ArticlePDF Available

Abstract and Figures

In order to understand the origin, phylogeny, and phylogeography of the species Cervus elaphus, we examined the DNA sequence variation of the mitochondrial cytochrome b gene of 51 populations of deer from the entire distribution area of Cervinae with an emphasis on Europe and Asia. Several methods, including maximum parsimony, maximum likelihood, and nested clade analysis, revealed that red deer originated from the area between Kyrgyzstan and Northern India. We found two distinct groups of red deer: a western group consisting of four subgroups and an eastern group consisting of three subgroups. Our mtDNA data do not support the traditional classification of red deer as only one species nor its division into numerous subspecies. The discrepancies between the geographical pattern of differentiation based on mtDNA cytochrome b and the existing specific and subspecific taxonomy based on morphology are discussed.
Content may be subject to copyright.
Mitochondrial DNA phylogeography of red deer (Cervus elaphus)
Christian J. Ludt,
a
Wolf Schroeder,
a
Oswald Rottmann,
b
and Ralph Kuehn
a,*
a
Department for Ecosystem and Landscape Management, Wildlife Biology and Wildlife Management Unit,
Technical University Munich-Weihenstephan, Am Hochanger 13, Freising 85354, Germany
b
Department for Animal Sciences, Technical University Munich-Weihenstephan, Am Hochanger 13, Freising 85354, Germany
Received 3 June 2003; revised 12 September 2003
Abstract
In order to understand the origin, phylogeny, and phylogeography of the species Cervus elaphus, we examined the DNA sequence
variation of the mitochondrial cytochrome bgene of 51 populations of deer from the entire distribution area of Cervinae with an
emphasis on Europe and Asia. Several methods, including maximum parsimony, maximum likelihood, and nested clade analysis,
revealed that red deer originated from the area between Kyrgyzstan and Northern India. We found two distinct groups of red deer: a
western group consisting of four subgroups and an eastern group consisting of three subgroups. Our mtDNA data do not support
the traditional classification of red deer as only one species nor its division into numerous subspecies. The discrepancies between the
geographical pattern of differentiation based on mtDNA cytochrome band the existing specific and subspecific taxonomy based on
morphology are discussed.
Ó2003 Elsevier Inc. All rights reserved.
Keywords: Cervinae; mtDNA; Cytochrome b; Phylogeny; Phylogeography; Red deer
1. Introduction
Red deer (Cervus elaphus) is the most widespread and
best known deer species in the world. Today there are up
to 22 known subspecies (Table 4) in the Holarctic (Geist,
1999; Trense, 1989; Whitehead, 1972). Although much is
known about the phylogeny of the species (Geist, 1999;
Kuwayama and Ozawa, 2000; Mahmut et al., 2002;
Polziehn and Strobeck, 1998, 2002; Randi et al., 1998,
2001; Trense, 1989), there are still some disagreements.
Whereas the division into the two species C. elaphus and
Cervus canadensis is widely accepted (Bryant and Maser,
1982; Cockerill, 1984), their subdivision into many sub-
species is questioned (Cronin, 1992; Nowack, 1991) as is
the assignment of the Central Asian subspecies to the two
lineages elaphus and canadensis (Geist, 1999; Polziehn
and Strobeck, 2002; Mahmut et al., 2002; Trense, 1989).
Since cladistic analyses detected many cases of parallel-
ism and convergence in the evolution of morphological
traits among Cervidae (Groves and Grubb, 1987; Janis
and Scott, 1987), the understanding of their pattern of
character evolution requires the drawing of a phylogeny
independent from those traits (Randi et al., 1998). The
present classification of the numerous subspecies is
mostly based on morphological characters such as body
and antler size (Dolan, 1988), antler shape (e.g., coronate
or acoronate) or cranial measurements (Geist, 1991,
1992) which are all considerably affected by nutrition
(Geist, 1999). Recent morphological studies have con-
centrated more on nutrition-independent characters such
as the hair coat of social organs, social signals (Geist,
1999) and postcranial measurements (Pfeiffer, 2002).
These studies as well as the most recent studies on
mitochondrial DNA (Mahmut et al., 2002; Polziehn and
Strobeck, 2002; Randi et al., 2001) query the number of
subspecies and favor the classification of red deer into
two different species. The mitochondrial protein-coding
gene for cytochrome bhas been proven to be useful for
resolving phylogenetic patterns among various artio-
dactyls within evolutionary time frames shorter than 25
million years (Stanley et al., 1994; Tanaka et al., 1996).
In this study we analyzed the phylogeny of 50
populations of most living species and subspecies of
the genus Cervus by comparing complete mtDNA
*
Corresponding author.
E-mail address: kuehn@wzw.tum.de (R. Kuehn).
1055-7903/$ - see front matter Ó2003 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2003.10.003
Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
MOLECULAR
PHYLOGENETICS
AND
EVOLUTION
www.elsevier.com/locate/ympev
cytochrome bsequences. The aim of this study was to
answer the following questions: Does the red deer rep-
resent only one species (C. elaphus) with numerous
subspecies distributed all over the Holarctic (Geist,
1999; Whitehead, 1972), or are there two different spe-
cies (C. elaphus and C. canadensis) consisting of an
eastern and a western group (Kuwayama and Ozawa,
2000; Mahmut et al., 2002; Polziehn and Strobeck, 1998,
2002; Randi et al., 1998, 2001)? Do the currently named
subspecies agree with phylogenetic and phylogeographic
knowledge based on genetic data? Does the origin of C.
elaphus lie in Central Asia as has been assumed by Geist
(1999) and Mahmut et al. (2002)? We also discuss the
paths of distribution of this widespread species.
2. Materials and methods
2.1. Sample collection and laboratory procedures
Samples of tissue or antlers were obtained from 37
wild populations of red deer (C. elaphus) across most of
the species range (Fig. 1), with 1–15 individuals from
each population being sampled (Table 1). Additional
three sequences of red deer were obtained from the
NCBI nucleotide data bank for comparison and verifi-
cation of our data. The following species were included
in the study to determine species status: Sika deer
(Cervus nippon) with five different subspecies (four from
the NCBI nucleotide data bank), two populations of
ThoroldÕs white lipped deer (Cervus albirostris), as well
as two populations of sambars (Cervus unicolor and
Cervus timorensis) and one of the hog deer (Axis porci-
nus). This means a total of 50 populations of Cervinae or
415 sampled individuals (Table 1). One sequence of the
fallow deer Dama dama (AJ000022), one of Bos taurus
(J01394), and one of Moshus moschiferus (AF026883)
were taken from the NCBI nucleotide data bank and
were used as outgroups in the phylogenetic part of the
work.
Tissue samples were preserved in 95% ethanol and
stored together with the antlers at )20 °C. DNA ex-
traction from tissue samples was performed using stan-
dard proteinase-K phenol–chloroform protocols
(Sambrook et al., 1989). Antler DNA was extracted by a
method established by Kuehn et al. (2001). The com-
plete cytochrome bgene (1140 bp) was amplified by
polymerase chain reaction (PCR) (Saiki et al., 1985).
The primer sequences designed for this study were cerni
cytoB A1 (GAAAAACCATCGTTGTCATTCA) and
cerni cytoB B2 (GGAGGTTGGTAGCTCTCCTTTT).
Each PCR (total of 25 ll) was composed of 1PCR
buffer (10 mM Tris–HCl, pH 8.3, 50 mM KCl), 3 mM
MgCl2, 0.2 mM dNTPs, 0.2 lM of each primer and 1 U
of Taq DNA polymerase. The PCR amplification con-
sisted of an initial denaturing at 94 °C for 3 min followed
by 35 cycles of denaturing at 94 °C for 45 s, annealing at
54 °C for 45 s, and extension at 72 °C for 70 s with a final
extension period of 3 min at 72 °C. PCR products were
purified using a NucleoSpin Extract Kit (MACHEREY-
NAGEL), and cycle-sequenced from both ends, using
either PHARMACIA Dye Primer kits (PCR primers
with Cy 5.0 labeled 50-tails) or PHARMACIA Cy 5.0
Dye Terminator kits; resulting fragments were ana-
lyzed in a PHARMACIA ALF Express II automated
sequencer.
Fig. 1. Map showing approximate sample collection sites. Numbers next to sites are equivalent to numbers in Table 1. Symbols for sites are identical
to group symbols in Table 1 and Fig. 4. Only populations with known geographical origin are shown. Population 24 from Montana/USA is not
shown on this map due to inappropriate map size.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1065
Table 1
Samples of Cervinae analyzed in this study
Nr. PopID NSpecies name Common name Geographical origin Group Acc. No.
