of ubiquitous metallo-
chaperones (cf. Fig. 8 [11, 12]).
Similar tripartite regulatory syst ems are also found in
other lactic acid bacteria. The regulation of gene
expression by copper is a key element of copper
homeostasis, and the kinetic analysis of this regulation
will help in the understanding of copper homeostasis.
We used here, for the first time, surface plasmon reso-
nance analysis to assess quantitatively kinetic parame-
ters of the interaction of the E. hirae CopY repressor
with the promoter. The in vitro findings were comple-
mented by in vivo measurements with a lux reporter
system under the control of the E. hirae cop-promoter/
repressor/chaperone system in an Escherichia coli host
deficient in copper homeostasis [13].
Materials and methods
Reagents
P-20 (ultra-pure Tween-20) was supplied by Biacore and
tris(2-carboxyethyl)phosphate (TCEP) by Aldrich. All
other chemicals were from Sigma Chemical Corp. (St.
Louis, MO, USA) or from Merck (Darmstadt, Germany)
and were of analytical grade. The following oligonucleo-
tides were synthesized by Microsynth (Balgach, Switzer-
land): biotinylated E. hirae promoter (hirae1),
5¢-AAGTTAAGTT TACAAATGTAATCGATGGAG;
complementary strand, 5¢-CTCCATCGATTACATTT
GTAAACTTAACTT; biotinylated control (control), 5¢-
TTTTAGTGTTGGTCCGCAGGAACTTATCTT;
complementary strand, 5¢-AAGATAAGTTCCTGC
GGACCAACACTAAAA; biotinylated S. mutans
promoter (mutans), 5¢-ATAATATATCTACA
AATGTAGATGAAAGGA; complementary strand, 5¢-
TCCTTTCATCTACATTTGTAGATATATTAT; bio-
tinylated L. lactis promoter (lactis), 5¢-TTTTAGTGTT-
TACACGTGTAAACTTATCTT; complementary
strand, 5¢-AAGATAAGTTTACACGTGTAAACACT
AAAA.
Construction of the CopY expression vector
The copY gene was amplified from plasmid pWY145 [6]
with the primers 5¢-GCTTGGATTCTCACCAA-
TAAAA and 5¢-GGATCCATGGAAGAAAAGA-
GAGTATTAATT and TaqPlus DNA poly merase
(Stratagene). The product was cut with BamHI and Hin-
dIII and cloned into pQE8 (Qiagen), digested with the
same enzymes. This resulted in the vector pWH6,
expressing CopY with a hexa-histidine N-terminal tag.
The correct DNA sequence of the clone was verified by
sequencing.
Protein purification
[Zn(II)CopY]
2
is the native form of CopY iso lated from
E. hirae or E. coli. For its purification, BL21(DE3) cells
(Stratagene) containing plasmid pWH6 were grown
aerobically at 37 CtoanA
550
of 0.4. Following
induction with 1 mM isopropyl-1-thio-ß-
D-galactopyr-
anoside for 4 h, the cells were harvested by centrifuga-
tion for 10 min at 5,000 g. The cell pellet was washed
twice with 200 ml TG buffer (50 mM tris-SO
4
, pH 7.8,
5% (v/v) glycerol) and resuspended in 5 ml of TG buf-
fer/g of wet cells. The cells were broken by three pas-
sages through a French press at 40 MPa. The cell debris
was collected by centrifugation for 1 h at 90,000 g and
the supernatant passed through a Ni-NTA Superflow
(Qiagen) column. [Zn(II)CopY]
2
was eluted with TG
buffer containing 200 mM imidazole. Final purification
was achieved by gel filtration on a TSK3000G column in
TG buffer. CopY without a histidine tag and CopZ were
purified as previously described [6, 11]. Protein concen-
trations were determined by quantitative amino acid
analysis. Zinc contents were assessed by inductively
coupled plasma atomic emission and were, on average,
1.1 Zn per CopY monomer in purified [Zn(II)CopY]
2
.
