Stress Induction and Mitochondrial Localization of Oxr1 Proteins in Yeast and Humans

ArticleinMolecular and Cellular Biology 24(8):3180-7 · May 2004with17 Reads
Impact Factor: 4.78 · DOI: 10.1128/MCB.24.8.3180-3187.2004 · Source: PubMed
Abstract

Reactive oxygen species (ROS) are critical molecules produced as a consequence of aerobic respiration. It is essential for cells to control the production and activity of such molecules in order to protect the genome and regulate cellular processes such as stress response and apoptosis. Mitochondria are the major source of ROS within the cell, and as a result, numerous proteins have evolved to prevent or repair oxidative damage in this organelle. The recently discovered OXR1 gene family represents a set of conserved eukaryotic genes. Previous studies of the yeast OXR1 gene indicate that it functions to protect cells from oxidative damage. In this report, we show that human and yeast OXR1 genes are induced by heat and oxidative stress and that their proteins localize to the mitochondria and function to protect against oxidative damage. We also demonstrate that mitochondrial localization is required for Oxr1 protein to prevent oxidative damage.

Full-text

Available from: Michael R Volkert
MOLECULAR AND CELLULAR BIOLOGY, Apr. 2004, p. 3180–3187 Vol. 24, No. 8
0270-7306/04/$08.000 DOI: 10.1128/MCB.24.8.3180–3187.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Stress Induction and Mitochondrial Localization of Oxr1 Proteins in
Yeast and Humans
Nathan A. Elliott and Michael R. Volkert*
Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School,
Worcester, Massachusetts 01655
Received 31 October 2003/Returned for modification 1 December 2003/Accepted 26 January 2004
Reactive oxygen species (ROS) are critical molecules produced as a consequence of aerobic respiration. It
is essential for cells to control the production and activity of such molecules in order to protect the genome
and regulate cellular processes such as stress response and apoptosis. Mitochondria are the major source
of ROS within the cell, and as a result, numerous proteins have evolved to prevent or repair oxidative
damage in this organelle. The recently discovered OXR1 gene family represents a set of conserved
eukaryotic genes. Previous studies of the yeast OXR1 gene indicate that it functions to protect cells from
oxidative damage. In this report, we show that human and yeast OXR1 genes are induced by heat and
oxidative stress and that their proteins localize to the mitochondria and function to protect against
oxidative damage. We also demonstrate that mitochondrial localization is required for Oxr1 protein to
prevent oxidative damage.
It is critical for the aerobically respiring cell to defend
against oxidative damage to cellular macromolecules in order
to carry out metabolic activities and faithfully maintain the
genome. Recently, much research has focused on the impor-
tance of reactive oxygen species (ROS) in various cellular
processes, including DNA damage and repair (10), redox reg-
ulation of protein activity (18, 24), signal transduction (5, 11),
ageing (30), and apoptosis (15, 21, 31).
There are numerous sources of ROS. Chemical agents such
as menadione and paraquat produce mainly superoxide radi-
cals (9), while hydrogen peroxide can be converted to the
hydroxyl radical by the Fenton reaction (23). Ionizing radiation
such as X rays and gamma rays damages cells primarily
through reactive oxygen intermediates formed by electrolysis
of water (4). However, the major source of ROS within the cell
is the mitochondria (26). Electron transport activities occur-
ring at the inner membrane of mitochondria have been shown
to produce ROS at significant levels; as much as 1 to 5% of the
O
2
consumed by respiring cells is converted to ROS (7). As a
result, cells express numerous antioxidant defenses that pro-
tect mitochondria, including Mn SOD, thioredoxins, glutathi-
one, and DNA repair enzymes (2, 29, 39, 41). Recent investi-
gations have also highlighted a role for antioxidant activity in
the regulation of the mitochondrial apoptosis pathway. Inhibi-
tion of the electron transport chain, resulting in increased ROS
production, has been shown to result in increased apoptosis
(25, 40). Conversely, mutations in mitochondrial antioxidant
functions (Trx-2, Mn SOD) have also been demonstrated to
increase apoptosis through the mitochondrion-dependent
pathway (32, 43). The important relationship between oxida-
tive damage prevention and disease is illustrated by mice de-
ficient in the mitochondrial apoptosis-inducing factor, which
display increased oxidative stress and cell death in neuronal
cells (22). It is becoming increasingly apparent that identifica-
tion and characterization of ROS-regulating proteins in the
mitochondria will be crucial in understanding how cells avoid
oxidative injury and control apoptosis.
Recently we have identified a novel human gene, OXR1,on
the basis of its ability to suppress oxidative DNA damage in
Escherichia coli (42). OXR1 is an evolutionarily conserved
gene, as homologues are present in many eukaryotic organ-
isms from yeast to humans. To date, there is little known
about its function. Deletion of the OXR1 gene in Saccharo-
myces cerevisiae (scOXR1) results in sensitivity to hydrogen
peroxide damage (42). This suggests that the OXR1 gene
product may play a particularly important and unique role,
as many other mutations in individual genes that prevent or
repair oxidative damage do not result in oxidation sensitivity
phenotypes (3, 20). Drosophila melanogaster expresses seven
isoforms of OXR1 (L82A to -G), and a mutant with the
entire locus deleted is lethal as a result of a defect in eclo-
sion (hatching from the pupal case) (37). The mouse homo-
logue of OXR1, C7, was identified in a screen for genes
induced upon cell attachment to extracellular matrix (14).
The eukaryotic OXR1 genes encode proteins of various
sizes, although they all contain a conserved 300-amino-
acid C-terminal domain. As this domain corresponds to the
entire S. cerevisiae Oxr1 protein, it likely represents a unique
functional domain and possesses the proposed oxidation
protection function of the scOxr1 and human Oxr1 (hOxr1)
proteins.
In this report, we further characterize the expression of the
scOXR1 and hOXR1 genes, as well as the cellular localization
of their respective proteins. We provide evidence that the
scOXR1 and hOXR1 genes exhibit a stress response in both
yeast and human cells. We also present the first evidence that
the hOxr1 protein provides protection from oxidative damage
in a eukaryotic cell.
