Article

SYBR Green-Based Real-Time Quantitative PCR Assay for Detection of West Nile Virus Circumvents False-Negative Results Due to Strain Variability

Department of Microbiology and Immunology, The University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73104, USA.
Journal of Clinical Microbiology (Impact Factor: 3.99). 05/2004; 42(4):1511-8. DOI: 10.1128/JCM.42.4.1511-1518.2004
Source: PubMed

ABSTRACT

Real-time quantitative PCR is used routinely for the high-throughput diagnosis of viral pathogens, such as West Nile virus
(WNV). Rapidly evolving RNA viruses present a challenge for diagnosis because they accumulate mutations that may render them
undetectable. To explore the effect of sequence variations on assay performance, we generated every possible single point
mutation within the target region of the widely used TaqMan assay for WNV and found that the TaqMan assay failed to detect
47% of possible single nucleotide variations in the probe-binding site and was unable to detect any targets with more than
two mutations. In response, we developed and validated a less expensive assay with the intercalating dye SYBR green. The SYBR
green-based assay was as sensitive as the TaqMan assay for WNV. Importantly, it detected 100% of possible WNV target region
variants. The assay developed here adds an additional layer of protection to guard against false-negative results that result
from natural variations or drug-directed selection and provides a rapid means to identify such variants for subsequent detailed
analysis.

Download full-text

Full-text

Available from: Wolfgang R Vahrson
    • "Single mismatches were detected in the forward and reverse primers or in the probe hybridization sequences of 12 strains (Table 2). While single mismatches have been described to cause failure in the detection of respiratory syncytial virus (Whiley and Sloots, 2006) and West Nile virus (Papin et al., 2004), it has also been demonstrated that single SNP may not completely prevent amplification, although they may cause inefficient annealing and amplification and underestimation of the copy number (Lefever et al., 2013). In four strains (HE800529, KM115677, KM115678, KM115679) the single mismatch can affect extension since it occurs at three bases from the 3 end of the reverse primer. "
    [Show abstract] [Hide abstract]
    ABSTRACT: A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.
    No preview · Article · Mar 2015 · Journal of virological methods
  • Source
    • "Viral load was determined by RT-qPCR as per our published procedures [51] with primers: WNV Env F: 5′-TCAGCGATCTCTCCACCAAAG-3′; WNV Env R: 5′-GGGTCAGCACGTTTGTCATTG-3′. The following oligo was diluted to generate a standard curve to determine copy number: WNV Env Oligo: TCAGCGATCTCTCCACCAAAGCTGCGTGCCCGACCATGGGAGAAGCTCACAATGACAAACGTGCTGACCC. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The innate immune response to West Nile virus (WNV) infection involves recognition through toll-like receptors (TLRs) and RIG-I-like receptors (RLRs), leading to establishment of an antiviral state. MiRNAs (miRNAs) have been shown to be reliable biomarkers of TLR activation. Here, we sought to evaluate the contribution of TLR3 and miRNAs to the host response to WNV infection. We first analyzed HEK293-NULL and HEK293-TLR3 cells for changes in the innate immune response to infection. The presence of TLR3 did not seem to affect WNV load, infectivity or phosphorylation of IRF3. Analysis of experimentally validated NFκB-responsive genes revealed a WNV-induced signature largely independent of TLR3. Since miRNAs are involved in viral pathogenesis and the innate response to infection, we sought to identify changes in miRNA expression upon infection in the presence or absence of TLR3. MiRNA profiling revealed 70 miRNAs induced following WNV infection in a TLR3-independent manner. Further analysis of predicted gene targets of WNV signature miRNAs revealed genes highly associated with pathways regulating cell death, viral pathogenesis and immune cell trafficking.
    Full-text · Article · Aug 2014 · PLoS ONE
  • Source
    • "The resulting threshold cycle (Ct) is then compared with standard samples or results of reference genes. Both procedures are well accepted for the quantification of specific genes (Papin et al. 2004; Vargas and James 2006). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The production of microcystin toxins by cyanobacteria is an intrapopulation feature and the toxic and nontoxic genotypes can be separated only through molecular analyses targeting the mcy markers. Quantitative real-time PCR (qPCR) is a procedure that has been established, not only to detect but to specifically quantify these genotypes. In the present work, primers were designed for the mcyD region to estimate the number of cyanobacteria that are potential microcystin producers. Laboratory tests to verify the efficiency and the specificity of the primers were performed. The methodology was first established for single strain cultures and thereafter was applied in environmental water samples, from a reservoir located in the Brazilian savannah (“cerrado”). The results were very satisfactory, demonstrating the high efficiency and the specificity of the primers used, and their ability to detect different cyanobacteria genera. Of particular interest were the results showing a high proportion of toxic strains (as high as 100 %) in the environmental samples, as previously reported in another tropical system. Furthermore, the occurrence of a smaller fraction of toxic strains at high cyanobacteria densities, and of more toxic populations when fewer cyanobacteria were present, deserves further investigation. Although records of cyanobacteria blooms are very common in the tropics and suggest an increasing incidence of toxic populations, the present research is one of the few applying qPCR in a tropical environment. The results obtained here, by a technique that allows a more precise quantification and in situ follow-up of changes in toxicity, will make possible new observations of seasonal and spatial dynamics in these environments.
    Full-text · Article · Oct 2013 · Journal of Applied Phycology
Show more

We use cookies to give you the best possible experience on ResearchGate. Read our cookies policy to learn more.