1 barba1 11 Cer. el. barbarus Barbary Red Deer Tunisia, Tunis rAfrica AY070222
2 barba2 12 Cer. el. barbarus Barbary Red Deer Tunisia, Tunis rAfrica AY070222
3 enclo1 11 Cer. el. Red Deer Germany, enclosure rAfrica AY118198
4 corsic 3 Cer. el. corsicanus Sardinian Deer Sardinia rAfrica AY244489
5 albir1 13 Cer. albirostris ThoroldÕs Deer China, Qinghai dAlbi AY044863
6 albir2 16 Cer. albirostris ThoroldÕs Deer China, Qinghai dAlbi AF423202
7 alasha 1 Cer. el. alashanicus Ala Shan Red Deer China mEast-Asia AY070224
8 xanth1 10 Cer. el. xanthopygus Isubra Russia, Anjui mEast-Asia AY070224
9 xanth2 10 Cer. el. xanthopygus Isubra Russia, Amur mEast-Asia AF423197
10 anonym 10 Cer. el. xanthopygus Isubra China, Sinkiang mEast-Asia AY244490
11 atlan1 9 Cer. el. atlanticus Red Deer Norway, Hitra W-Europe AY070226
12 atlan2 1 Cer. el. atlanticus Red Deer Norway, Hitra W-Europe AY070221
13 enclo2 15 Cer. el. hispanicus Spanish Red Deer Spain, enclosure W-Europe AY044859
14 france 10 Cer. el. hippelaphus Middle-European
Red Deer
France W-Europe AY244491
15 hispan 6 Cer. el. hispanicus Spanish Red Deer Spain, La Garganta W-Europe AF489281
16 kreuth 10 Cer. el. hippelaphus Middle-European
Red Deer
Germany, Kreuth W-Europe AY044858
17 poland 11 Cer. el. hippelaphus Middle-European
Red Deer
Poland, Massuria W-Europe AY044860
18 scotic 1 Cer. el. scoticus Scottish Red Deer Scotland W-Europe AB021099a
19 swedis 4 Cer. el. elaphus Red Deer Sweden W-Europe AY070226
20 ukrain 2 Cer. el. brauneri Krim Red Deer Ukraine/Krim W-Europe AY148966
21 boluot 2 Cer. el. maral Maral Turkey, Bolu }Middle-East AY118199
22 maral1 3 Cer. el. maral Maral Iran }Middle-East AF489280
23 maral2 4 Cer. el. maral Maral Iran }Middle-East AF489280
24 canad1 10 Cer. el. canadensis American Wapiti North America nAsia/Amer AF423198
25 canad2 1 Cer. el. canadensis American Wapiti nN-Asia/Amer. AB021096a
26 sibir1 15 Cer. el. sibericus Siberian Wapiti China, Mongolia nN-Asia/Amer. AY044862
27 sibir2 14 Cer. el. sibericus Siberian Wapiti China, Mongolia nN-Asia/Amer. AF423199
28 songa1 15 Cer. el. songaricus Tien Shan Wapiti China, Tien Shan nN-Asia/Amer. AY035871
29 songa2 12 Cer. el. songaricus Tien Shan Wapiti China, Tien Shan nN-Asia/Amer. AY044856
30 nipcen 1 Cer. nip. centralis Sika Deer sNippon AB021094a
31 nipmag 1 Cer. nip. mageshima Sika Deer sNippon AB021092a
32 nipnip 1 Cer. nip. nippon Sika Deer sNippon AB021093a
33 nipsic 15 Cer. nip. sichuanicus Sika Deer China, Sichuan sNippon AY035876
34 nipyes 1 Cer. nip. yesoensis Sika Deer sNippon AB021095a
35 kansu1 10 Cer. el. kansuensis Kansu Red Deer China, Dong Da
Shan
S-Asia AY070223
36 kansu2 1 Cer. el. kansuensis Kansu Red Deer South-Asia AB021098a
37 neill1 13 Cer. el. macneilli MÕNeillÕs Deer China, Qinghai South-Asia AY035875
38 neill2 15 Cer. el. macneilli MÕNeillÕs Deer China, Qinghai South-Asia AY070223
39 wallic 13 Cer. el. wallichi Shou China, Tibet South-Asia AY044861
40 axispo 12 Axis porcinus Hog Deer India *Sambar AY035874
41 timore 14 Cer. tim. macassanicus Rusa Deer Indonesia, Celebes *Sambar AF423200
42 unicol 15 Cer. uni. cambojensis Sambar China, Yunan *Sambar AF423201
43 austri 12 Cer. el. hippelaphus Middle-European
Red Deer
Austria jBalkan AY044857
44 bulgar 13 Cer. el. hippelaphus Middle-European
Red Deer
Bulgaria jBalkan AF423195
45 enclo3 1 Cer. el. hippelaphus Red Deer Germany, enclosure jBalkan AF423196
46 hungar 15 Cer. el. hippelaphus Middle-European
Red Deer
Hungary jBalkan AF489279
47 istan1 2 Cer. el. hippelaphus Middle-European
Red Deer
Turkey, Istanbul jBalkan AY118197
48 montan 1 Cer. el. montanus Eastern Red Deer Romania jBalkan AY070225
49 yugosl 11 Cer. el. hippelaphus Middle-European
Red Deer
Yugoslawia,
Delibrat.
jBalkan AY070225
50 bactri 2 Cer. el. bactrianus Bactrian Red Deer Tadzikistan Tarim AY142327
51 yarkan 3 Cer. el. yarkandensis Yarkand Red Deer China,
Ur
umki Tarim AY142326
52 damda 1 Dama dama Fallow Deer AJ000022a
W-Europe, Western-Europe; N-Asia/Amer., North-Asia/America; PopID, population ID; N, number of individual samples of population.
a
Sequences obtained from the NCBI data bank with unknown origin.
1066 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
Sequences were visually inspected and corrected using
ALFwin Sequence Analyser version 2.10 (PHARMA-
CIA); sites or segments from which sequences could not
be unambiguously scored after three attempts (inde-
pendent PCR and sequencing reactions) were treated as
missing information and excluded from the analysis.
Three individual samples of every population were se-
quenced unless they were not available (Table 1). If
these three sequences were equal, the population was
treated as one haplotype. If the sequences showed dif-
ferences, all individual samples (N) of the population
were sequenced and the haplotypes found (n) included in
the data (Table 1). All in all 125 deer sequences of 43
populations were obtained. In total 44 haplotypes of
50 populations of the genus cervus and three outgroup
sequences were used for calculation.
2.2. Data analysis
Sequences were aligned using ClustalX version 1.83
(Thompson et al., 1997) and checked visually. Initial
sequence comparisons and measures of variability were
performed using Mega version 2.1 (Kumar et al., 2001).
Transition/transversion ratios and the a-parameter of
the cdistribution of rate variation among sites were
estimated using TreePuzzle version 5.0 (Schmidt et al.,
2002). To determine the appropriate model of sequence
evolution and statistically compare successively nested
more parameter-rich models for this data set, the pro-
gram MODELTEST version 3.06 (Posada and Cran-
dall, 1998) was used. The chosen model was applied to
the data matrix to produce maximum likelihood (ML)
estimates using PAUP* version 4.10b (Swofford, 2003).
PAUP* was used to compute consensus trees from ML
trees found by heuristic searches (with replicated ran-
dom sequence addition for each replicate) of 500 boot-
strap (Felsenstein, 1985) replicates of the sequences.
Dates of evolutionary separation between different
groups of populations were estimated using conven-
tional molecular clock calibrations with the fossil record
of Bos and Dama (Vrba and Schaller, 2000). Population
divergence times were estimated using a molecular clock
based on net genetic distance values (dc) to correct
within population variation (Avise, 1994): dc¼dAB
0:5ðdAþdBÞ, where dAB is the mean pairwise genetic
distance between individuals in populations Aand B,
and dAand dBare nucleotide diversities (mean genetic
distances between individuals) within the two popula-
tions. This procedure assumes that group diversity in the
ancestral population was similar to the mean values in
extant populations.
Population genetic parameters, such as gene diversity
(the probability that two randomly chosen mtDNA se-
quences are different in the sample (Nei, 1987)) were
estimated from the mtDNA data set using ARLEQUIN
version 2.0 (Schneider et al., 2000). To estimate the
proportion of genetic variation at different hierarchical
levels, using information from the geographical distri-
bution of haplotypes and the pairwise distance between
them, an analysis of molecular variance (AMOVA)
(Excoffier et al., 1992) was performed. The statistical
significance of the estimated FST values was tested using
100,000 permutations as implemented in ARLEQUIN.
We also applied the nested cladistic analysis (NCA)
proposed by Templeton et al. (1995) to draw phyloge-
ographic inferences from our mtDNA data set, using
GEODIS version 2.0 (Posada et al., 2000) and 10,000
permutations to test the significance of alternative his-
torical scenarios. Accordant cladograms were created
with TCS version 1.13 (Clement et al., 2000) with 95%
parsimoniously plausible connections between haplo-
types (Templeton and Sing, 1993) and nested by hand.
Reliability of the correlation of genetic and geographical
distances was assessed by a Mantel randomization test
as implemented in R-Package version 4.0 (Casgrain,
2001). The geographical distance matrix needed for this
test was computed with R-Package from the approxi-
mate latitudes and longitudes of the geographical origin
of the sampled animals. For interpretation of the
GEODIS output, we used the latest Inference Key for
the Nested Haplotype Tree Analysis of Geographical
Distances (Templeton, 2001).
3. Results
3.1. Characterization of sequence variation
A total of 52 (eight from the NCBI nucleotide
data bank; Accession Nos. AB021092–AB021096,
AB021098, AB021099, and AJ000022) out of 125 mi-
tochondrial cytochrome bsequences (1140 nucleotides
each), representing 51 populations, 45 haplotypes and
30 Cervinae taxa (according to GeistÕs (1999) classifi-
cation), were included in the calculation (Table 1). Se-
quence identity was observed only among individuals
originating from the same or adjacent geographical re-
gions but for all individuals from the same population
with one exception only (population of Cervus elaphus
atlanticus split into two haplotypes atlan1 (n¼9) and
atlan2 (n¼1)). The full-length sequences (Appendix A)
were deposited in the NCBI nucleotide data bank
(Accession Nos. AF423195–AF423202, AF489279–
AF489281, AY035871, AY035874–AY035876, AY044856–
AY044863, AY070221–AY070227, AY118197–AY118199,
AY142326 and AY142327, AY148966, AY244489–
AY244491). Sequences of a cow (B. taurus) and a musk
deer (M. moschiferus), were extracted from the NCBI
nucleotide data bank and were used as outgroups (Ac-
cession Nos. J01394 and AF026883). A total of 365
(32.0%) sites were variable, of which 235 (20.6%) were
parsimony-informative. Within red deer (C. elaphus
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1067
and C. canadensis) there were 144 (12.6%) variable sites,
of which 114 (10.0%) were parsimony-informative. The
transition/transversion parameter was estimated to be
16.1 with and 18.4 without outgroups. Substitution
rates varied among sites, resulting in an overall a-value
of 0.20 with and 0.09 without outgroups. Base compo-
sition was biased with a deficiency of guanine (A¼
31:6%, C¼26:8%, G¼13:1%, T¼28:5%).