Copper loading of CopZ
CopZ at 587 lg/ml was dialyzed twice for 2 h at 4 C
against buffer Y (20 mM tris acetate, pH 8.0, 5 mM
Fig. 1 Schematic representation of the [Zn(II)CopY]
2
–DNA inter-
action. The conserved cop boxes are emphasized by yellow
rectangles and the inverted repeat indicated by black arrows.A
[Zn(II)CopY]
2
dimer binds to each of the two cop boxes of the
E. hirae promoter (hirae1/2) and protects the regions indicated by
red type from DNaseI digestion [6]. Transcription starts at the
underlined G residue and is symbolized by the green arrow. Aligned
below the first E. hirae cop box are the second E. hirae cop box
(hirae2) and the cop boxes of Lactobacillus sakei (sakei), Strepto-
coccus mutans (mutans), and Lactococcus lactis (lactis). Also shown
is a control oligonucleotide (control) derived from the L. lactis
promoter by mutation of the inverted repeat
397
Page 2
magnesium acetate, 50 mM sodium acetate, 1 mM cal-
cium acetate, 2% acetonitrile, and 0.05% P-20). CopZ
was then reduced for 15 min at room temperature by
adding 1/10 volume of 50 mM TCEP in buffer Y. Cu(I)-
acetonitrile, prepared as described by Hemmerich and
Sigwart [14], was diluted 1,000-fold from 10 mM stock
in 2% acetonitrile, 5 mM perchloric acid, into the CopZ
solution, resulting in a final concentration of 10 lM
Cu(I)-acetonitrile. Incubation was continued for an
additional 30 min. Copper-loaded Cu(I)Cop Z was
diluted to the concentrations indicated.
Coupling of DNA to the sensor chip
For coupling, 500 ll of the biotinylated 29-mer olig o-
nucleotide (1.25 lg/ml) was mixed with 500 ll of the
complementary, non-biotinylated 29-mer oligonucleo-
tide (1.5 lg/ml). The mix was heated to 80 C and slowly
cooled to 30 C within 1 h. Avidin-containing SA sensor
chips were conditioned with three consecutive 1-min
injections of 1 M NaCl in 50 mM NaOH, followed by
the injection of 2.5 lg/ml biotinylated oligonucleotide
until binding of approximately 500 RU (response units)
was achieved.
Coupling of CopY to the sensor chip
The surface of CM5 chips were activated by injecting
45 llofN-hydroxylsuccinimide/N-hydroxylsuccinimide
and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide at
a flow rate of 5 ll/min. Protein at 2.5 lg/ml in 20 mM
sodium acetate, pH 4.5, was injected at a flow rate of
10 ll/min until an increase of about 500 RU was
reached. To quench excessive reactive groups, 30 llof
1 M ethanolamine, pH 9.0, was injected. This was fol-
lowed by washing with 2 M MgSO
4
to remove non-
covalently bound protein.
Surface plasmon resonance analysis
Experiments were performed on a Biacore Upgrade
instrument at 25 C, using a flow rate of 5 ll/min. All
runs were performed in buffer Y, and protein samples
were dialyzed against this buffer before use. Between
assays, sensor chips were reconditioned with two con-
secutive washes of 10 llof10mMEDTAand2M
MgCl
2
. Data analysis was performed with BIAevalua-
tion software version 3.1 (Biacore). Interactions were
fitted by the Langmuir binding model (A+B=AB). The
calculated association (k
a
) and dissociation (k
d
) rates
were derived by fitting of the Biacore curves. Association
and dissociation phases were fitted separately. K
D
values
were calculated from the relation K
D
=k
d
/k
a
.
Construction of the lux reporter plasmid
The 3¢-end of the E. hirae cop operon, containing the
promoter and the copY and copZ genes, was cut out of
pOA1 [3] with EcoRI and HindIII, made blunt-ended
with Klenow DNA polymerase, and ligated into pC3
[15], cut with the same enzymes and also made blunt-
ended with Klenow DNA polymerase. The resultant
plasmid, pOC1, was cut with BamHI and PstI and li-
gated with the luxCDABE cluster excised from
pUCD615 [16] with the same enzymes, resulting in
plasmid pOCL.
Measurement of lux induction
The E. coli copA-knockout strain DW3110 [13] con-
taining the lux reporter plasmid pOCL was grown aer-
obically at 37 C to mid-log phase in 12 ml of LB media.