* Corresponding author. Mailing address: Department of Molecular
Genetics and Microbiology, University of Massachusetts Medical
School, 55 Lake Ave., North, Worcester, MA 01655. Phone: (508)
856-2314. Fax: (508) 856-5920. E-mail: michael.volkert@umassmed
.edu.
3180
Page 1
MATERIALS AND METHODS
Yeast strains, plasmids, and media. S. cerevisiae strain N1-4 (42) was used for
wild-type controls. Strains N74 and N76 (containing plasmids pMV656 and
pMV657, respectively) were derived from oxr1::URA3 strain N1-9 (see Table
1). The mitochondrial targeting sequence (MTS) of SOD2 was fused to hOXR1
by PCR with the primer 5 AAGGATCCATGTTCGCGAAAACAGCAGCTG
CTAATTTAACCAAGAAGGGTGGTTTGTCATTGCTCTCCCAAAGGGA
AAATATTCAAC 3. The product was inserted into the expression vector
pMV611 to generate pMV656. pMV657 was constructed in the same way, except
that the upstream hOXR1 primer lacked the SOD2 MTS sequence. Strains N34
and N39 were derived from strain N1-4 by integration into the OXR1 locus of a
PCR product containing a C-terminal green uorescent protein (GFP) or hem-
agglutinin (HA) tag fused to the 3 end of the OXR1 open reading frame and
anked by 40 bp of chromosomal sequence upstream and downstream of the
OXR1 open reading frame, in accordance with published procedures (28). Cor-
rect integration into the chromosome was conrmed by PCR analysis with a
internal primer corresponding to OXR1 and an external primer corresponding to
the selectable kanamycin resistance marker. Also, strains were tested phenotyp-
ically for wild-type sensitivity to hydrogen peroxide to conrm OXR1 function.
The plasmid template for the HA tag was a gift from M. Longtine (Oklahoma
State University, Stillwater). Yeast peptone dextrose and synthetic minimal dex-
trose media were prepared as described by Adams et al. (1).
Cell lines and culture. HeLa cells were cultured in Dulbeccos modied eagle
medium (GIBCO BRL) supplemented with 10% fetal bovine serum (Sigma), 1
mg of
L-glutamine (Gibco) per ml and penicillin-streptomycin (Gibco) at 37°Cin
a5%CO
2
incubator.
Immunofluorescence microscopy. Yeast immunouorescence microscopy was
carried out as previously described (1), with mouse anti-HA monoclonal anti-
body 16B12 (Covance) at a 1:1,000 dilution and secondary anti-mouse Alexa-
Fluor 568 antibody (Molecular Probes) at a 1:500 dilution. For HeLa cell im-
munouorescence microscopy, cells grown on 12-mm-diameter poly-
D-lysine-
coated glass coverslips (Becton Dickinson) were washed ve times in phosphate-
buffered saline (PBS), xed in 2.5% paraformaldehyde, washed once in PBS, and
permeabilized with 0.1% Triton X-100. Cells were incubated with a 1:200 dilu-
tion of either rabbit anti-C7C (0.78-mg/ml stock) or anti-C7 M (0.25-mg/ml
stock) antibodies, which were gifts from E. Engvall (Burnham Institute, La Jolla,
Calif.). Antibodies were produced and afnity puried with the C7C or C7M
domain peptides as described by Fischer et al. (14). Cells were then washed three
times in PBS and incubated with anti-rabbit AlexaFluor 488 secondary antibody
(Molecular Probes) at a 1:200 dilution, followed by visualization by uorescence
microscopy. For mitochondrial labeling, cells were incubated with 100 nM Mi-
toTracker Red (Molecular Probes) for 15 min prior to xation.
Protein extracts and immunoblotting. Yeast and HeLa cells were pelleted,
washed once in PBS, resuspended in sodium dodecyl sulfate (SDS) protein
loading buffer, and immediately boiled for 10 min. Proteins were then separated
by SDS-polyacrylamide gel electrophoresis and immunoblotted with mouse an-
ti-HA monoclonal antibody 16B12 (Covance) and a horseradish peroxidase
(HRP)-conjugated anti-mouse secondary antibody (Amersham Life Science).
Where shown, mouse anti--tubulin antibody (Lab Vision) was used to probe
blots as a loading control.
RNA isolation and Northern blotting. Total yeast RNA was extracted by the
acid phenol method as described by Sambrook et al. (36). Approximately 20 g
of total RNA per sample was separated on a 1% formaldehyde gel and trans-
ferred to a nylon membrane (Hybond) by capillary transfer. PCR products of the
scOXR1 open reading frame or the SCR1 open reading frame were used as
templates in random primed labeling reactions to generate
32
P-labeled probes.
Hybridization was carried out at 42°C overnight. Band intensities were scanned
on a Personal Densitometer SI (Molecular Dynamics) and quantied with Mo-
lecular Analyst software (Bio-Rad).
RESULTS
Mitochondrial localization of scOxr1 protein. Sequence
analysis of the scOXR1 open reading frame revealed a putative
mitochondrial localization signal at the N terminus of the pro-
tein (PSORTII; http://psort.nibb.ac.jp). We therefore sought
to conrm this prediction by the use of a uorescently tagged
scOxr1 protein. The GFP open reading frame was fused in
frame with the 3 end of the OXR1 gene, and this fusion
construct was integrated by homologous recombination, re-
placing the endogenous OXR1 gene on chromosome XVI. This
allows expression of an Oxr1-GFP fusion protein from the
endogenous OXR1 promoter in the normal OXR1 chromo-
somal context. Figure 1 shows the localization of Oxr1-GFP to
discrete cytoplasmic compartments which correspond with the
extranuclear 4,6-diamidino-2-phenylindole (DAPI)-stained
regions (compare panels A and B), indicating that Oxr1-GFP
and mitochondrial DNA reside in the same compartment. To
further support this, yeast cells were stained with the mito-
chondrion-specic probe MitoTracker (Molecular Probes). As
shown in Fig. 1C, the regions stained with MitoTracker clearly
overlap those identied by Oxr1-GFP uorescence. Very little,
if any, protein is associated with the nucleus (large, DAPI-
stained region), indicating that scOxr1 protein resides almost
exclusively in the mitochondria.