3.2. Phylogenetic analysis
MODELTEST (Posada and Crandall, 1998) deter-
mined that the GTR model (Rodr
ıgez et al., 1990) with
c-distributed rates (GTR + G) is the statistically ap-
propriate model for the data set with outgroups. The
maximum likelihood search found one tree with ln Lof
)4900.09461. This tree clearly shows eleven distinct
groups of Cervinae (Fig. 2). They were designated as
Western-Europe (W-Europe), Balkan, Middle-East,
Africa, Tarim, North-Asia/America (N-Asia/Amer.),
South-Asia (S-Asia), East-Asia (E-Asia), Nippon, Al-
birostris (Albi), and a Sambar group including the hog
deer A. porcinus (which is not a Sambar). For red deer
only, the HKY85 model (Hasegawa et al., 1985) with
c-distribution rates (HKY + G) was determined as the
appropriate model by MODELTEST (Posada and
Crandall, 1998). PAUP* produced one tree with ln Lof
)2721.14176. The same eight groups of red deer as in
the Cervinae-tree form three big clusters which were
designated as Western Red Deer, Eastern Red Deer,
and Tarim (Fig. 3). To verify these results, especially
the large gap between eastern (Asia and North Amer-
ica) and western (Africa, Middle-East, and Europe)
species, an analysis of molecular variance (AMOVA)
was conducted. The AMOVA was performed three
times:
(1) Three populations with Western Red Deer
(Africa, Middle-East, Balkan, and Western-Europe),
Eastern Red Deer (East-Asia, South-Asia, and North-
Asia/America), and Tarim. This structure showed a
variation of 79.26% among the groups, 17.34% among
populations within groups, and 3.40% within popula-
tions. The corresponding FST -value of 0.96602 was
significant (p<0:05) by 100,000 permutations. (2) Two
populations with Western Red Deer (including the
Tarim cluster) and Eastern Red Deer. This analysis
revealed a variation of 75.21% among groups, 21.35%
among populations within the groups, and 3.22%
within populations. The corresponding FST-value of
0.96778 was significant (p<0:05) by 100,000 permu-
tations. (3) Two populations with Western Red Deer
and Tarim incorporated into Eastern Red Deer. This
structure showed a variation of 68.40% among groups,
28.14% among populations within groups, and 3.46%
within populations. The corresponding FST-value of
0.96537 was significant (p<0:05) by 100,000 permu-
tations. A structure in accordance with the present
classification into the denominated subspecies (Trense,
1989) did not lead to significant results. To compare
the eleven groups of deer identified in this study the
values for gene diversity, basepair- and pairwise dif-
ferences are shown in Table 2. Pairwise distances (pd)
in this table are calculated with the appropriate model
HKY + G (Hasegawa et al., 1985). The mean distances
between Eastern and Western Red Deer (0.057 0.006)
as estimated by PAUP* ver. 4.10b (Swofford, 2003)
under the HKY + G model (Hasegawa et al., 1985) and
the distances between each of them and the three sister
groups (sika deer (0.060 0.006 to Western and
0.041 0.004 to Eastern), ThoroldÕs white lipped deer
(0.060 0.007 to Western and 0.048 0.006 to East-
ern), and the Sambar group (0.062 0.007 to Western
and 0.055 0.006 to Eastern)) support a classification
into two species. The mean distances within the groups
are considerably lower (0.014 0.002 for Western Red
Deer and 0.013 0.002 for Eastern Red Deer). The
same applies to the Sambar group, which consists of
three distinct species (0.013 0.002), and to the Nip-
pon group (0.027 0.003), a group rich in subspecies.
The two populations of ThoroldÕs white lipped deer
from different locations show a mean distance of
0.005 0.002.
3.3. Molecular clock
The measure of nucleotide divergence (dxy ) (Saitou
and Nei, 1987) based on a GTR + G model (Rodr
ıgez
et al., 1990) of nucleotide substitution between cow and
deer sequences (mean dxy ¼0:1966 0:0151) was used
to estimate a molecular clock for deer mtDNA se-
quences. However, lineage separation in a gene tree
normally predate population-level splits (Avise, 2000),
so a correction is needed for within-cervus nucleotide
diversity. To estimate the substitution rate of the an-
alyzed mtDNA, the net genetic distance (dxy ) (Avise,
1994) between the deer sequences was computed (dxy ¼
0:0539 0:0017). The standard equation dxy ¼2Tl
(where lis the substitution rate and Tis time (Saitou
and Nei, 1987)) and a conservative fossil record cali-
bration of 25 million years (MY) for the most recent
common ancestor (MRCA) of cervids and bovids
(Vrba and Schaller, 2000) produced a substitution rate
of approximately 0.39% (l¼0:00393 0:00031) per
site per million years (PMY). We calculated an esti-
mated age of 6.1–7.6 MY for the coalescence of the
ancestors of the recent red deer mtDNA haplotypes.
Albirostris split approximately between 5.1 and 6.1
million years ago (MYA) from red deer and Nippon
between 2.9 and 3.4 MYA. The separation of D. dama
from the Cervus group at about 12.6–7.6 MYA corre-
sponds to the known fossil records (Vrba and Schaller,
2000).
1068 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
Fig. 2. Phylogeny of Cervinae constructed using maximum-likelihood with GTR + G model (Rodr
ıgez et al., 1990) with a cshape parameter of
a¼0:2005 for complete sequences from the cytochrome bof mitochondrial DNA. Bootstrap (Felsenstein, 1985) support indices that were upheld in
over 50% of the 1000 bootstrap replicates are shown above each branch.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1069
3.4. Nested clade analysis
Enclo2 and enclo3 (Table 1) were not included into
the Mantel randomization test with R-Package (Cas-
grain, 2001) due to their uncertain origin (samples were
obtained from enclosures in Germany). The value for
the correlation of the genetic and geographical distance
estimated by the Mantel-Test was r¼0:63 with
Table 2
Measures of mitochondrial DNA diversity observed in the 11 groups of red deer identified in this study
Group Nnbp differences Gene diversity Pairwise difference (%) Mean pd (%)
Western Red Deer 26 21 91 0.9815 0.0164 0–4.86 1.86 0.22
Western Europe 10 8 10 0.93330.0773 0–0.44 0.19 0.07
Balkan/Middle-East 10 8 27 0.9556 0.0594 0–1.60 0.77 0.15
Balkan 7 6 12 0.9524 0.0955 0–0.88 0.38 0.11
Middle-East 3 2 7 0.6667 0.3143 0–0.62 0.41 0.15
Africa 4 3 5 0.8333 0.2224 0–0.35 0.28 0.12
Tarim 2 2 12 1.0000 0.5000 1.06 1.06 0.30
Eastern Red Deer 15 13 43 0.9810 0.0308 0–2.33 1.27 0.20
Noth-Asia/America 6 6 17 1.0000 0.0962 0.09–1.15 0.68 0.17
South-Asia 5 4 3 0.9000 0.1610 0–0.26 0.12 0.08
East-Asia 4 3 5 0.8333 0.2224 0–0.44 0.22 0.09
Nippon 5 5 60 1.0000 0.1265 0.18–4.39 2.77 0.30
Albirostris 2 2 6 1.0000 0.5000 0.53 0.53 0.22
Sambar 3 3 23 1.0000 0.2722 0.79–1.69 1.36 0.27
Total 51 44 217 0.9937 0.0054 0–6.92 5.54 0.34
Nis the number of populations, nthe number of haplotypes per group, and bp stands for basepairs. Pairwise distances (pd) are estimated using
HKY + G model (Hasegawa et al., 1985).
Fig. 3. Phylogeny of red deer constructed using maximum-likelihood with HKY + G model (Hasegawa et al., 1985) with a cshape parameter of
a¼0:0898 for complete sequences from the cytochrome bof mitochondrial DNA. Bootstrap (Felsenstein, 1985) support indices that were upheld in
over 80% of the 1000 bootstrap replicates are shown at the inherent nodes.
1070 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
p60:001. Supported by this significant correlation, a
nested clade analysis was performed (Fig. 4). Based on
the 95% connection probability (614 steps) calculated
by TCS (Clement et al., 2000), haplotypes of Western
Red Deer were subdivided into Western-Europe (H,
n¼10), Africa (I, n¼4) and a third network (South-
Europe) consisting of Balkan and Middle-East (FG,
n¼10). The Eastern Red Deer, on the other hand,
formed a single network (BCDE, n¼15). Since the Albi
group consists of only two individuals and the Sambar
and Nippon groups were subdivided into several net-
works, these groups were not included into the nested
clade analysis. Networks generally correspond with the
relationships among well supported clades revealed by
maximum parsimony (MP) and ML analysis (Figs. 2
and 3). The obtained cladograms were nested by hand
Fig. 4. The nested haplotype networks for red deer clades A–I. Haplotype connections ( 614 substitutions) are based on a P0.95 probability of being
parsimonious. Dotted lines connecting haplotypes represent single substitutions. Circles represent unsampled haplotypes. Hierarchical nesting levels
are denoted by boxes and numbered clades. Haplotypes and associated specimens are summarized in Table 1 and geographically depicted by clade-
symbol in Fig. 1.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1071
and the received clades were used to create an input file
for GEODIS (Posada et al., 2000) with the corre-
sponding locations of the populations as longitudes and
latitudes. The ancient haplotypes derived from the MP
tree were chosen as interior populations for the corre-
sponding clade (Posada et al., 2000). Clade I was ex-
cluded from the analysis due to its small sample size.
The Inference Key for the Nested Haplotype Tree
Analysis (Templeton, 2001) was used to identify popu-
lation-level processes; the results are summarized in
Table 3. The key shows an allopatric fragmentation for
the Eastern Red Deer (Clade 5.1) as well as for the N-
Asia/America branch (Clade 3.5), whereas it presumes
restricted gene flow with isolation by distance for East-
Asia (Clade 2.4). Between East-Asia and South-Asia
(Clade 4.2) past fragmentation was determined. In the
case of the Western Red Deer (FG, H, and I) the out-
come for all networks appeared to be the result of
contiguous range expansion. Based on the results of the
NCA, the data of the molecular clock as well as fossil
and geographic data (Agust
ı and Ant
on, 2002), the
approximate colonization routes of red deer were
retraced and are shown in Fig. 5.
4. Discussion
4.1. Species or not species?
The phylogenetic trees obtained from the sequence
data from the cytochrome bgene of mtDNA, support
the classification of Western Red Deer and Eastern Red
Deer as individual species. The integration of sika deer
and ThoroldÕs white lipped deer as sister taxa in the
phylogenetic analysis clearly identify Western and
Eastern Red Deer as two monophyletic groups (Fig. 2).
The fallow deer (D. dama) showed a distance between
0.111 and 0.126 to the examined groups. This confirms
the state of Dama as a distinct genus as formerly de-
scribed (Douzery and Randi, 1997; Randi et al., 2001).
Recent studies of the control region of Cervidae (Pol-
ziehn and Strobeck, 1998, 2002; Randi et al., 2001;
Table 3
Results of the nested clade analysis
Network Nested clades Inclusive clades DcDnInference chain; population inference
A 3.1 (A) 2.1 (Interior) 0 610 1-2-11-17-Inconclusive
2.2 (Tip) 0 621LPast fragmentation?