Cells were then centrifuged at room temperature and the
cell pellet resuspended in 24 ml of 0.9% NaCl and 1%
glucose (salt media). Aliquots of 1 ml were transferred
to Eppendorf tubes and induced at room temperature by
the addition of CuSO
4
. Emitted light was measured after
1 h (LB media) or 2 h (salt media) with an LAS-1000
CCD camera (Fuji Phot o Film, Japan) for 10 min. The
images were integrated with the AIDA software (Raytest
Isotopenmessgera
¨
te, Straubenhardt, Germany).
Results
It was shown previously by DNase footprinting and
band-shift assays that there are two distinct binding sites
for CopY in the promoter region of E. hirae cop operon
[6]. By comparison of these regions with the promoter
sites of the cop operons of Lactococcus lactis and
Streptococcus mutans, we identified a conserved inverted
Fig. 2 Saturation of the promoter binding site with [Zn(II)CopY]
2
.
Injection of 2 lg/ml biotinylated hirae2-DNA onto the streptavi-
dine-coated sensor chip was started at point a and continued to
point b, followed by extensive washing with 2 M MgSO
4
(break in
the curve). Injection of 100 lg/ml of E. hirae [Zn(II)CopY]
2
was
started at point c, followed by injection of buffer, started at point d
and continued to the end of the curve. Other details are outlined
under Materials and methods
398
Page 3
repeat or ‘‘cop-box’’ that is common to these promoters
(Fig. 1). A control oligonucleotide with a randomly
mutated cop-box did not exhibit significant binding of
CopY (cf. Fig. 1, control). This sug gests that the eight
bases of the cop-box sequence represent the consensus
repressor binding site.
To characterize the binding of E. hirae CopY in
quantitative terms, biotinylated double-stranded E. hi-
rae promoter DNA (hirae2) was coupled to a strepta-
vidine-coated Biacore sensor chip, and the binding of
[Zn(II)CopY]
2
to the DNA was measured by surface
plasmon resonance analysis. Figure 2 shows the initial
DNA loading of the sensor chip and subsequent
[Zn(II)CopY]
2
binding and dissociation. At point a,
injection of 2 lg/ml of hirae2-DNA was started and
continued until 484 RU was reached at point b.(Note
that the upward jump at a and the downward jump at b
are due to the changes in refractive index of the buffers
and not due to mass changes on the chip surface.)
During the extensive wash with 2 M MgCl
2
(axis break),
there was no apparent loss of DNA (the limit of detec-
tion was 10 RU). At point c, 100 lg/ml of CopY was
injected until saturation of the binding to DNA, yielding
947 RU. Since the response units are directly propor-
tional to the mass bound to the chip surface, the stoi-
chiometry of the DNA–CopY complex can be
calculated. The chip, containing 484 RU of biotinylated,
double-stranded hirae2 oligonucleotide with an M
r
of
18,651, bound 947 RU of [Zn(II)CopY]
2
with an M
r
of
33,285. This corresponds to a calculated stoichiometry
of 1.09 [Zn(II)CopY]
2
bound per oligonucleotide and
shows that the model of one [Zn(II)CopY]
2
dimer
binding to each cop box is correct. Since histidine-tagged
CopY and native CopY worked equally well and
exhibited essentially the same binding profiles, experi-
ments were conducted with histidine-tagged CopY.
The CopY repressor was also cross-tested with pro-
moter DNA of Lactococcus lactis and Streptococc us
mutans. To these heterologous promoters, CopY showed
the same binding activity as the endemic E. hirae pro-
moter (not shown). This supports the hypothesis that the
cop box, which is conserved in all these promoters, is the
consensus repressor binding element. In line with this,
there was no significant CopY binding to a control
promoter in which the eight bases of the inverted repeat
were randomly changed. In addition, there was no
measurable interaction between CopY and a streptavi-
dine chip without bound DNA, which shows that the
repressor–DNA interaction was specific.
The association and dissociation rates of the inter-
action between CopY and the cop promoter were as-
sessed by measuring the binding of [Zn(II)CopY]
2
to
promoter DNA at different CopY concentrations
(Fig. 3). The association and dissociation curves were
fitted with the BIAevaluation software. This resulted in
an association rate co nstant k
a
of 4.3·10
4
M
-1
s
-1
and a
dissociation rate k
d
of 7.3·10
-6
s
-1
. Accordingly, the
affinity of [Zn(II)CopY]
2
for the promoter could be
calculated from K
D
=k
d
/k
a
as 1.7·10
-10
M. In the
presence of copper, CopY dissociated from the pro-
moter as [Cu(I)
2
CopY]
2
at a rate of 5·10
-5
s
-1
.An
association rate for [Cu(I)
2
CopY]
2
could not be deter-
mined due to the unavailability of this complex. Pre-
sumably, the observed changes in the affinity of CopY
for the cop-box partake in induction of the cop operon
by copper in vivo .