We also conrmed the localization of Oxr1 protein by the
use of an epitope-tagged Oxr1 protein and immunouores-
cence techniques. A C-terminally HA-tagged form of Oxr1
protein was generated and expressed from the endogenous
OXR1 locus, as was done for Oxr1-GFP. Immunouorescence
was then performed to determine the localization of the HA-
TABLE 1. Yeast strains and plasmids used in this study
Strain
Genotype or
strain/plasmid
Reference
N1-4 381G 42
N1-9 N1-4 oxr1::URA3 42
N34 N1-4 OXR1-GFP This study
N39 N1-4 OXR1-HA This study
N70 N1-4/pMV611 This study
N71 N1-9/pMV611 This study
N74 N1-9/pmt-hOXR1-myc This study
N76 N1-9/phOXR1-myc This study
FIG. 1. Localization of scOxr1 protein in yeast. Fluorescence mi-
croscopy was carried out on strain N34 expressing C-terminally GFP-
tagged Oxr1 protein. Cells were preloaded with 100 M MitoTracker
Green probe for 30 min prior to collection and mounting in DAPI-
containing mounting buffer. Panels: A, DAPI-stained cells; B, Mito-
Tracker; C, Oxr1p-GFP. Immunouorescence microscopy of strain
N-39 expressing Oxr1p-HA was conducted. Panels: D, DAPI; E, an-
ti-HA immunostaining.
V
OL. 24, 2004 Oxr1 STRESS INDUCTION AND MITOCHONDRIAL LOCALIZATION 3181
Page 2
tagged protein. Figure 1D and E show the colocalization of
mitochondrial DNA and the Oxr1-HA protein. These results
are in agreement with the Oxr1-GFP studies and strongly sug-
gest that scOxr1 protein is associated with the yeast mitochon-
dria.
Expression of scOXR1 is induced by heat and oxidative
stress. Global transcription proling experiments with yeast
have demonstrated that OXR1 is one of a subset of genes
induced by stress conditions, particularly those conditions as-
sociated with an increase in oxidative stress (6, 17). To conrm
that OXR1 expression is stress inducible, we subjected yeast
cells to both heat and oxidative stress conditions, and the levels
of OXR1 transcripts were monitored by Northern blotting.
Figure 2A shows the results of a Northern blot assay of total
yeast RNA from untreated cells and from those subjected to
heat stress at 37°C. The OXR1 transcript levels increased
within the rst 15 min of treatment and returned to unstressed
levels by 45 min. These data closely resemble those obtained
with a probe to the classical yeast heat shock gene HSP12 (data
not shown) (35). The heat stress-inducible expression of OXR1
is also apparent at the translational level. As shown in Fig. 2B,
heat stress causes accumulation of the Oxr1-HA protein, as
determined by immunouorescence immunomicros copy.
These results suggest that expression of OXR1 is regulated at
least in part by growth temperature. We also asked if OXR1
expression could be induced by oxidative stress. Figure 2A
shows the effect of exposure to 0.5 mM H
2
O
2
on the OXR1
transcript level as monitored by Northern blotting. As with
heat stress, there was a rapid increase in the OXR1 transcript
level during the rst 15 min of treatment, although transcript
levels remained elevated throughout the time course of the
experiment. Together with the heat stress data and previously
published microarray data, these results strongly suggest that
OXR1 is a stress-induced gene in S. cerevisiae.
The hOxr1 protein is localized to mitochondria in human
cells. Previous work with the mouse homolog of hOxr1, C7, has
generated antibodies to two domains of the C7 protein. An
antibody to domain II of C7 was used to demonstrate nucleolar
localization of C7 in several rodent cell lines (14). A second
antibody specic for the C-terminal domain (domain III) of C7
and called C7C was also generated. This domain is highly
homologous to the corresponding region of the hOxr1 protein
(90% identity) and is also homologous to scOxr1 protein.
(We reasoned that mouse antibody C7C would provide a use-
ful tool for examining the localization of the hOxr1 protein in
the human HeLa cell line, since it recognizes hOxr1 expressed
in bacteria [data not shown].) We conducted immunouores-
cence experiments with HeLa cells and the C7C antibody, and
as shown in Fig. 3, the hOxr1 protein is localized to a specic
cytoplasmic compartment, enriched around the nuclear pe-
riphery, and also found in long, tubular projections extending
from the perinuclear region to the tips of the adherent cell.
The observed staining is strikingly similar to that of the mito-
chondria in HeLa cells (8). We therefore stained the cells with
MitoTracker prior to immunouorescence microscopy in order
to establish colocalization. Figure 3 clearly shows that Mito-
Tracker stains the same cellular compartment as the Oxr1
antibody, indicating that in HeLa cells, hOxr1 is associated
with the mitochondria. As is the case in yeast, little if any Oxr1
protein is detected in the nucleus. Similar localization results
were obtained in experiments with two additional mammalian
cell lines, human Hep2 cells and monkey COS cells (data not
shown).
hOxr1 protein is induced by heat and oxidative stress in
HeLa cells. Given the similarities between scOxr1 and hOxr1
in terms of protein homology and localization, we asked if
hOXR1 expression is also induced by stress conditions in hu-
man cells. First, we subjected HeLa cells toa1mMdose of
H
2
O
2
for 15 min and allowed 1 h for recovery in fresh growth
FIG. 2. Heat and oxidative stress induction of scOXR1. (A) Yeast
cells were grown at 22°C to log phase and shifted to 37°C for the times
shown (left). Alternatively, cells were grown at 30°C and treated with
0.5 mM H
2
O
2
for the times indicated (right). At each time point, cells
were harvested and total RNA was analyzed by Northern blotting.