I–T 0 )11S
BCDE 2.4 (C) 1.5 (Tip) 0 141S1-2-11-17-4-No; Restricted Gene Flow
1.6 (Interior) 0 431Lwith Isolation by Distance
I–T 0 290L
3.5 (E) 2.6 (Interior) 389 7646 1-2-11-17-4-9-10-Yes; Allopatric
2.7 (Tip) 0 7015SFragmentation
I–T 389 631L
4.2 (CD) 2.4 (Tip) 214 1137 1-2-3-4-9-No; Past Fragmentation
2.5 (Interior) 973 1294
I–T 760L157
5.1 (BCDE) 2.3 (Tip) 569 2694 1-2-3-5-15-16-Yes; Allopatric
2.4 (Interior) 214S3196 Fragmentation
2.5 (Interior) 2265 2873
2.6 (Tip) 389 2289
2.7 (Tip) 0S9641L
I–T 1125 )1872
FG 3.6 (F) 2.8 (Interior) 0S259 1-2-11-12-No; Contiguous Range
2.9 (Tip) 0 510 Expansion
I–T 0S)251
3.7 (G) 2.10 (Tip) 626L630 1-2-11-12-No; Contiguous Range
2.11 (Interior) 418 420 Expansion
2.12 (Tip) 0 438
I–T 1 )145
4.3 (FG) 3.6 (Tip) 342 1778L1-2-11-12-No; Contiguous Range
3.7 (Interior) 483S763SExpansion
I–T 141 )1015S
H 2.13 (H) 1.19 (Interior) 0 2015L1-2-11-12-No; Contiguous Range
1.20 (Interior) 802S891SExpansion
1.21 (Tip) 0 1655
1.22 (Tip) 0 1888
I–T 701S)740
Clades within each nested clade and their associated interior or tip designation are listed. Values for clade distance (Dc) and nested clade distance
(Dn) in kilometers are included. Interior versus tip contrasts (I–T) are reported. Significantly large (L) or small (S) values of Dcor Dnare shown in
bold. The inference chain and population inference follow from the inference key of Templeton (2001).
1072 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
Mahmut et al., 2002) yielded similar results and confirm
our assumption that Western and Eastern Red Deer are
two distinct species (Polziehn and Strobeck, 2002).
Whereas Randi assigned A. porcinus to the genus Axis
based on mtDNA data of the control region (Randi
et al., 2001), our data assign it to the genus Cervus. This
confirms GeistÕs postulation (1999) that hog deer (A.
porcinus) may not be as closely related to Axis axis as
hitherto assumed because of the antler structure with a
preorbital gland that, as in sambars, is everted during
agonistic or sexual arousal. Additionally, unlike chital
(A. axis), hog deer have no rutting call. Apart from this,
RandiÕs and our data match very well.
Therefore we do not support the current classification
of red deer into one superspecies (Geist, 1999) nor its
subdivision into numerous subspecies (Trense, 1989).
The AMOVA supports the division into four Western
and three Eastern groups with the Tarim group being at
the basis, as it shows the highest and most significant
F-values for this classification.
Based on the results of this study, Western Red Deer
can be subdivided into four subgroups: Western-Eu-
rope, Balkan, Middle-East, and Africa. Former studies
based on coloration and morphology (Groves and
Grubb, 1987) yielded similar results. The barrier be-
tween the Balkan and the Middle-East group is clearly
defined by the Bosphorus in Turkey. The Alps and
Carpathians seem to form the barrier between Western
Europe and the Balkan. Our data show that the red deer
of Western Europe cannot be subdivided into several
subspecies. The subspecies C. atlanticus,C. brauneri,
C. elaphus,C. hippelaphus,C. hispanicus,andC. scoticus
in Western Europe as well as C. hippelaphus and
C. montanus in the Balkan group could not be differ-
entiated by the mtDNA cytochrome bsequence data
(Figs. 3 and 4). On the other hand, the subspecies
C. hippelaphus is assigned to both Western Europe and
the Balkan group by morphological classification (Table
1). This is inconsistent with the large genetic gap be-
tween these two groups. Subspecies status of the African
barbary deer, the maral and the two subspecies of the
Tarim group (C. bactrianus and C. yarkandensis) can be
confirmed (Table 4).
The three subgroups of the Eastern group (North
Asia/America, South-Asia, and East-Asia) are clearly
defined. The existence of further subspecies is unlikely
according to our data. Thus, the current classification
into subspecies has to be reconceived thoroughly. This
can be seen in the N-Asia/Amer. group with Cervus el.
songaricus and sibericus as well as in the S-Asia group
with Cervus el. kansuensis and macneilli which we were
unable to differentiate (Figs. 3 and 4). The barriers for
speciation are more difficult to identify than those in the
Western Group. In light of the fact that Siberian and
American wapitis are more or less identical, the isolated
position of the Isubra (Cervus elaphus xanthopygus) in-
habiting the Amur mountains is not easy to understand.
The South Asian group is isolated by the Takla Makan-
and the Gobi-Deserts and evolved sympatrically with
ThoroldÕs white lipped deer, although their area of cir-
culation is separated by altitude. The primordial Tarim
group stands at the base of the red deer and is geo-
graphically isolated by the Takla Makan Desert to the
East and the Pamir Mountains to the West. Genetically
it is more related to the Western group, whereas its
habitat is close to the N-Asia/Amer. group.
Sika deer and ThoroldÕs deer form one group with
Eastern Red Deer. The branching pattern of the
subspecies of C. nippon complies with that described for
the control region (Kuwayama and Ozawa, 2000), the
mainland subspecies C. n. sichuanicus standing at the
base of the entire sika group. The high divergence
among the sika deer probably results from recent drift
due to the island distribution of the populations, which
Fig. 5. Colonization routes of red deer in Asia and Europe based on cytochrome bsequences. Clade-names (bold) are the same as in Fig. 2.
Geographic (genetic) barriers (italic) are marked by bars and named with geographic realities of today. Dashed arrows show definite routes of
colonization and dotted arrows show possible ones.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1073
was also verified by microsatellite and mtDNA data
(Cook et al., 1999; Goodman et al., 2001). Their genetic
proximity to Eastern Red Deer may point to hybrid-
ization as described in recent studies (Goodman et al.,
1999; Willard et al., 1998). However, our phylogenetic
tree lacks a mosaic form, which would be a hint to hy-
bridization in mtDNA (Kuwayama and Ozawa, 2000).
In addition, there are no hybridization zones with the
Japanese subspecies. Therefore, it is likely that Eastern
Red Deer and Sika deer shared a common ancestor
which split off from Western Red Deer.
4.2. Time of divergence
The calculated time of divergence between Eastern
and Western Red Deer of about 7 million years con-
firm the data of Randi (2001) for the mtDNA control
region. In contrast to our and RandiÕs study, Polziehn
and Strobeck (2002) as well as Kuwayama and Ozawa
(2000) calculated a divergence time of less than one
million years for red deer, wapiti, sika deer and
ThoroldÕs white lipped deer based on mtDNA cyto-
chrome bdata. The calibration point of 1.6 MY for the
last common ancestor of red deer and fallow deer,
which they had taken from Kurt
en (1968), is incorrect.
Kurt
en described only the first appearance of fallow
deer in the Pleistocene, but not their very first ap-
pearance. If Polziehn and Kuwayama had used newer
fossil records like Vrba and Schaller (2000) or Agust
ı
and Ant
on (2002), their unusually high substitution
rate of 3.5%/MY for the cytochrome b(Randi reported
a substitution rate of 1.11–1.13%/MY for the highly
variable control region) would decrease to 0.38%/MY;
a result similar to ours.
4.3. Reasons for speciation
Extensive changes took place in the early and middle
Miocene. When the African and Indian continental
plates crashed into the Eurasian continent about
40 MYA, the orogenesis of the Himalayas and the Alps
was initiated. The first cervoids appeared at the
changeover from the Oligocene to the Miocene about
25 MYA in the region of todayÕs Hindukush (Agust
ı
and Ant
on, 2002). In those days they were archaic
artiodactyls of medium size (like moshoids today).
Their ancestors were Oligocene survivors such as
Dremotherium and Bedenomeryx, which experienced a
quick diversification into a number of genera like
Cetinensis with its hypsodont check-teeth. About
15 MYA a high-latitude cooling event began (Flower
and Kennet, 1994; Miller et al., 1991), causing a sea-
level decline (Haq et al., 1987) by growth of the
Eastern Antarctic ice sheets. This is the reason why the
ancient sea Tethys in the western part of Eurasia dried
and became vast grassland. The first ancestors of the
genus Dama appeared (Agust
ı and Ant
on, 2002), which
corresponds with our data of the molecular clock.
Then the Arabian plate stopped the circulation of
warm deep-water between the Mediterranean and the
Table 4
Twenty-two currently known subspecies of red deer (Geist, 1999) in comparison to 10 haplotype-lineages found in this study
Nr. Subspecies name Common name Geographical origin Haplotype name
1Cer. el. barbarus Barbary Red Deer Tunisia Cer. el. barbarus
2Cer. el. corsicanus Sardinian Deer Sardinia Cer. el. barbarus
3Cer. el. hippelaphus Middle-European Red Deer Bulgaria Cer. el. hippelaphus
4Cer. el. montanus Eastern Red Deer Romania Cer. el. hippelaphus
5Cer. el. alashanicus Alashan Red Deer China Cer. can. xanthopygus
6Cer. el. xanthopygus Isubra Russia Cer. can. xanthopygus
7Cer. el. maral Maral Iran Cer. el. maral
8Cer. can. nelsoni Rocky Mountain Wapiti North America Cer. canadensis
9Cer. canadensis American Wapiti North America Cer. canadensis
10 Cer. el. sibericus Siberian Wapiti China, Mongolia Cer. can. sibericus
11 Cer. el. songaricus Tien Shan Wapiti China, Tien Shan Cer. can. sibericus
12 Cer. el. Hanglu Kashmir Red Deer India ns
13 Cer. el. kansuensis Kansu Red Deer China, Dong Da Shan Cer. can. kansuensis
14 Cer. el. macneilli MÕNeillÕs Deer China, Qinghai Cer. can. kansuensis
15 Cer. el. wallichi Shou China, Tibet Cer. can. kansuensis
16 Cer. el. bactrianus Bactrian Red Deer Tadzikistan Cer. el. bactrianus
17 Cer. el. yarkandensis Yarkand Red Deer China Cer. el. yarkandensis
18 Cer. el. atlanticus Red Deer Norway Cer. el. elaphus
19 Cer. el. brauneri Krim Red Deer Ukraine/Krim Cer. el. elaphus
20 Cer. el. elaphus Red Deer Sweden Cer. el. elaphus
21 Cer. el. hispanicus Spanish Red Deer Spain Cer. el. elaphus
22 Cer. el. scoticus Scottish Red Deer Scotland Cer. el. elaphus
Note. ns, not sampled.
Nomenclature of haplotype-lineages follows most common subspecies names.