A possible interfering interaction of [Zn(II)CopY]
2
with itself was analyzed by direct coupling of [Zn(II)-
CopY]
2
to the chip surface, yielding approximately
500 RU. Injecting different concentrations of [Zn(II)-
CopY]
2
onto this chip did not reveal any significant
interaction of CopY with itself (not shown). Using the
same [Zn(II)CopY]
2
chip, the interaction with CopZ
and copper-loaded Cu(I)CopZ was analyzed. Kinetic
parameters were determined at CopZ and Cu(I)CopZ
concentrations of 587, 353, 117, 59, and 35 lg/ml. (For
clarity, only one concentration is shown in Fig. 4.)
While the k
d
values differed only two-fold between
CopZ and Cu(I)CopZ, the k
a
value for Cu(I)CopZ was
440-fold higher than that for CopZ (cf. Fig. 8). When
Fig. 3 Association and dissociation of CopY with the E. hirae
promoter. [Zn(II)CopY]
2
was injected for 2 min at different
concentrations and a flow rate of 10 ll/min. This was followed
by the injection of buffer Y. Other details are given under Materials
and methods
Fig. 4 Interactions of CopY with CopZ and Cu(I)CopZ. [Zn(II)-
CopY]
2
chemically cross-linked to a sensor chip was challenged for
3 min with 35 lg/ml of CopZ (----), and 35 lg/ml of Cu(I)CopZ
(ÆÆÆÆ), followed by the injection of buffer Y. Other details are as
outlined under Materials and methods
399
Page 4
CopZ was immobilized, no interaction with [Zn(II)-
CopY]
2
was detected (not shown). Most likely, this was
due to steric hindrance. The coupling method we used
preferentially crosslinks proteins via the -amino
groups of lysine residues. There is a cluster of six lysine
residues one side of CopZ, and we had shown previ-
ously by site-directed mutagenesis that these lysine
residues are required for interaction with [Zn(II)
CopY]
2
[10].
From previous in vivo and in vitro studies, it was
clear that copper releases zinc from [Zn(II)CopY]
2
,
thereby releasing the repressor from the DNA and
allowing tra nscription of the cop operon to proceed [5, 6,
7]. Thus, the effect of Cu(I) on the release of [Zn(II)-
CopY]
2
bound to a sensor chip with immobilized hirae1
DNA was investigated. CopY release was triggered with
copper(I)-acetonitrile, a copper(I) complex which is
stable even under aerobic conditions (Fig. 5). The dis-
sociation rate of the [Zn(II)CopY]
2
–DNA complex in
the presence of 100 lM of the copper(I)-chelator bi-
cinchoninic acid was 7.3·10
-6
s
-1
. This value represents a
lower threshold for the dissociation rate of the [Zn(II)-
CopY]
2
–DNA complex in the absence of copper. The
rate of decomposition of the complex increased seven-
fold in the presence of 10 lM copper(I)-acetonitrile,
reaching a value of 5·10
-5
s
-1
. Presumably, this rate
change is responsib le for the induction process in vivo.
Inside the cell, the delivery of copper to CopY is
supposed to be effected by Cu(I)CopZ. To investigate
this step by surface plasmon resonance, [Zn(II)CopY]
2
was bound to a chip containing cop promoter DNA , and
the release of CopY by Cu(I)CopZ was measured
(Fig. 6). When Cop Z was passed over the chip, there
was a bi-phasic signal: a decrease in RU followed by an
increase in RU. This was due to two reactions taking
place simultaneously: the binding of CopZ to CopY,
leading to an increase in RU, and the release of CopY
from the chip, resulting in a decrease in RU. So binding
of CopZ masks simultaneous release of CopY, which
precluded the determination of kinetic constants for this
tripartite reaction. When Cu(I)CopZ instead of CopZ
was injected, the decrease in RU was strongly acceler-
ated due to the accelerated release of CopY from the
DNA chip. Qualitatively, this shows that Cu(I)CopZ
accelerates the release of [Zn(II)CopY]
2
from the pro-
moter, in line with the presumed in vivo function of
Cu(I)CopZ in delivering copper to the [Zn(II)CopY]
2
repressor dimer.