Fold induction values are given for each time point relative to the
zero-time control. (B) Yeast cells were grown at 22°C to log phase and
incubation was continued at 22°C, or cells were shifted to 37°C and
incubation was continued for 1 h. Cells were then xed and stained
with anti-HA antibody to visualize Oxr1p-HA. Left side, DAPI stain-
ing; right side, anti-HA staining.
3182 ELLIOTT AND VOLKERT M
OL.CELL.BIOL.
Page 3
medium. hOxr1 protein was then visualized by immunouo-
rescence microscopy, as shown in Fig. 4A. The staining of Oxr1
protein is more intense in peroxide-treated cells than in un-
treated cells, and the protein accumulation appears to be lo-
calized primarily to the mitochondria, with some diffuse stain-
ing in the cytoplasm (compare Oxr1 staining with MitoTracker
staining). There is no visible difference in the intensity of
MitoTracker staining between peroxide-treated and untreated
cells, indicating that the difference seen in Oxr1 staining is due
to protein levels and not mitochondrial content. To support
the immunouorescence microscopy results, we also moni-
tored hOxr1 protein levels during stress by Western blotting
(Fig. 4B). In unstressed HeLa cells, the C7C antibody recog-
nizes a 37.5-kDa protein, which is consistent with the predicted
size (41.6 kDa) of the hOXR1 gene product originally isolated
(42). Following 1 mM H
2
O
2
treatment, Oxr1 protein accumu
-
lated within the rst hour after treatment, and by 4 h the level
of protein reached a maximum and began to decrease by 5 h.
We also observed the accumulation of a higher-molecular-
weight protein recognized by the C7C antibody at 58.8 kDa,
which presumably reects a larger splice variant that includes
additional upstream exons detected by DNA sequence analysis
of chromosome 8. We also asked if heat stress induces expres-
sion of hOxr1 protein, as it does for scOxr1 protein. Figure 4C
shows a Western blot of HeLa cells extracts following 30 min
of heat stress at 42°C. hOxr1 protein accumulates in a manner
very similar to that in peroxide-treated cells, with a maximum
level occurring by 2.5 h and reduction apparent by the 4.5-h
mark. The immunouorescence results of peroxide-treated
HeLa cells, together with the Western blots of peroxide- and
heat-treated cells, indicate that hOxr1 protein expression is
induced by heat and oxidative stress in human cells.
Multiple transcripts of hOXR1 are expressed in a tissue-
specic manner. To further characterize hOXR1 expression,
we determined the abundance of hOXR1 message in multiple
human tissues by Northern blotting. A blot of poly(A)
RNA
from several human tissues was hybridized with a hOXR1
cDNA probe corresponding to the entire C-terminal OXR1
homology domain, and the results are shown in Fig. 5. Two
transcripts, 2.9 and 4.9 kb, are observed in nearly all of the
tissues, with the exception of brain tissue, which expresses a
unique 5.1-kb transcript in addition to the 2.9-kb transcript.
Also, the relative abundances of the transcripts differ in the
tissues examined, with the 4.9-kb transcript being most abun-
dant in placenta, lung, liver, kidney, and pancreas tissues. In
heart and skeletal muscle tissues, the smaller transcript ap-
pears to be as abundant as the 4.9-kb transcript. From this
nding, we conclude that hOXR1 is expressed as two tran-
scripts whose relative abundances differ among various human
tissues.
Mitochondrion-targeted hOxr1 can complement the perox-
ide sensitivity of a yeast oxr1 mutant strain. Previous work
has shown that the yeast oxr1 mutant is approximately 10-fold
more sensitive to hydrogen peroxide lethality than is the wild-
type strain (42). In order to determine if the hOxr1 protein is
capable of complementing the peroxide sensitivity of the yeast
oxr1 mutant, we expressed mitochondrion-targeted and un-
targeted hOxr1 proteins in the yeast oxr1 mutant background
and tested resistance to hydrogen peroxide. To target hOxr1
protein to the yeast mitochondria, the MTS from yeast Sod2
FIG. 3. Localization of hOXR1 protein in HeLa cells. HeLa cells were preloaded with 100 M MitoTracker Red probe, xed, and immuno-
stained with rabbit anti-C7C antibody and anti-rabbit AlexFluor 488 secondary antibody. Panels: A, anti-C7C staining; B, MitoTracker; C, merged
images of panels A and B.
V
OL. 24, 2004 Oxr1 STRESS INDUCTION AND MITOCHONDRIAL LOCALIZATION 3183
Page 4
protein was fused to the N terminus of the hOxr1 protein. This
targeting signal has been used previously to direct ectopically
expressed proteins into the yeast mitochondria (13). The pro-
tein was tagged at its C terminus with the 13-Myc epitope tag
for detection by immunouorescence microscopy and Western
blotting. The untargeted hOxr1-myc protein lacked the Sod2
protein MTS. Figure 6A shows the hydrogen peroxide survival
curves of the wild-type, oxr1, and oxr1 strains expressing
either the mitochondrion-targeted hOXR1 (mt-hOxr1-myc) or
the untargeted hOxr1 (phOxr1-myc) gene from the constitutive
GPD (glyceraldehyde-phosphate dehydrogenase) promoter.
The mt-hOxr1-myc-expressing strain shows wild-type resis-
tance to hydrogen peroxide, while the untargeted hOxr1-myc-
expressing strain is as sensitive as the oxr1 mutant strain.
Even though the untargeted hOxr1-myc protein is more highly
expressed than the mt-hOxr1-myc protein (Fig. 6B), it does not
confer peroxide resistance on the strain in which it is ex-
pressed, indicating that mitochondrial localization is required
for protection from oxidation by Oxr1 protein. We also con-
rmed the mitochondrial localization of the mt-hOxr1-myc
protein by immunouorescence microscopy as shown in Fig.
6C. The anti-myc antibody staining colocalizes with the Mito-
Tracker probe. In contrast, the untargeted hOxr1-myc protein
displays a more diffuse staining pattern, with a signicant
amount of signal present in the nucleus and little colocalization
with MitoTracker. These results indicate that hOxr1 can func-
tionally complement the hydrogen peroxide sensitivity of a
yeast oxr1 mutant strain and that mitochondrial localization is
a requirement for function.