1074 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
Indo-Pacific (Axelrod and Raven, 1978). This causes a
climatic trend to cooler winters and decreased summer
rainfall (Axelrod, 1975), followed by a spread of
grasses over large stretches of Europe and Asia be-
tween 8 and 7 million years ago (Cerling et al., 1997),
enabled large and fast moving grazers such as cervids
to radiate. In accordance with our data, this is the
timeframe when the ancestors of todayÕs red deer sep-
arated. After the split, they were isolated by distance.
In regions of contingency the contact was interrupted
by several Ice Ages with huge glaciers as well as by
insurmountable barriers, such as mountains, deserts,
and the sea. Therefore the populations were able to
establish their species status. At the Pliocene/Miocene
boundary of about 5 MYA, another sea-level fall
started, which was related to glaciation. This led to the
diversification of deer during early Pliocene and the
first appearance of the genus Cervus (C. perrieri,C.
cusanus). At the beginning of the Pleistocene of about
2 MYA, the ancestors of modern species started their
speciation assisted by recurring glaciations.
4.4. Ways of differentiation
The nested clade analysis showed different models for
the separation of the denominated groups. Allopatric or
past fragmentation for the Eastern group is easy to
understand by the geographical barriers such as deserts
and high mountains, which came into being in the ac-
cording timeframes (Fig. 5). In the case of the American
wapiti and its close relationship to the North Asian red
deer we have to take into account that the barrier, in the
form of the Bering Sea, only appeared 9000 years ago.
This timeframe can be neglected with mtDNA data. It
seems that exchange took place between the American
and North Asian wapitis until the Bering Land Bridge
disappeared. The colonization route of the Isubra (C. el.
xanthopygus) and the Ala Shan Red Deer (Cervus. el.
alashanicus) and their isolated position is hard to ex-
plain. The nested clade analysis supports the coloniza-
tion from the South (Fig. 4 and Table 3), whereas it is
undeterminable whether South Asian populations are
descendants of former East Asian populations or
vice versa.
Due to the geographical distribution of the sub-
groups within the Western Red Deer, contiguous range
expansion for the separate groups seems likely. Con-
tiguous range expansion between the Balkan and the
Middle-East is also possible due to the former land
bridge across the Bosphorus. In contrast, the relatively
large gap between Southern Europe and Western Eu-
rope is difficult to explain, because the Danube water-
sides should, for example, offer ways of exchange. On
the other hand, the Alps and Carpathians form quite
immense barriers. Therefore, the European populations
should be investigated more thoroughly. Since the
African and Sardinian red deer are geographically iso-
lated, they were probably subjected to recent gene drift,
which provides an explanation for their high differen-
tiation from the other subgroups. Thus, an overesti-
mation of the time of divergence (2.2 MYA) is
possible. Due to the existence of a temporary Pleisto-
cene land bridge between Europe and Africa (Agust
ı
and Ant
on, 2002), it is possible that the ancestors of the
Africa group moved to their current habitats from the
north. Colonization from the East with a former hab-
itat comprising the whole of Northern Africa is possible
as well (Fig. 5). This would mean that todayÕs African
and Sardinian deer represent a relict endemic group of
this former African population, which was depleted by
the appearance of the Sahara desert.
5. Conclusion
Sequence deviation and the difference in the mtDNA
cytochrome bgene in the various groups of the genus
Cervus, appears to be informative and may be used as a
marker to describe species boundaries, to appoint sub-
species and to find the geographical origin of unidenti-
fied samples. Due to our results the present classification
of red deer into a large number of subspecies has to be
reconceived. This study shows a very high probability
for the existence of two different species of red deer with
three subspecies in Asia and America (Eastern Red
Deer) and four subspecies in Eurasia (Western Red
Deer) and additional one or two primordial subspecies
in Central Asia (Tarim group). The origin of the genus
Cervus seems to be in Central Asia near todayÕs Hin-
dukush.
Acknowledgments
We thank C. Oswald for providing us with rare
samples which in some cases are difficult to achieve.
We thank T. Pfeiffer for assistance in palaeontological
questions. Further thanks are extended to J. Bisson-
ette and U. Puszkarz for helpful comments on this
manuscript. Financial support of the Deutsche Fors-
chungsgemeinschaft (DFG) is gratefully acknowl-
edged.
Appendix A
Mitochondrial DNA cytochrome bhaplotypes
identified in this study. Nucleotide positions showing
variation among haplotypes are depicted; numbers
(vertical) refer to the aligned site in our 1140 bp
data set.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1075
1076 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1077
1078 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1079
1080 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
References
Agust
ı, J., Ant
on, M., 2002. Mammoths, Sabertooths, and Hominids:
65 Million Years of Mammalian Evolution in Europe. Columbia
University Press, New York, US.
Avise, J.C., 1994. Molekular Markers, Natural History and Evolution.
Chapman & Hall, New York, US.
Avise, J.C., 2000. Phylogeography: The History and Formation of
Species. Havard University Press, Cambridge, Massachusetts.
London, England.
Axelrod, D.J., 1975. Evolution and biogeography of Madrean–
Tethyan sclerophyll vegetation. Ann. Missouri Botanical Garden
62, 280–334.
Axelrod, D.I., Raven, P.H., 1978. Late cretaceous and tertiary
vegetation history of Africa. In: Werger, M.J.A. (Ed.),
Biogeography and Ecology of Southern Africa. Junk, The
Hague.
Bryant, L.D., Maser, C., 1982. Classification and distribution. In:
Thomas, J.W., Toweill, D.E. (Eds.), Elk of North America.
Stackpole Books, Harrisburg, pp. 1–59.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1081
Casgrain, P., 2001. Development Release of the R-Package 4.0.
University of Montreal, CA.
Cerling, T.E., Harris, J.R., MacFadden, B.J., Leakey, M.G., Quade,
J., Eisenmann, V., Ehleringer, J.R., 1997. Global vegetation
change through the Miocene/Oligocene boundary. Nature 389,
153–158.
Clement, M., Posada, D., Crandall, K.A., 2000. TCS: a computer
program to estimate gene genealogies. Mol. Ecol. 9, 1657–1659.
Cockerill, R.A., 1984. Deer. In: Mcdonald, D. (Ed.), The Encyclopedia
of Mammals. Facts on File Puplishing, NY, pp. 520–529.
Cook, C.E., Wang, Y., Sensabaugh, G., 1999. A mitochondrial control
region and cytochrome bphylogeny of sika deer (Cervus nippon)
and report of tandem repeats in the control region. Mol.
Phylogenet. Evol. 12, 47–56.
Cronin, M.A., 1992. Intraspecific mitochondrial DNA variation in
North American cervids. J. Mammal. 73, 70–82.
Dolan Jr., J.M, 1988. A deer of many lands. Zoo Nooz 62 (10), 4–34.
Douzery, E., Randi, E., 1997. The mitochondrial control region of
cervidae: evolutionary patterns and phylogenetic content. Mol.
Biol. Evol. 14 (11), 1154–1166.
Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular
variance inferred from metric distances among DNA haplotypes:
application to human mitochondrial DNA restriction data. Ge-
netics 131, 479–491.
Felsenstein, J., 1985. Confidence limits on phylogenetics: an approach
using the bootstrap. Evolution 39, 783–791.
Flower, B.P., Kennet, J.P., 1994. The middle Miocene climatic
transition: East Antarctic ice sheet development, deep ocean
circulation and global carbon cycling. Paleogeogr. Paleoclimatol.
Paleoecol. 1008, 537–555.
Geist, V., 1991. Bones of contention revisited: did antlers enlarge with
sexual selection as a consequence of neonatal security strategies?
Appl. Anim. Behav. Sci. 29, 453–469.
Geist, V., 1992. Endangered species and the law. Nature (London) 357,
247–276.
Geist, V., 1999. Deer of the World: Their Evolution, Behaviour, and
Ecology. Swan Hill Press, UK.
Goodman, S.J., Barton, N.H., Swanson, G., Abernethy, K., Pember-
ton, J.M., 1999. Introgression through rare hybridization: a genetic
study of a hybrid zone between red and sika deer (genus Cervus)in
Argyll, Scotland. Genetics 152 (1), 355–371.
Goodman, S.J., Tamate, H.B., Wilson, R., 2001. Bottlenecks, drift and
differentiation: the population structure and demographic history
of sika deer (Cervus nippon) in the Japanese archipelago. Mol. Ecol.
10, 1357–1370.
Groves, C.P., Grubb, P., 1987. Relationships of living deer. In:
Wemmer, C. (Ed.), Biology and Management of the Cervidae.
Smithsonian Institute Press, Washington.
Haq, B.U., Hardenbol, J., Vail, P.R., 1987. Chronology of fluctuating
sea levels since the Triassic. Science 235, 1156–1167.
Hasegawa, M., Kishino, M., Yano, T., 1985. Dating the human-ape
split by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22,
160–174.
Janis, C.M., Scott, K.M., 1987. The interrelationships of higher
ruminant families, with special emphasis on the members of the
Cervidae. Am. Mus. Novit. 2893, 1–85.
Kuehn, R., Schroeder, W., Rottmann, O., 2001. Sequencing of the
cave bear Ursus spelaeus from the Bavarian Alps is feasible by
nested and touchdown PCR. Acta Theriologica 46 (1), 61–68.
Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2:
molecular evolutionary genetics analysis software. Bioinformatics
17, 1244–1245.
Kurt
en, B., 1968. Pleistocene Mammals of Europe. Weidenfeld and
Nicolson, London.
Kuwayama, R., Ozawa, T., 2000. Phylogenetic relationships among
European Red deer, Wapiti and Sika Deer inferred from mito-
chondrial DNA sequences. Mol. Phylogenet. Evol. 15, 115–123.
Mahmut, H., Masuda, R., Onuma, M., Takahashi, M., Nagata, J.,
Suzuki, M., Ohtaishi, N., 2002. Molecular phylogeography of the
Red deer (Cervus elaphus) populations in Xinjiang of China:
comparison with other Asian, European, and North American
populations. Zool. Sci. 19, 485–495.
Miller, K.G., Wright, J.D., Fairbanks, R.G., 1991. Unlocking the
icehouse: Oligocene–Miocene oxygen isotopes, eustacy and margin
erosion. J. Geographic Res. 96, 6829–6848.
Nei, M., 1987. In: Molecular Evolutionary Genetics. Columbia
University Press, New York, USA, pp. 176–208.
Nowack, R.M., 1991. WalkerÕs Mammals of the World, fifth ed. John
Hopkins Press, Baltimore.
Pfeiffer, T., 2002. The first complete skeleton of Megaloceros verticor-
nis (Dawkins, 1868) Cervidae, Mammalia, from Bilshausen (Lower
Saxony, Germany): description and phylogenetic implications.