The copper concentration necessary to induce the cop
operon in vivo was assessed by constructing a biosensor
based on the light-producing lux gene cluster of Vibrio
fischeri. The plasmid pOCL contained the 3¢ end of the
E. hirae cop operon, consisting of the cop promoter, the
copY repressor gene, and the copZ gene for the copper
chaperone. Downstream of the copZ gene, the operon
was fused to the lux gene cluster of V. fischeri, thus
placing these genes under the control of the regulatory
system of the E. hirae cop operon. The construct was
transformed into the DcopA Escherichia coli strain
DW3110. This strain is deficient in the copper-secreting
CopA ATPase, the major, or possibly sole, extrusion
system for cytoplasmic copper [17, 18]. The lumines-
cence produced by the expression of the lux genes under
the control of the cop promoter was measured as a
function of ambient copper concentrations. In LB
media, luminescence ensued at 300 lM added copper
and reached a maximum at 2 mM added copper
(Fig. 7). At higher copper concentrations, luminescence
decreased due to copper toxicity, which is apparent in
growth experiments (not shown).
In contrast to the response in LB media, lumines-
cence measured in 0.9% NaCl, with 1% glucose as an
energy source, already started at 2 lM added copper
and reache d a maximum at 10 lM. Clearly, in LB
media, a large fraction of the added copper was com-
plexed and thus not bioavailable . The copper levels re-
quired for induction in simple salt media cannot be
translated into intracellular copper concentrations be-
cause of copper binding to intracellular constituents.
Fig. 5 Copper-dependence of the dissociation of CopY from the
promoter. Dissociation rates of CopY from a sensor chip
containing hirae2-DNA was measured at different copper(I)-
acetonitrile concentrations, essentially as described in Fig. 3
Fig. 6 Influence of CopZ on dissociation of CopY. CopY
(950 RU) was bound to a hirae2-DNA-containing sensor chip,
and CopY release was measured by injecting buffer Y (solid curve),
10 lg/ml of CopZ (dashed curve), or 10 lg/ml of Cu(I)CopZ
(dotted curve). Other details are described under Materials and
methods
400
Page 5
The experiment does, however, suggest the ambient
copper concentration to which bacteria react by up-
regulating the cop operon.
Discussion
Related Gram-positive bacteria were found by database
sequence-similarity searching to contain operons similar
to the cop operon of E. hirae. Althoug h some of these
operons are missing the equivalent of the E. hirae copB
or copZ genes, they do possess the genes encoding
CopY-like repressors and CPx-type heavy-metal ATP-
ases [4], which presumably are copper efflux pumps.
Sequence comparison of the putative cop promoter/
repressor binding regions in these organisms revealed a
common motif, consisting of an inverted repeat of the
sequence TACAnnTGTA. This motif forms a type of
‘‘cop box’’, which appears to be the binding site for
CopY-like copper-respon sive repressors. This is sup-
ported by three observations: (1) the motif is conserved
in all operons related to the E. hirae cop operon, (2)
E. hirae [Zn(II)CopY]
2
exhibited the same affinity for
these heterologous promoter regions which we tested,
and (3) mutation of the conserved inverted-repeat
completely abolishes repressor binding. The binding site
of the copper-responsive repressor of E. coli, CueR, does
not share sequence similarity to the cop box, which may
thus be specific for Gram-positive bacteria [19, 20].
We measured, for the first time, kinetics for copper-
repressor–DNA interactions by surface plasmon reso-
nance analysis. Since the signal changes (RU) in surface
plasmon resonance analysis are proportional to the mass
bound to the sensor chip, stoichiometries for the
repressor–DNA interaction could be derived. Under the
experimental conditions used, 1.09 [Zn(II)CopY]
2
per
oligonucleotide could be bound. This is very close to the
theoretical value of one, providi ng experimental support
for the hypothesis that one [Zn(II)CopY]
2
dimer binds
to a single cop-box. It also shows that essentially all the
oligonucleotides on the sensor chip were accessible to
[Zn(II)CopY]
2
under our experimental conditions.