DISCUSSION
The recently discovered hOXR1 gene represents a family of
well-conserved eukaryotic genes whose function is proposed to
include resistance to oxidative damage (42). In this report, we
demonstrate that the regulation of gene expression, protein
localization, and function of Oxr1 is also conserved from yeast
to humans.
Numerous proteins are localized to the mitochondria to
counteract the deleterious effects of ROS, including glutathi-
one peroxidase, thioredoxin, SOD, and multiple DNA repair
enzymes (2, 29, 39, 41). Despite the seeming overabundance of
these oxidative damage resistance functions, the yeast oxr1
mutant remains sensitive to oxidative damage, indicating an
important role for this gene in protecting cells from oxidative
damage (42). Consistent with this idea are the results of several
microarray experiments addressing stress-induced gene expres-
sion in yeast. The scOXR1 gene has been shown to be induced
under conditions of heat stress, stationary phase, and diauxic
shift (6, 17). Interestingly, these same conditions have been
reported to result in signicant increases in ROS within the cell
(12, 19, 27). Our ndings corroborate the microarray data and
FIG. 4. (A) H
2
O
2
-induced accumulation of hOxr1 protein in HeLa
cells. Cells were loaded with 100 M MitoTracker Red for 15 min and
then treated with 1 mM H
2
O
2
for 15 min or left untreated and allowed
to recover in fresh medium for 1 h prior to xation and staining with
anti-C7C antibody. (B) HeLa cells were treated with 1 mM H
2
O
2
for
15 min and allowed to recover in fresh medium for the times indicated.
Cells were harvested, and crude protein extracts were separated by
SDS-polyacrylamide gel electrophoresis and immunoblotted with anti-
C7C antibody. Samples were also stained with Coomassie as a loading
control. (C) Cells were heat stressed at 42°C for 30 min and allowed to
recover at 37°C for the times indicated. Western blot assays were
conducted as in panel B. Blots were probed with anti--tubulin anti-
body as a loading control. U, unstressed.
FIG. 5. Multiple-tissue Northern blot assay of hOxr1. A blot of
poly(A)
RNA from several human tissues (Clontech) was probed
with
32
P-labeled hOXR1 cDNA.
3184 ELLIOTT AND VOLKERT M
OL.CELL.BIOL.
Page 5
expand these observations by showing that scOXR1 is part of a
stress response pathway turned on under conditions of ROS
production and provide further evidence that scOxr1 protein
serves to protect yeast cells from oxidative damage. We also
demonstrate that the scOxr1 protein can be functionally re-
placed by its human orthologue containing the Oxr1 homology
domain.
The mouse homologue of hOXR1, C7, was isolated by others
in a screen for genes up regulated upon cell attachment to
extracellular matrix. With the C7M antibody generated to do-
main II of C7, this protein was shown to localize to the nucle-
olus in several rodent cell lines (14). We have used the C7C
antibody produced from this study and shown it to recognize
specically mitochondrial protein in HeLa cells (Fig. 3), as well
as in Hep2 and COS cells. This is consistent with the Western
blot data showing that the C7C antibody recognizes only one
major protein in untreated HeLa cell extracts (Fig. 4B, un-
treated control lane). A second species is detectable after in-
duction by oxidative or heat stress and also appears to be
largely mitochondrial. No nucleolar staining is detectable, even
after stress induction. Our results indicate that, in the cell lines
tested, hOxr1 is associated with the mammalian mitochondria.
That we observed no nucleolar staining with the C7C antibody
suggests either that the nucleolar isoform of Oxr1 lacks the
amino acid sequence recognized by C7C or that the antibody
cannot access such sequences. Recent studies failed to detect
nucleolar staining in human cells (Eva Engvall, personal com-
munication) and are similar to our results with the C7C or
C7M antibodies (Fig. 3 and 4 and data not shown). This sug-
gests that the nucleolar staining in rodent cells is due to a
species difference or is a species-related artifact. Mitochondrial
localization of the Oxr1 homology domain is consistent with
the nding that Oxr1 must be targeted to this cellular com-
partment for the antioxidant function of this domain in yeast.
As is the case with scOXR1, the hOXR1 gene is induced by
stress conditions in human cells. The rst evidence of stress-
induced expression of the hOXR1 gene came from immuno-
uorescence experiments with HeLa cells after hydrogen per-
oxide treatment (Fig. 4A). During a 1-h recovery from
oxidative stress, hOxr1 protein visibly accumulated in the mi-
tochondria. We also saw a more intense signal in the cyto-
plasm, which may be due to leakage of hOxr1 protein from the
mitochondria, incomplete importation of all of the protein into
the mitochondria, or the expression of a distinct cytoplasmic
isoform of hOxr1. The latter possibility is consistent with the
Western blot results showing the appearance of multiple Oxr1
bands following peroxide treatment (Fig. 4B). This Western
blot nding also conrms the oxidative stress-induced accumu-
lation of the 37.5-kDa hOxr1 protein. As in yeast, heat stress
has been shown to lead to increased ROS and induction of
antioxidant functions in mammalian cells (38). We have shown
that heat stress induces expression of hOxr1 protein in a man-
ner very similar to that of oxidative stress (Fig. 4C). Although
the induction of mitochondrial heat shock proteins by heat and
oxidative stress is well known (16), there is little evidence of
mitochondrial proteins outside of this well-conserved protein
family induced by both heat and oxidative stress. Also, the
most well-characterized mitochondrial heat shock proteins are
chaperonins (33), and it is unclear what, if any, antioxidant
activity they possess. hOxr1 may therefore represent one of a
small set of proteins that are responsive to multiple stress
conditions and provide protection against ROS in human mi-
tochondria. In this respect, it is interesting that hOXR1 mRNA
FIG. 6. Mitochondrion-targeted hOxr1 protein complements the
peroxide sensitivity of an oxr1::URA3 mutant S. cerevisiae strain. (A)
Yeast strains were grown to an optical density at 600 nm of 0.6 and
treated with the indicated doses of H
2
O
2
, and dilutions were plated on
synthetic minimal dextrose medium plates without leucine. Colonies
were counted after 3 days of growth at 30°C. Strains bearing plasmids
expressing either the mitochondrion-targeted (pmt-hOXR1-myc) or
the untargeted (phOXR1-myc) form of hOXR1 are compared with
wild-type (WT) and vector control (oxr1::URA3) strains. The data
shown are representative of three independent experiments. conc.,
concentration. (B) Protein extracts from oxr1::URA3 strains express-
ing myc-tagged hOxr1 protein fused to the MTS (mt-hOXR1-myc) or
untargeted (hOxr1-myc) were immunoblotted with anti-myc monoclo-
nal antibody 9E10. (C) Yeast cells were loaded with 100 M Mito-
Tracker Green probe and immunostained for hOxr1-myc proteins with
anti-myc 9E10 antibody and AlexaFluor 568 secondary antibody. Cells
expressing targeted and untargeted hOxr1 proteins are labeled as in
panel B.