Mitt. Mus. Nat. kd. Berl., Geowiss. Reihe 5, pp. 289–308.
Polziehn, R.O., Strobeck, C., 1998. Phylogeny of Wapiti, Red deer,
Sika Deer, and other North American Cervids as determined from
mitochondrial DNA. Mol. Phylogenet. Evol. 10 (2), 249–258.
Polziehn, R.O., Strobeck, C., 2002. A phylogenetic comparison of red
deer and wapiti using mitochondrial DNA. Mol. Phylogenet. Evol.
22, 342–356.
Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of
DNA substitution. Bioinformatics 14 (9), 817–818.
Posada, D., Crandall, K.A., Templeton, A.R., 2000. GEODIS: a
program for the cladistic nested analysis of the geographical
distribution of genetic haplotypes. Mol. Ecol. 9, 487–488.
Randi, E., Mucci, N., Pierpaoli, M., Douzery, E., 1998. New
phylogenetic perspectives on the Cervidae (Artiodactyla) are
provided by the mitochondrial cytochrome bgene. Proc. R. Soc.
Lond. B 265, 793–801.
Randi, E., Mucci, N., Claro-Herguetta, F., Bonnet, A., Douzery,
E.J.P., 2001. A mitochondrial DNA control region phylogeny of
the Cervinae : speciation in Cervus and its implications for
conservation. Anim. Conserv. 4, 1–11.
Rodr
ıgez, F., Oliver, J.F., Mar
ın, A., Medina, J.R., 1990. The general
stochastic model of nucleotide substitution. J. Theor. Biol. 142,
485–501.
Saiki, R.K., Scharf, S., Faloona, F., 1985. Enzymatic amplification of
beta-globin genomic sequences and restriction site analysis for
diagnosis of sickle cell anemia. Science 230, 1350–1354.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A
Laboratory Manual SE. Cold Spring Harbor Laboratory Press,
USA.
Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002.
TREE-PUZZLE: maximum likelihood phylogenetic analysis
using quartets and parallel computing. Bioinformatics 18, 502–
504.
Schneider, S., Roessli, D., Excoffier, L., 2000. ARLEQUIN Ver. 2.0: A
Software for Population Genetics Data Analysis. Genetics and
Biometry Laboratory, University of Geneva, Switzerland.
Stanley, H.F., Kadwell, M., Wheeler, J.C., 1994. Molecular evolution
of the family Camelidae: a mitochondrial DNA study. Proc. R.
Soc. Lond. B 256, 1–6.
Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsi-
mony (*and Other Methods). Version 4. Sinauer Associates,
Sunderland, Massachusetts.
Tanaka, K., Solis, C.D., Masangkay, J.S., 1996. Phylogenetic rela-
tionship among all living species of the genus Bubalus based on
DNA sequences of the cytochrome bgene. Biochem. Genet. 34,
443–452.
Templeton, A.R., 2001. Using phylogeographic analyses of gene trees
to test species status and processes. Mol. Ecol. 10, 779–791.
Templeton, A.R., Routman, E., Phillips, C.A., 1995. Separating
population structure from population history: a cladistic analysis
1082 C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083
of the geographical distribution of mitochondrial DNA haplotypes
in the tiger salamander, Ambystoma tigrinum. Genetics 140, 767–782.
Templeton, A.R., Sing, C.F., 1993. A cladistic analysis of phenotypic
associations with haplotypes inferred from restriction endonuclease
mapping. IV. Nested analyses with cladogram uncertainty and
recombination. Genetics 134, 659–669.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,
D.G., 1997. The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 25, 4876–4882.
Trense, W., 1989. The Big Game of the World. Paul Parey, Hamburg.
Vrba, A., Schaller, G.B., 2000. Antelopes, Deer, and Relatives: Fossil
Record, Behavioral Ecology, Systematics, and Conservation. Yale
University Press.
Willard, S.T., Flores-Foxworth, G., Chapman, S., Drew, M.L.,
Hughes, D.M., Neuendorff, D.A., Randel, R.D., 1998. Hybridiza-
tion between wapiti (Cervus elephus manitobensis) and sika deer
(Cervus nippon): a comparison of two artificial insemination
techniques. J. Zoo. Wildl. Med. 29 (3), 295–299.
Whitehead, G.K., 1972. The Deer of the World. Constable, London.
C.J. Ludt et al. / Molecular Phylogenetics and Evolution 31 (2004) 1064–1083 1083

Supplementary resources (39)

... The goal of this study was to determine if any of these three possible scenarios (or combination of scenarios) reflects the most appropriate explanation for the elk located in the Trans-Pecos region. Therefore, DNA sequences from the mitochondrial cytochrome-b (Cyt-b) and D-loop control region, and nine microsatellite markers were examined due to their ability to detect differences at the species, subspecies, and population level (Meredith et al. 2005(Meredith et al. , 2007Ludt et al. 2004). To elucidate among these three scenarios, samples from the Davis and Glass mountain ranges were compared to samples collected throughout the range of C. c. nelsoni. ...
... Polymerase chain reaction (PCR) was used to amplify the entire Cyt-b gene (1,140 base pairs). Amplification followed methods from Ludt et al. (2004) using primers LGL766/765 (Bickham et al. 1995;Bickham et al. 2004). D-loop primers (L0, D1, E1, and S0; Douzery and Randi, 1997) were used to amplify a 1,296 base pair region. ...
... Strong support was obtained at the base of clades I and II (posterior probability value of 1.00); however, the genetic divergence between the two clades was small (0.35%). The lack of topological resolution from mitochondrial sequences is similar to that reported in other genetic studies of intraspecific relationships among elk (Ludt et al. 2004). It appears that these genetic markers are not evolving at a sufficient rate to distinguish among populations. ...
Article
Full-text available
Elk (Cervus canadensis) historically are among the most widely distributed members of the deer family, occupying much of the United States, Canada, and northern Mexico. The natural distribution of this species decreased substantially in the early 20 th century, presumably resulting in the extirpation of populations in Texas. In the past 40 years, several herds of free-ranging elk have reappeared in the Trans-Pecos region of Texas. For some herds, it is not known if the origin was: 1) the result of individuals that escaped from captive herds; 2) an expansion of previously transplanted individuals from South Dakota and Oregon into Texas; or 3) the result of natural emigrants from southeastern New Mexico into the Trans-Pecos region. The objective of this study was to use DNA sequences from the mitochondrial cytochrome-b gene and D-Loop region, in combination with nine microsatellite loci, to assess genetic divergence, relationships, and origin(s) of the contemporary elk herds in Texas. Findings of the mitochondrial sequence data depicted a high degree of relatedness among individuals throughout the sampling area; whereas, microsatellite data revealed differences in frequencies of alleles in the Glass Mountain populations of Texas compared to samples from South Dakota, New Mexico, and the Davis Mountains. Further, computer simulations of population genetic parameters based on the mi-crosatellite data supported a scenario depicting the origin of contemporary elk in Texas likely was the result of natural emigrants from New Mexico or descendants of previously introduced individuals from New Mexico. In addition, simulations did not detect evidence of a genetic bottleneck during the past 350 generations, indicating a long, shared history between Texas and New Mexico populations.
... Mitochondrial markers (for a review see Zachos and Hartl 2011) identified in European red deer modern populations three major haplogroups including the several subspecies described for this taxon (Skog et al. 2009 in Italy. C. e. italicus (formerly in haplogroup C) (Ludt et al. 2004;Skog et al. 2009) and haplogroup E occur in Armenia, Crimea, and Southern Russia (Doan et al. 2022). The above distinct mitochondrial DNA (mtDNA) lineages would reflect the main refugia during the Last Glacial Maximum (LGM). ...
... The genetic structure of the red deer in Europe has been widely investigated (Ludt et al. 2004;Skog et al. 2009;Perez-Espona et al. 2009;Niedziałkowska et al. 2011;Fernández-García et al. 2014;Zachos et al. 2016;Rey-Iglesia et al. 2017;Schnitzler et al. 2018;Doan et al. 2022) even though a small percentage of data involved peninsular Italian populations (Lorenzini et al. 2005;Hmwe et al. 2006A, BA;Zachos et al. 2016;Doan et al. 2017Doan et al. , 2022. Doan et al. (2022) also highlighted Italy as one of the countries with the lowest genetic amount of data as to red deer populations. ...
... Therefore, although the original population in ACQUERINO derived from free-ranging individuals captured in North-Eastern Italy (Mazzarone and Mattioli 1996), several unofficial releases from local caged areas may have occurred in the last 50 years, thus contributing to this genetic diversity. Genetic studies on the red deer have involved mitochondrial DNA sequences (Ludt et al. 2004;Skog et al. 2009;Perez-Espona et al. 2009;Niedziałkowska et al. 2011;Fernández-García et al. 2014;Borowski et al. 2016;Schnitzler et al. 2018;Queiròs et al. 2019;Doan et al. 2022) andmicrosatellites (Hwme et al. 2006B;Zachos et al. 2016). These authors have shown that the large-scale genetic structure of European red deer has been shaped by the Late Pleistocene and Holocene glacial-interglacial cycles. ...
Article
The red deer Cervus elephus has been a common species in Italy until the Middle Ages and the Renaissance, when its distribution range started to considerably decrease, due to gradual deforestation and hunting pressure. Afterwards, the red deer has been reintroduced to many regions of the world, including Italy. In the Italian Apennines, the Acquerino-Cantagallo Natural Reserve (ACQUERINO) hosts one of the largest peninsular red deer populations, originated from a series of successful reintroductions. In this study, we meant to detect the level of genetic variability of Acquerino-Cantagallo Natural Reserve deer population and to investigate the genetic relationships with the other Italian and European populations. We identified five mitochondrial DNA control region (D-loop) haplotypes, four falling in lineage A and one falling in lineage C, derived from at least two maternal lineages, confirming that ACQUERINO population should be the result of multiple reintroductions. Haplotype diversity (H = 0.50) and nucleotide (π = 0.004) diversity were low, but included into the deer range values. ACQUERINO population showed low levels of genetic diversity when compared to other European and Mediterranean populations, confirming that this expanding population may have been generated from a low number of founders.
... The report of Dermotherium, Bedenomeryx from Eurasia and Blastomeryx from North America in late Oligocene and early Miocene, and considered to be an ancestor of Cervidae, but latter Blastomeryx assigned under the family Bovidae (Gentry, 1994), and postulate that Cervidae has quick diversifications into several genera and species (Ludt et al., 2004;Lorenzini and Garofalo, 2015;Heckeberg, 2020). The divergence of major cervids lineages was a very short period since this group was originated (DeMiguel et al., 2014). ...