We determined an equilibrium dissociation constant,
K
D
, for the [Zn(II)CopY]
2
–DNA interaction of 1.7·10
-
10
in the absence of copper. The association rate of
[Zn(II)CopY]
2
with the DNA target was not affected by
copper. In contrast, the dissociation rate of the
[Zn(II)CopY]
2
–DNA complex was increased seven-fold
in the presence of copper (Fig. 8). This increase is co n-
sistent with the in vivo action of CopY, i.e. the release
from the DNA-binding site upon contact with copper
and the formation of a [Cu(I)
2
CopY]
2
complex. Copper-
induced dissociation of CopY from the DNA had al-
ready qualitatively been shown by band-shift experi-
ments [6]. The modulation of the affinity of a repressor
for its DNA target by a chemical inducer has not been
determined quantitatively before. The EthR repressor, a
member of the TetR/CamR family of repressors,
exhibited a K
D
of only 1.5·10
-7
M and showed strong
cooperativity, but did not undergo a change in affinity
by the presence of the purported inducer ethionamide
[21]. The thermo-inducible cts-52 mutant repressor of
Bacillus subtilis phage u 105 had affinities for DNA
Fig. 8 Overview of all interaction kinetics between elements
involved in copper homeostasis. Shown are the CopA copper
ATPase of the plasma membrane (blue), the CopZ and Cu(I)CopZ
chaperones (green), CopY
2
and [Zn(II)CopY]
2
repressor dimers
(yellow), and the promoter region with the cop box (red). The
kinetic values for the respective interactions are indicated. Values
for the interaction of CopZ and Cu(I)CopZ with CopA were taken
from reference [23]
Fig. 7 In vivo induction of the cop operon measured with a lux
biosensor. E. coli DcopA cells containing the biosensor plasmid
pOCL were exposed to copper in 0.9% NaCl, 1% glucose (filled
circles), or in LB media (open circles). Luminescence was measured
with a cooled CCD camera. Other details are given under Materials
and methods
401
Page 6
similar to those of CopY, namely in the range of 0.2–
1·10
-10
, depending on the promoter [22]. Raising the
temperature from 37 to 50 C led to a more than ten-
fold decrease in the affinity of the repressor for some of
the promo ters, explaining thermo-induction [22]. Thus,
relatively small changes in equilibrium-dissociation
constants between the repressor and the DNA target
appear to be sufficient to trigger induction of tran-
scription.
The rate of dissoci ation of CopZ from [Zn(II)CopY]
2
differed only two-fold in the presence or absence of
copper. In contrast, the association rate of Cu(I)CopZ
with [Zn(II)CopY]
2
was 440-fold higher than that of
CopZ. This supports the in vivo function of Cu(I)CopZ
in delivering copper to [Zn(II)CopY]
2
[5, 10]. Once
CopZ has donated the copper to CopY (and possibly
other cellular constituents requiring copper), it has to be
re-loaded with copper during the cyclic process of this
chaperone. This presumably occurs at CopA [23]. The
kinetic parameters of the interaction of CopZ and CopA
had been determined earlier by surface plasmon reso-
nance analysis [23] and corroborated the suggested
CopZ cycle (Fig. 8). The association rates of CopZ and
Cu(I)CopZ with the CopA ATPase were very similar,
while the dissociation rate of Cu(I)CopZ was increased
14-fold compared to that of CopZ.
It was observed that copper( I)-acetonitrile in excess
of 2 lM enhanced the dissociation of CopY from the
DNA about five-fold. In the presence of 10 lM copper,
the maximal dissociation rate of 5·10
-5
s
-1
was reached.
Unfortunately, a dissociation constant for copper(I)-
acetonitrile is not available. It is thus not possible to
estimate the influence of the free copper concentration
on the measured binding kinetics. For the copper-
responsive activator of E. coli, CueR, the free copper
concentration to which it responded to was estimated to
be in the zeptomolar range (10
-21
M [24]). This activator
turns on copper homeostatic genes in response to cop-
per, but the mechanism of this regulation does not
resemble that of CopY of E. hirae [19, 20].