V
OL. 24, 2004 Oxr1 STRESS INDUCTION AND MITOCHONDRIAL LOCALIZATION 3185
Page 6
appears to be abundant in tissues with a relatively high respi-
ration capacity (heart, skeletal muscle, brain; Fig. 5), where it
would be advantageous to counteract mitochondrial ROS pro-
duction.
It has been hypothesized that ROS play a role in mediating
cell death in mammalian cells, particularly through the mito-
chondrial apoptosis pathway (15, 21, 31). Conditions that in-
crease the amount of mitochondrial ROS production (for ex-
ample, inhibition of the electron transport chain) lead to
increased apoptosis. Conversely, depletion of mitochondrial
antioxidant functions has also been shown to increase cell
death by apoptosis (22). Regulation of the mitochondrial redox
state has been shown to be important for resistance to oxida-
tive stress in S. cerevisiae, as well as in mammals. Deletion of
the mitochondrial thioredoxin reductase TRR2 in yeast causes
increased sensitivity to hydrogen peroxide (34), while homozy-
gous mutation of mitochondrial thioredoxin (Trx-2) in mice
results in elevated apoptosis and embryonic lethality (32). We
have found that targeting hOxr1 to the yeast mitochondria is
necessary for complementing the hydrogen peroxide sensitivity
of an oxr1 mutant (Fig. 6A). The hOxr1 protein containing an
N-terminal MTS is targeted to the yeast mitochondria (Fig.
6C) and exhibits wild-type resistance to peroxide, particularly
at the highest doses tested. A strain expressing an identical
copy of hOXR1 lacking the MTS is as sensitive to peroxide as
is the oxr1 mutant. These data suggest that the peroxide-
induced lethality seen in yeast is mediated by a mitochondrial
process, and mitochondrial localization of OXR1 function (ei-
ther yeast or human) is required for wild-type resistance to
peroxide damage. Furthermore, these results support the claim
that the hOxr1 and scOxr1 proteins are functionally homolo-
gous. Our ndings suggest that both hOxr1 and scOxr1 may be
part of a mitochondrial stress response. Since hOxr1 is capable
of providing yeast cells protection from oxidative damage when
localized to the mitochondria, it is likely that it plays a similar
role in oxidative stress resistance in human cells as well. It will
be interesting to determine if hOxr1 is involved in the regula-
tion of ROS production or detoxication and protection from
oxidation-mediated apoptosis in human cells.
ACKNOWLEDGMENTS
This work was supported by grant GM56420 from the National
Institutes of Health.
We thank E. Engvall for mouse C7 antibodies and M. Marinus and
E. Engvall for critical reading of the manuscript.
REFERENCES
1. Adams, A., D. E. Gottschling, C. A. Kaiser, and T. Stearns. 1997. Methods
in yeast genetics. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
2. Arner, E. S., and A. Holmgren. 2000. Physiological functions of thioredoxin
and thioredoxin reductase. Eur. J. Biochem. 267:61026109.
3. Avery, A. M., and S. V. Avery. 2001. Saccharomyces cerevisiae expresses
three phospholipid hydroperoxide glutathione peroxidases. J. Biol. Chem.
276:3373033735.
4. Breen, A. P., and J. A. Murphy. 1995. Reactions of oxyl radicals with DNA.
Free Radic. Biol. Med. 18:10331077.
5. Carmody, R. J., and T. G. Cotter. 2001. Signalling apoptosis: a radical
approach. Redox Rep. 6:7790.
6. Causton, H. C., B. Ren, S. S. Koh, C. T. Harbison, E. Kanin, E. G. Jennings,
T. I. Lee, H. L. True, E. S. Lander, and R. A. Young. 2001. Remodeling of
yeast genome expression in response to environmental changes. Mol. Biol.
Cell 12:323337.
7. Chance, B., H. Sies, and A. Boveris. 1979. Hydroperoxide metabolism in
mammalian organs. Physiol. Rev. 59:527605.
8. Collins, T. J., M. J. Berridge, P. Lipp, and M. D. Bootman. 2002. Mitochon-
dria are morphologically and functionally heterogeneous within cells. EMBO
J. 21:16161627.
9. Comporti, M. 1989. Three models of free radical-induced cell injury. Chem.
Biol. Interact. 72:156.
10. Cooke, M. S., M. D. Evans, M. Dizdaroglu, and J. Lunec. 2003. Oxidative
DNA damage: mechanisms, mutation, and disease. FASEB J. 17:11951214.
11. Costa, V., and P. Moradas-Ferreira. 2001. Oxidative stress and signal trans-
duction in Saccharomyces cerevisiae: insights into ageing, apoptosis and
diseases. Mol. Aspects Med. 22:217246.
12. Davidson, J. F., B. Whyte, P. H. Bissinger, and R. H. Schiestl. 1996. Oxida-
tive stress is involved in heat-induced cell death in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA 93:51165121.
13. Dobson, A. W., Y. Xu, M. R. Kelley, S. P. LeDoux, and G. L. Wilson. 2000.
Enhanced mitochondrial DNA repair and cellular survival after oxidative
stress by targeting the human 8-oxoguanine glycosylase repair enzyme to
mitochondria. J. Biol. Chem. 275:3751837523.