... The cold and arid climate was led to the replacement of forest habitats with open grasslands in Europe and Central Asia which were favoring the diversification, evolution, and dispersal of cervids (Meijaard and Groves, 2004;Gilbert et al., 2006;Lorenzini and Garofalo, 2015;Heckeberg, 2020). The earliest true Cervidae has appeared in the middle Miocene in Central Asia/ Eastern Eurasia (Scott and Janis, 1987;Vislobokova, 1990;Wang et al., 2009;Heckeberg, 2017), while fossils evidence indicate that the origin of cervid may be in the Europe (Heckeberg, 2017) which migrated from central Asia/Eastern Eurasia to Europe in the middle Miocene, and the same time to North America probably through Bering Land Bridge because of no any other records of cervids from North America known before late Miocene (Ludt et al., 2004;Webb, 2000). It can also be possible that same time cervids migrated to the Indian subcontinent (Fig. 11) after the origin of the Himalaya and regression of Tethys Sea due to which formation of lowland platform for the dispersal from Europe to the Indian subcontinent probably via Neotethys (Fig. 11). ...
... It can also be possible that same time cervids migrated to the Indian subcontinent (Fig. 11) after the origin of the Himalaya and regression of Tethys Sea due to which formation of lowland platform for the dispersal from Europe to the Indian subcontinent probably via Neotethys (Fig. 11). This hypothesis is also supported by the mitochondrial (DNA) studies of recent cervids and suggested that the Cervidae originated from Central Asia/Eastern Eurasia and migrated to the Indian subcontinent, Europe and Europe to North America (Ludt et al., 2004), while the dispersal from North America to South America was through the Isthmus land bridge during the late Pliocene (Webb, 2000). ...
Article
Limb bones of Cervus sp. have been recovered for the first time from the lower Karewa Formation (Hirpur Formation) exposed along the River Romushi, Khaigam, Pakharpora, Budgam District, Jammu and Kashmir, India. The 28 main morphological characters of present fossil tibia, astragalus, calcaneus, cubionavicular, ectomesocueiform and metatarsal have been selected to compare with the fossils and recent limb bones of eleven species of Cervidae, including Cervus elaphus (red deer), Odocoileus hemionus (mule deer), O. virginianus (white-tail deer), Dama dama (fallow deer), Capreolus capreolus (roe deer), Muntiacus reevesi (Reeve's muntjuk), Hydropotes inermis (Chinese water deer), Alces alces (moose deer), Megaloceros giganteus (Irish elk deer), Cervalces sp. (Elkmoose deer), Arvernocrous ardei, and three outgroup taxa, such as Giraffidae, Bovidae and Camelidae. It shows that the maximum characters of limb bones have close affinities with the Cervus elaphus and presumably, these bones refer to Cervus sp. The study also suggests that the Cervidae originated from Eastern Eurasia/ Asia in the late Oligocene or early Miocene and migrated to Europe and the Indian subcontinent during the middle Miocene. The functional morphology (ecomorphology) of limb bones supports the hypothesis that the Cervus sp. have had a cursorial habitat and lived in an open forest (forest and grassland).
... Red deer Cervus elaphus stags produce their rutting calls for attracting potential mates and deterring competitive males (Clutton-Brock and Albon 1979). Studies of acoustic variation of stag rutting calls (Frey et al. 2012;Passilongo et al. 2013;Della Libera et al. 2015;Volodin et al. 2015aVolodin et al. ,b, 2019Golosova et al. 2017) are in agreement with the subdivision of red deer to phylogenetic lineages (Mahmut et al. 2002;Ludt et al. 2004;Skog et al. 2009;Zachos and Hartl 2011;Zachos et al. 2016). The acoustics of stag rutting calls proved to be helpful population markers in red deer (Frey et al. 2012;Passilongo et al. 2013;Volodin et al. 2019) in addition to the genetic markers, such as mtDNA and microsatellites (Feulner et al. 2004;Niedziałkowska et al. 2012;Krojerova-Prokešova et al. 2015;Carranza et al. 2016;Zachos et al. 2016). ...
... However, for the easternmost red deer populations of European parts of Russia (Caucasian and Voronezh), data on the acoustics of stag rutting roars are scarce or lacking. For the native Caucasian red deer C.e. maral population of the Caucasian region of Russia (Ludt et al. 2004;Trepet and Eskina 2017), only a few spectrograms of stag rutting roars were published (Nikol'skii et al. 1979). For the introduced Voronezh red deer C.e. hippelaphus population of Southern Russia (Kuznetsova et al. 2012(Kuznetsova et al. , 2013Likhatsky et al. 2012), only the dynamics of male roaring were investigated (Rusin et al. 2021), whereas the acoustics of the rutting roars have yet to be studied. ...
... After the Late Pleistocene glacial maximum occurred 25-12 thousand years ago (Clark et al. 2009), the species Cervus elaphus recolonized Europe (Ludt et al. 2004;Skog et al. 2009;Zachos and Hartl 2011;Niedziałkowska et al. 2021). Recolonization started from the three main refugia, corresponding to red deer mitochondrial DNA (mtDNA) lineages A, B, and C (Ludt et al. 2004;Skog et al. 2009;Niedziałkowska et al. 2011Niedziałkowska et al. , 2021. ...
Article
Full-text available
This study investigates a population of red deer Cervus elaphus, founded by 10 individuals introduced in the nineteenth century from Germany to the Voronezh region of the European part of Southern Russia and then developed without further introductions. We characterize for the first time the vocal phenotype of the Voronezh red deer male rutting calls in comparison with similar data on the Pannonian (native Central European) and Iberian (native West European) red deer obtained by the authors during preceding studies. In addition, we provide for the first time the genetic data on Pannonian red deer. In Voronezh stags, the number of roars per bout (2.85 ± 1.79) was lower than in Pannonian (3.18 ± 2.17) but higher than in Iberian (2.11 ± 1.71) stags. In Voronezh stags, the duration of main (the longest within bouts) roars was longer (2.46 ± 1.14 s) than in Pannonian (1.13 ± 0.50 s) or Iberian (1.90 ± 0.50 s) stags. The maximum fundamental frequency of main roars was similar between Voronezh (175 ± 60 Hz) and Pannonian (168 ± 61 Hz) but higher in Iberian stags (223 ± 35 Hz). Mitochondrial cytochrome b gene analysis of red deer from the three study populations partially supports the bioacoustical data, of closer similarity between Voronezh and Pannonian populations. In contrast, microsatellite DNA analysis delineates Voronezh red deer from either Pannonian or Iberian red deer. We discuss that population bottlenecking might affect the acoustics of the rutting roars, in addition to genotype.
... The common and scientific species names for our three study species are taken from Burgin et al. (2020). For red deer, we additionally considered Ludt et al. (2004) and Zachos and Hartl (2011) ...
... Interestingly, wapiti (Cervus canadensis), a Cervus species that is more closely related to sika deer than western red deer (Heckeberg, 2020;Ludt et al., 2004), emit bugle vocalizations during the rut that contain both a whistle component with a very high fundamental frequency (g 0 ) as well as a low fundamental frequency (f 0 ) produced by their proportionately large, low-positioned and mobile larynx (Frey & Riede, 2013;Reby et al., 2016). In red deer and fallow deer the relative thyrohyoid muscle length is larger in the males than in the females, whereas the relative lengths of the sternohyoid and sternothyroid muscles are smaller in the males than in the females as a consequence of the lower larynx position in the males (Table 3). ...
Article
Full-text available
Eurasian deer are characterized by the extraordinary diversity of their vocal repertoires. Male sexual calls range from roars with relatively low fundamental frequency (hereafter fo) in red deer Cervus elaphus, to moans with extremely high fo in sika deer Cervus nippon, and almost infrasonic groans with exceptionally low fo in fallow deer Dama dama. Moreover, while both red and fallow males are capable of lowering their formant frequencies during their calls, sika males appear to lack this ability. Female contact calls are also characterized by relatively less pronounced, yet strong interspecific differences. The aim of this study is to examine the anatomical bases of these inter-specific and inter-sexual differences by identifying if the acoustic variation is reflected in corresponding anatomical variation. To do this, we investigated the vocal anatomy of male and female specimens of each of these three species. Across species and sexes, we find that the observed acoustic variability is indeed related to expected corresponding anatomical differences, based on the source-filter theory of vocal production. At the source level, low fo is associated with larger vocal folds, whereas high fo is associated with smaller vocal folds: sika deer have the smallest vocal folds and male fallow deer the largest. Red and sika deer vocal folds do not appear to be sexually dimorphic, while fallow deer exhibit strong sexual dimorphism (after correcting for body size differences). At the filter level, the variability in formants is related to the configuration of the vocal tract: in fallow and red deer, both sexes have evolved a permanently descended larynx (with a resting position of the larynx much lower in males than in females). Both sexes also have the potential for momentary, call-synchronous vocal tract elongation, again more pronounced in males than in females. In contrast, the resting position of the larynx is high in both sexes of sika deer and the potential for further active vocal tract elongation is virtually absent in both sexes. Anatomical evidence suggests an evolutionary reversal in larynx position within sika deer, that is, a secondary larynx ascent. Together, our observations confirm that the observed diversity of vocal behaviour in polygynous deer is supported by strong anatomical differences, highlighting the importance of anatomical specializations in shaping mammalian vocal repertoires. Sexual selection is discussed as a potential evolutionary driver of the observed vocal diversity and sexual dimorphisms.
... Discordance between mitochondrial and nuclear phylogenies is widespread, and within Cervidae it is particularly well-known with regard to C. elaphus and C. canadensis. The two are morphologically very similar (to the point that they have often been considered conspecific), but mtDNA consistently placed C. nippon (and sometimes even other Cervus species) as closer to C. canadensis than C. elaphus (Hassanin et al., 2012;Heckeberg, 2020;Kuwayama & Ozawa, 2000;Lorenzini & Garofalo, 2015;Ludt et al., 2004;Polziehn & Strobeck, 1998;Randi et al., 2001). This has usually been considered an example of a misleading gene tree, and indeed, the first nuclear analysis recently resulted in red deer and wapiti being sister taxa to the exclusion of all other Cervus species, sika included (Hu et al., 2019). ...