To determine the free ambient copper concentration
to which the CopY repressor responds in vivo and to
assess the validity of our in vitro Biacore data for the in
vivo situation, a lux reporte r system containing the
E. hirae cop promoter and the genes for CopY and CopZ
was used to determine the copper concentration required
for induction of the cop operon. These experiments were
carried out with an E. coli host deficient in CopA, the
major and possibly only extrusion system for cytoplas-
mic copper [13, 18]. In LB media, half-maximal induc-
tion was observed in 1 mM copper. When the same
measurement was performed in 0.9% NaCl, 1% glucose,
this value shifted to 5 lM copper. This shift is due to
copper-binding substances in LB medium which
strongly chelate free copper. Copper binding by the salt
media per se should be insignificant, but there could still
be binding of copper to the cell envelope and other
cellular constituents. We tried to avoid this as far as
possible by working with dilute cell suspensions. At the
cell concentrations used, further dilution of the cells did
not measurably change the half-maximal induction level
of 5 lM copper, suggesting that this is the relevant
ambient copper concentration to activate transcription
of the cop operon of E. hirae.
Acknowledgment We thank Kristian Raaby Poulsen and Thomas
Weber for valuable experimental help and Christopher Rensing for
providing the E. coli CopA-knockout strain DW3110. This work
was supported by grant 31-68075.02 from the Swiss National
Foundation, and by the International Copper Association (M.S.)
and the Deutsche Forschungsgemeinschaft DFG (G.M.).
References
1. Odermatt A, Suter H, Krapf R, Solioz M (1992) Ann NY Acad
Sci 671:484–486
2. Odermatt A, Suter H, Krapf R, Solioz M (1993) J Biol Chem
268:12775–12779
3. Odermatt A, Solioz M (1995) J Biol Chem 270:4349–4354
4. Solioz M, Vulpe C (1996) Trends Biochem Sci 21:237–241
5. Cobine P, Wickramasinghe WA, Harrison MD, Weber T, So-
lioz M, Dameron CT (1999) FEBS Lett 445:27–30
6. Strausak D, Solioz M (1997) J Biol Chem 272:8932–8936
7. Wunderli-Ye H, Solioz M (1999) Biochem Biophys Res Com-
mun 259:443–449
8. Himeno T, Imanaka T, Aiba S (1986) J Bacteriol 168:1128–
1132
9. Wittman V, Wong HC (1988) J Bacteriol 170:3206–3212
10. Cobine PA, George GN, Jones CE, Wickramasinghe WA,
Solioz M, Dameron CT (2002) Biochemistry 41:5822–5829
11. Wimmer R, Herrmann T, Solioz M, Wu
¨
thrich K (1999) J Biol
Chem 274:22597–22603
12. Rosenzweig AC (2001) Acc Chem Res 34:119–128
13. Rensing C, Fan B, Sharma R, Mitra B, Rosen BP (2000) Proc
Natl Acad Sci USA 97:652–656
14. Hemmerich P, Sigwart C (1963) Experientia 19:488–489
15. Solioz M, Waser M (1990) Biochimie 72:279–283
16. Rogowsky PM, Close TJ, Chimera JA, Shaw JJ, Kado CI
(1987) J Bacteriol 169:5101–5112
17. Stoyanov JV, Magnani D, Solioz M (2003) FEBS Lett 546:391–
394
18. Franke S, Grass G, Rensing C, Nies DH (2003) J Bacteriol
185:3804–3812
19. Stoyanov JV, Hobman JL, Brown NL (2001) Mol Microbiol
39:502–512
20. Outten FW, Outten CE, Hale J, O’Halloran TV (2000) J Biol
Chem 275:31024–31029
21. Engohang-Ndong J, Baillat D, Aumercier M, Bellefontaine F,
Besra GS, Locht C, Baulard AR (2004) Mol Microbiol 51:175–
188
22. Chan AY, Lim BL (2003) J Mol Biol 333:21–31
23. Multhaup G, Strausak D, Bissig K-D, Solioz M (2001) Bio-
chem Biophys Res Commun 288:172–177
24. Changela A, Chen K, Xue Y, Holschen J, Outten CE,
O’Halloran TV, Mondragon A (2003) Science 301:1383–1387
402
Page 7
  • Source
    • "In this scenario, the decreased growth phenotype observed in bacteria lacking CopA could be due to reduced copper availability to the cuproproteins of the periplasm. The presence in E. hirae of a soluble copper-chaperone CopZ and a copper-dependent transcription factor CopY [12,13] may also indicate that CopA is a component of a regulatory network that provides copper to the regulator molecules in a biologically available form. "
    [Show abstract] [Hide abstract] ABSTRACT: Copper is an essential nutrient for most life forms, however in excess it can be harmful. The ATP-driven copper pumps (Copper-ATPases) play critical role in living organisms by maintaining appropriate copper levels in cells and tissues. These evolutionary conserved polytopic membrane proteins are present in all phyla from simplest life forms (bacteria) to highly evolved eukaryotes (Homo sapiens). The presumed early function in metal detoxification remains the main function of Copper-ATPases in prokaryotic kingdom. In eukaryotes, in addition to removing excess copper from the cell, Copper-ATPases have another equally important function - to supply copper to copper dependent enzymes within the secretory pathway. This review focuses on the origin and diversification of Copper ATPases in eukaryotic organisms. From a single Copper ATPase in protozoans, a divergence into two functionally distinct ATPases is observed with the evolutionary appearance of chordates. Among the key functional domains of Copper-ATPases, the metal-binding N-terminal domain could be responsible for functional diversification of the copper ATPases during the course of evolution.