14. Fischer, H., X. U. Zhang, K. P. OBrien, P. Kylsten, and E. Engvall. 2001. C7,
a novel nucleolar protein, is the mouse homologue of the Drosophila late
puff product L82 and an isoform of human OXR1. Biochem. Biophys. Res.
Commun. 281:795803.
15. Fleury, C., B. Mignotte, and J. L. Vayssiere. 2002. Mitochondrial reactive
oxygen species in cell death signaling. Biochimie 84:131141.
16. Garrido, C., S. Gurbuxani, L. Ravagnan, and G. Kroemer. 2001. Heat shock
proteins: endogenous modulators of apoptotic cell death. Biochem. Biophys.
Res. Commun. 286:433442.
17. Gasch, A. P., and M. Werner-Washburne. 2002. The genomics of yeast
responses to environmental stress and starvation. Funct. Integr. Genomics
2:181192.
18. Georgiou, G. 2002. How to ip the (redox) switch. Cell 111:607610.
19. Grant, C. M., S. Luikenhuis, A. Beckhouse, M. Soderbergh, and I. W. Dawes.
2000. Differential regulation of glutaredoxin gene expression in response to
stress conditions in the yeast Saccharomyces cerevisiae. Biochim. Biophys.
Acta 1490:3342.
20. Grant, C. M., G. Perrone, and I. W. Dawes. 1998. Glutathione and catalase
provide overlapping defenses for protection against hydrogen peroxide in the
yeast Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 253:893
898.
21. Kim, J. Y., and J. H. Park. 2003. ROS-dependent caspase-9 activation in
hypoxic cell death. FEBS Lett. 549:9498.
22. Klein, J. A., C. M. Longo-Guess, M. P. Rossmann, K. L. Seburn, R. E. Hurd,
W. N. Frankel, R. T. Bronson, and S. L. Ackerman. 2002. The harlequin
mouse mutation downregulates apoptosis-inducing factor. Nature 419:367
374.
23. Koppenol, W. H. 2001. The Haber-Weiss cycle70 years later. Redox Rep.
6:229234.
24. Kuge, S., M. Arita, A. Murayama, K. Maeta, S. Izawa, Y. Inoue, and A.
Nomoto. 2001. Regulation of the yeast Yap1p nuclear export signal is me-
diated by redox signal-induced reversible disulde bond formation. Mol.
Cell. Biol. 21:61396150.
25. Li, N., K. Ragheb, G. Lawler, J. Sturgis, B. Rajwa, J. A. Melendez, and J. P.
Robinson. 2003. Mitochondrial complex I inhibitor rotenone induces apo-
ptosis through enhancing mitochondrial reactive oxygen species production.
J. Biol. Chem. 278:85168525.
26. Liu, Y., G. Fiskum, and D. Schubert. 2002. Generation of reactive oxygen
species by the mitochondrial electron transport chain. J. Neurochem. 80:
780787.
27. Longo, V. D., E. B. Gralla, and J. S. Valentine. 1996. Superoxide dismutase
activity is essential for stationary phase survival in Saccharomyces cerevisiae.
Mitochondrial production of toxic oxygen species in vivo. J. Biol. Chem.
271:1227512280.
28. Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A.
Brachat, P. Philippsen, and J. R. Pringle. 1998. Additional modules for
versatile and economical PCR-based gene deletion and modication in Sac-
charomyces cerevisiae. Yeast 14:953961.
29. Macmillan-Crow, L. A., and D. L. Cruthirds. 2001. Invited review: manga-
nese superoxide dismutase in disease. Free Radic. Res. 34:325336.
30. Melov, S., J. Ravenscroft, S. Malik, M. S. Gill, D. W. Walker, P. E. Clayton,
D. C. Wallace, B. Malfroy, S. R. Doctrow, and G. J. Lithgow. 2000. Extension
of life-span with superoxide dismutase/catalase mimetics. Science 289:1567
1569.
31. Newmeyer, D. D., and S. Ferguson-Miller. 2003. Mitochondria: releasing
power for life and unleashing the machineries of death. Cell 112:481490.
32. Nonn, L., R. R. Williams, R. P. Erickson, and G. Powis. 2003. The absence
of mitochondrial thioredoxin 2 causes massive apoptosis, exencephaly, and
early embryonic lethality in homozygous mice. Mol. Cell. Biol. 23:916922.
33. Parcellier, A., S. Gurbuxani, E. Schmitt, E. Solary, and C. Garrido. 2003.
Heat shock proteins, cellular chaperones that modulate mitochondrial cell
death pathways. Biochem. Biophys. Res. Commun. 304:505512.
34. Pedrajas, J. R., E. Kosmidou, A. Miranda-Vizuete, J. A. Gustafsson, A. P.
Wright, and G. Spyrou. 1999. Identication and functional characterization
of a novel mitochondrial thioredoxin system in Saccharomyces cerevisiae.
J. Biol. Chem. 274:63666373.
3186 ELLIOTT AND VOLKERT MOL.CELL.BIOL.
Page 7
35. Praekelt, U. M., and P. A. Meacock. 1990. HSP12, a new small heat shock
gene of Saccharomyces cerevisiae: analysis of structure, regulation and func-
tion. Mol. Gen. Genet. 223:97106.
36. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
37. Stowers, R. S., S. Russell, and D. Garza. 1999. The 82F late puff contains the
L82 gene, an essential member of a novel gene family. Dev. Biol. 213:116130.
38. Subjeck, J. R., and T. T. Shyy. 1986. Stress protein systems of mammalian
cells. Am. J. Physiol. 250:C1C17.
39. Takao, M., H. Aburatani, K. Kobayashi, and A. Yasui. 1998. Mitochondrial
targeting of human DNA glycosylases for repair of oxidative DNA damage.
Nucleic Acids Res. 26:29172922.
40. Taylor, E. R., F. Hurrell, R. J. Shannon, T. K. Lin, J. Hirst, and M. P.
Murphy. 2003. Reversible glutathionylation of complex I increases mito-
chondrial superoxide formation. J. Biol. Chem. 278:1960319610.