Article
Full-text available
Antlers are the most conspicuous trait of cervids and have been used in the past to establish a classification of their fossil and living representatives. Since the availability of molecular data, morphological characters have generally become less important for phylogenetic reconstructions. In recent years, however, the appreciation of morphological characters has increased, and they are now more frequently used in addition to molecular data to reconstruct the evolutionary history of cervids. A persistent challenge when using antler traits in deer systematics is finding a consensus on the homology of structures. Here, we review early and recent attempts to homologise antler structures and objections to this approach, compare and evaluate recent advances on antler homologies, and critically discuss these different views in order to offer a basis for further scientific exchange on the topic. We further present some developmental aspects of antler branching patterns and discuss their potential for reconstructing cervid systematics. The use of heterogeneous data for reconstructing phylogenies has resulted in partly conflicting hypotheses on the systematic position of certain cervid species, on which we also elaborate here. We address current discussions on the use of different molecular markers in cervid systematics and the question whether antler morphology and molecular data can provide a consistent picture on the evolutionary history of cervids. In this context, special attention is given to the antler morphology and the systematic position of the enigmatic Pere David's deer (Elaphurus davidianus). This article is protected by copyright. All rights reserved.
... Evolution is a continuous process that does not occur in discrete steps. Thus, the classification of "evolving live forms" into discrete or distinct species is always problematic regardless of whether they are bacteria or higher organisms, such as herring gulls (Liebers et al., 2004), or cervids (Ludt et al., 2004). This distinction cannot be made without a certain element of arbitrariness. ...
Article
Full-text available
The phylogenetic tree of the Staphylococcus aureus complex consists of several distinct clades and the majority of human and veterinary S. aureus isolates form one large clade. In addition, two divergent clades have recently been described as separate species. One was named Staphylococcus argenteus, due to the lack of the “golden” pigment staphyloxanthin. The second one is S. schweitzeri, found in humans and animals from Central and West Africa. In late 2021, two additional species, S. roterodami and S. singaporensis, have been described from clinical samples from Southeast Asia. In the present study, isolates and their genome sequences from wild Straw-coloured fruit bats (Eidolon helvum) and a Diamond firetail (Stagonopleura guttata, an estrildid finch) kept in a German aviary are described. The isolates possessed staphyloxanthin genes and were closer related to S. argenteus and S. schweitzeri than to S. aureus. Phylogenetic analysis revealed that they were nearly identical to both, S. roterodami and S. singaporensis. We propose considering the study isolates, the recently described S. roterodami and S. singaporensis as well as some Chinese strains with MLST profiles stored in the PubMLST database as different clonal complexes within one new species. According to the principle of priority we propose it should be named S. roterodami. This species is more widespread than previously believed, being observed in West Africa, Southeast Asia and Southern China. It has a zoonotic connection to bats and has been shown to be capable of causing skin and soft tissue infections in humans. It is positive for staphyloxanthin, and it could be mis-identified as S. aureus (or S. argenteus) using routine procedures. However, it can be identified based on distinct MLST alleles, and “S. aureus” sequence types ST2470, ST3135, ST3952, ST3960, ST3961, ST3963, ST3965, ST3980, ST4014, ST4075, ST4076, ST4185, ST4326, ST4569, ST6105, ST6106, ST6107, ST6108, ST6109, ST6999 and ST7342 belong to this species.
Preprint
Background: Hangul ( Cervus hanglu hanglu ) or Kashmiri stag belongs to the family Cervidae and is the only surviving red deer in the Indian subcontinent. Its complete mitogenome sequence is lacking in the open database for further phylogenetic inferences. Methods and results: We sequenced and characterized the first complete mitogenome of Hangul, which was 16,354 bp in length. It was compared with other red deer subspecies. We observed eight pairs of overlapping genes and 15 intergenic spacers in between the mitochondrial regions. Relative synonymous codon usage (RSCU) for the 13 PCGs of Hangul consisted of 3597 codons (excluding stop codons). We observed a highest frequency for leucine (11.75%) and the lowest for tryptophan amino acid (1.12%) in 13 PCGs of Hangul. All the tRNA genes showed a typical secondary cloverleaf arrangement, excluding tRNA-Ser in which dihydrouridine arm did not form a stable structure. Conclusions: The Bayesian inference phylogenetic tree indicated that Hangul clustered within the Tarim deer group ( C. h. yarkandensis ) and closed to C. e. hippelaphus , which formed the western clade. Besides, the subspecies of C. nippon and C. canadensis clustered together and formed an eastern clade. The finding was supported by the mean pairwise genetic distance based on both complete mitogenome and 13 PCGs. The comparative study of the Hangul mitogenome with other red deer provides crucial information for understanding the evolutionary relationships. It offers a valuable resource for conserving this critically endangered cervid with a limited distribution range.
Article
Full-text available
There are about 150 Cervidae species on the IUCN Red List of Threatened Species. Only a small part is counted among farm animals, and most of them are free roaming. The universality and large numbers of representatives of cervids such as red deer (Cervus elaphus) and roe deer (Capreolus capreolus) may predispose these species to be used as models for research on reintroduction or assisted reproduction of deer at risk of extinction. We outlined the historical fluctuation of cervids in Europe and the process of domestication, which led to breeding management. Consequently, the reproductive techniques used in domestic ruminants were adapted for use in female deer which we reviewed based on our results and other available results. We focused on stress susceptibility in cervids depending on habitat and antropopression and proposed copeptin as a novel diagnostic parameter suitable for stress determination. Some reproductive biotechniques have been adopted for female cervids with satisfactory results, e.g., in vitro fertilization, while others still require methodological refinement, e.g., cryopreservation of oocytes and embryos.
Article
Full-text available
The species Cervus elaphus is characterised by its significant and very swift ability to adapt to the broad woodland-related range of environments in the northern hemisphere, as can be seen by the large number of distinct populations and living subspecies. From studies on the phenotypic plasticity and adaptative capability of living populations of red deer, we can hypothesise that environmental conditions influenced the spread and the evolution of the species, especially in changing landscapes like those of the Italian peninsula during the Middle and Late Pleistocene. In fact, Cervus elaphus occurs on the Italian peninsula from the Middle Pleistocene, a period characterised by a particularly wide variety of environments determined by changeable palaeoclimatic and palaeogeographical conditions that are in all cases more significant in the late Middle Pleistocene and in the Late Pleistocene. If we observe the various fossil subspecies and apply the principle that present features like phenotypic plasticity are important keys to understanding the past, we must reconsider the Pleistocene red deer in evolutionary and taxonomic terms. This reappraisal also provides new data on the biochronological importance of the various red deer subspecies widespread in Italy during the Middle and Late Pleistocene.
Article
Full-text available
Intraspecific variation in mitochondrial DNA of North American cervids was assessed with restriction enzymes to determine relationships among populations and subspecies. No variation was detected in moose (Alces alces) and little in elk (Cervus elaphus). Caribou (Rangifer tarandus), white-tailed deer (Odocoileus virginianus), and mule deer (Odocoileus hemionus) possessed considerable variation. Characteristic genotypes exist in caribou and white-tailed deer from different geographic areas although subspecies are not discernable as distinct mtDNA assemblages. Except for O. hemionus, intraspecific mtDNA sequence divergences are small (< 2%). Subspecies of mule deer have divergent mtDNA (7%) and are the only subspecies of cervids with distinct genotypes.
Article
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
Article
A new method called the neighbor-joining method is proposed for reconstructing phylogenetic trees from evolutionary distance data. The principle of this method is to find pairs of operational taxonomic units (OTUs [= neighbors]) that minimize the total branch length at each stage of clustering of OTUs starting with a starlike tree. The branch lengths as well as the topology of a parsimonious tree can quickly be obtained by using this method. Using computer simulation, we studied the efficiency of this method in obtaining the correct unrooted tree in comparison with that of five other tree-making methods: the unweighted pair group method of analysis, Farris's method, Sattath and Tversky's method, Li's method, and Tateno et al.'s modified Farris method. The new, neighbor-joining method and Sattath and Tversky's method are shown to be generally better than the other methods.
Article
Broadleaved evergreen sclerophyllous taxa occupied a subhumid belt across much of North America-Eurasia by the middle Eocene. They originated from alliances in older laurophyllous forests that adapted to spreading dry climate. Since the continued trend to aridity finally restricted sclerophyllous vegetation to subhumid areas separated by drier tracts, it now occurs in areas with summer rain as well as in summer-dry mediterranean climates. Taxa of chaparral and macchia habit are common undershrubs in sclerophyll woodlands, to which they are seral. Shrublands spread only recently, though the adaptive structural features of the taxa are ancient and probably not pyrogenic. The history of Madrean-Tethyan sclerophyll vegetation illuminates three biogeographic problems. First, related taxa that link the Mediterranean-California areas are part of the larger problem of ties between these areas and those of summer rainfall, of taxa now in summer-rain areas that were in presently summer-dry areas into the early Pleistocene, and of the more numerous taxa that linked sclerophyllous vegetation of the Madrean-Tethyan regions during the Tertiary. The ties between summer-dry and summer-wet areas are relicts of the Neogene; taxa now in mediterranean-climate areas adapted functionally to these new climates during the Pleistocene; and most trans-Atlantic links owe to migration across a narrower ocean with more numerous islands, to a broader zone of subhumid climate, and to a more easterly trending Appalachian axis with numerous dry edaphic sites. Second, by the mid-Oligocene spreading dry climate had confined a formerly continuous temperate rainforest to southern Mexico, the West coast and the Appalachian area. Winter cold and summer drought exterminated it in the West, whereas in the East winter cold eliminated most evergreen dicots, leaving a dominantly deciduous hardwood forest there. The temperate "Appalachian disjuncts" in southern Mexico are therefore ancient, and did not migrate south to enter a forest previously without deciduous hardwoods, as others maintain. Third, the Canarian laurel forest derived its taxa from those in laurophyllous forests that covered northern Africa into the middle Miocene, not by southward migration from southern Europe in the Pliocene. Since many shrubs in the surviving laurel forest also contribute to macchia on bordering slopes, the ancient origin of their typical adaptive structural features is clearly implied.
Book
— We studied sequence variation in 16S rDNA in 204 individuals from 37 populations of the land snail Candidula unifasciata (Poiret 1801) across the core species range in France, Switzerland, and Germany. Phylogeographic, nested clade, and coalescence analyses were used to elucidate the species evolutionary history. The study revealed the presence of two major evolutionary lineages that evolved in separate refuges in southeast France as result of previous fragmentation during the Pleistocene. Applying a recent extension of the nested clade analysis (Templeton 2001), we inferred that range expansions along river valleys in independent corridors to the north led eventually to a secondary contact zone of the major clades around the Geneva Basin. There is evidence supporting the idea that the formation of the secondary contact zone and the colonization of Germany might be postglacial events. The phylogeographic history inferred for C. unifasciata differs from general biogeographic patterns of postglacial colonization previously identified for other taxa, and it might represent a common model for species with restricted dispersal.