    Full-text · Article · Apr 2012 · Current Genomics
  • Source
    • "The procedure described by Portmann and coworkers [7] was used to isolate Zn(II)-CopY. Although a homogeneous protein preparation is ensured by the inclusion of a size-exclusion chromatography step, precautions need to be taken to minimize aggregation stemming from random crosslinking of the four cysteine residues within the monomer or between monomers. "
    [Show abstract] [Hide abstract] ABSTRACT: Metal binding to the C-terminal region of the copper-responsive repressor protein CopY is responsible for homodimerization and the regulation of the copper homeostasis pathway in Enterococcus hirae. Specific involvement of the 38 C-terminal residues of CopY in dimerization is indicated by zonal and frontal (large zone) size-exclusion chromatography studies. The studies demonstrate that the attachment of these CopY residues to the immunoglobulin-binding domain of streptococcal protein G (GB1) promotes dimerization of the monomeric protein. Although sensitivity of dimerization to removal of metal from the fusion protein is smaller than that found for CopY (as measured by ultracentrifugation studies), the demonstration that an unrelated protein (GB1) can be induced to dimerize by extending its sequence with the C-terminal portion of CopY confirms the involvement of this region in CopY homodimerization.
    Full-text · Article · Feb 2011 · Biochemical and Biophysical Research Communications
  • Source
    • "From the slope and the intercept, the following kinetic parameters were derived: k a = (1.1 AE 0.2) Â 10 4 M À1 s À1 and k d = (8 AE 1) Â 10 À2 s À1 . The resultant K D for the CopZ–Gls24 interaction was (7.5 AE 0.4) Â 10 À6 M. Thus, CopZ interacted more strongly with Gls24 than with the CopY repressor or the CopA copper ATPase (Multhaup et al., 2001; Portmann et al., 2004). To rule out a nonspecific, ionic interaction between Gls24 (pI = 4.45) and CopZ (pI = 8.52), lysozyme (pI = 9.23) was included as a control. "
    [Show abstract] [Hide abstract] ABSTRACT: Intracellular copper routing in Enterococcus hirae is accomplished by the CopZ copper chaperone. Under copper stress, CopZ donates Cu(+) to the CopY repressor, thereby releasing its bound zinc and abolishing repressor-DNA interaction. This in turn induces the expression of the cop operon, which encodes CopY and CopZ, in addition to two copper ATPases, CopA and CopB. To gain further insight into the function of CopZ, the yeast two-hybrid system was used to screen for proteins interacting with the copper chaperone. This led to the identification of Gls24, a member of a family of stress response proteins. Gls24 is part of an operon containing eight genes. The operon was induced by a range of stress conditions, but most notably by copper. Gls24 was overexpressed and purified, and was shown by surface plasmon resonance analysis to also interact with CopZ in vitro. Circular dichroism measurements revealed that Gls24 is partially unstructured. The current findings establish a novel link between Gls24 and copper homeostasis.
    Full-text · Article · Oct 2009 · FEMS Microbiology Letters
Show more