41. Ueda, S., H. Masutani, H. Nakamura, T. Tanaka, M. Ueno, and J. Yodoi.
2002. Redox control of cell death. Antioxid. Redox Signal. 4:405414.
42. Volkert, M. R., N. A. Elliott, and D. E. Housman. 2000. Functional genomics
reveals a family of eukaryotic oxidation protection genes. Proc. Natl. Acad.
Sci. USA 97:1453014535.
43. Zhao, Y., T. D. Oberley, L. Chaiswing, S. M. Lin, C. J. Epstein, T. T. Huang,
and D. St Clair. 2002. Manganese superoxide dismutase deciency enhances
cell turnover via tumor promoter-induced alterations in AP-1 and p53-
mediated pathways in a skin cancer model. Oncogene 21:38363846.
VOL. 24, 2004 Oxr1 STRESS INDUCTION AND MITOCHONDRIAL LOCALIZATION 3187
Page 8
    • "Yeast mutants with an OXR1 deletion exhibit increased sensitivity to H 2 O 2 (Volkert et al., 2000 ). Based on the importance of OXR1 during stress, a GFPencoding gene was integrated into the promoter of OXR1 in S. cerevisiae N34 (Elliott and Volkert, 2004). Consequently, ROS enrichment results in GFP fluorescence due to the activation of OXR1 gene expression, which thus functions as a direct indicator of oxidative stress (Vandenbroucke et al., 2008). "
    [Show abstract] [Hide abstract] ABSTRACT: Abstract Since the last decade, nanodispersed drug delivery systems gain increasingly more importance for therapeutic research fields. The forced transport to the centers of inflammation is supposed to take advantage as a novel strategic approach. Thus, the focus of this study was to investigate the applicability of ubiquinone nanoformulations against oxidative stress. The physiological reduction of reactive oxygen species (ROS) seems to be a promising treatment to point out the potential effects of these sophisticated nano-constructs. Therefore, the yeast strain Saccharomyces cerevisiae N34 was used for in vitro studies as a representative for eukaryotic organisms. Growth parameters during sequential fed batch-cultivation were monitored online using focused beam reflectance measurement (FBRM) method. The ability to control diverse cellular processes makes this yeast strain to a valuable tool for the initial investigation by understanding the fundamental mechanisms of nanoparticulate formulations onto eukaryotic cells. Furthermore, the characteristic stress response of yeast cell culture was examined, so that drug effects could be determined quantitatively. As a chemical stressor, diamide was tested in the range of 1–1000 mg diamide per g cell dry weight (CDW). The ubiquinone nanoformulation demonstrated a total stress reduction of approximately 14% in the yeast culture, confirming the potential applicability of ubiquinone.
    Full-text · Article · Nov 2014 · International Journal of Pharmaceutics
    0Comments 0Citations
    • "The role of OXR1 in preventing oxidative stress-induced cell death has been previously addressed in yeast, mosquito and mice [7] [8] [14] [15]. Expression of truncated human OXR1 in yeast reversed H 2 O 2 sensitivity in yeast oxr1 mutant, suggesting a similar function in human [6]. In this paper, based on the hOXR1 knock-down experiments in several human cell lines, we demonstrated that OXR1 has the same anti-oxidation function in human cells as observed in model organisms. "
    [Show abstract] [Hide abstract] ABSTRACT: The oxidation resistance gene 1 (OXR1) prevents oxidative stress-induced cell death by an unknown pathway. Here, depletion of human OXR1 (hOXR1) sensitized several human cell lines to hydrogen peroxide-induced oxidative stress, reduced mtDNA integrity, and increased apoptosis. In contrast, depletion of hOXR1 in cells lacking mtDNA showed no significant change in ROS or viability, suggesting that OXR1 prevents intracellular hydrogen peroxide-induced increase in oxidative stress levels to avoid a vicious cycle of increased oxidative mtDNA damage and ROS formation. Furthermore, expression of p21 and the antioxidant genes GPX2 and HO-1 was reduced in hOXR1-depleted cells. In sum, these data reveal that human OXR1 upregulates the expression of antioxidant genes via the p21 signaling pathway to suppress hydrogen peroxide-induced oxidative stress and maintain mtDNA integrity.
    Full-text · Article · Sep 2014 · Free Radical Biology and Medicine
    0Comments 5Citations
    • "OXR1 is an oxidation resistant protein. Yeast oxr1 mutant is sensitive to H2O2.(44) Expression of human OXR1 complements the frequency of spontaneous mutations in base excision repair-deficient E. coli.(44) "
    [Show abstract] [Hide abstract] ABSTRACT: Excessive generation of reactive oxygen species within cells results in oxidative stress. Furthermore, accumulation of reactive oxygen species has been shown to reduce cell longevity. Many dietary supplements are believed to have anti-aging effects. The herb mixture KPG-7 contains several components with antioxidant activity. We aim to clarify the mechanisms responsible for the antioxidant activity of KPG-7 and to establish whether KPG-7 has an anti-aging effect. We examined whether dietary supplementation with KPG-7 could provide protection against oxidative stress, extend lifespan, and delay aging in Caenorhabditis elegans (C. elegans). We found that KPG-7 extended lifespan and delayed aging in adult C. elegans. The expression of oxidation resistance 1 protein was induced by juglone and this effect was significantly suppressed in KPG-7-treated. In addition, the amount of oxidized protein was significantly lower in KPG-7-treated worms than untreated worms. Furthermore, locomotive activity was increased in C. elegans at 3 days of age following the treatment with KPG-7. On the other hand, the level of cellular ATP was lower at 3 days of age in worms treated with KPG-7 than in untreated worms. KPG-7 increases lifespan and delays aging in C. elegans, well corresponding to its activity to protect against oxidative stress.
    Full-text · Article · Sep 2013 · Journal of Clinical Biochemistry and Nutrition
    0Comments 7Citations
Show more

Discover cutting-edge research

ResearchGate is where you can find and access the latest publications from your field of research.

Discover more