The Chromatin-Remodeling BAF Complex Mediates Cellular Antiviral Activities by Promoter Priming

Article (PDF Available)inMolecular and Cellular Biology 24(10):4476-86 · June 2004with25 Reads
DOI: 10.1128/MCB.24.10.4476-4486.2004 · Source: PubMed
Abstract
The elicitation of cellular antiviral activities is dependent on the rapid transcriptional activation of interferon (IFN) target genes. It is not clear how the interferon target promoters, which are organized into chromatin structures in cells, rapidly respond to interferon or viral stimulation. In this report, we show that alpha IFN (IFN-α) treatment of HeLa cells induced hundreds of genes. The induction of the majority of these genes was inhibited when one critical subunit of the chromatin-remodeling SWI/SNF-like BAF complexes, BAF47, was knocked down via RNA interference. Inhibition of BAF47 blocked the cellular response to viral infection and impaired cellular antiviral activity by inhibiting many IFN- and virus-inducible genes. We show that the BAF complex was required to mediate both the basal-level expression and the rapid induction of the antiviral genes. Further analyses indicated that the BAF complex primed some IFN target promoters by utilizing ATP-derived energy to maintain the chromatin in a constitutively open conformation, allowing faster and more potent induction after IFN-α treatment. We propose that constitutive binding of the BAF complex is an important mechanism for the IFN-inducible promoters to respond rapidly to IFN and virus stimulation.
MOLECULAR AND CELLULAR BIOLOGY, May 2004, p. 4476–4486 Vol. 24, No. 10
0270-7306/04/$08.000 DOI: 10.1128/MCB.24.10.4476–4486.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
The Chromatin-Remodeling BAF Complex Mediates Cellular Antiviral
Activities by Promoter Priming
Kairong Cui,
1
Prafullakumar Tailor,
2
Hong Liu,
1
Xin Chen,
3
Keiko Ozato,
2
and Keji Zhao
1
*
Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute,
1
and Laboratory of Molecular Growth
Regulation, National Institute of Child Health and Human Development,
2
National Institutes of Health,
Bethesda, Maryland 20892, and Department of Biopharmaceutical Sciences, University of
California, San Francisco, California 94143
3
Received 26 September 2003/Returned for modification 4 December 2003/Accepted 11 February 2004
The elicitation of cellular antiviral activities is dependent on the rapid transcriptional activation of inter-
feron (IFN) target genes. It is not clear how the interferon target promoters, which are organized into
chromatin structures in cells, rapidly respond to interferon or viral stimulation. In this report, we show that
alpha IFN (IFN-) treatment of HeLa cells induced hundreds of genes. The induction of the majority of these
genes was inhibited when one critical subunit of the chromatin-remodeling SWI/SNF-like BAF complexes,
BAF47, was knocked down via RNA interference. Inhibition of BAF47 blocked the cellular response to viral
infection and impaired cellular antiviral activity by inhibiting many IFN- and virus-inducible genes. We show
that the BAF complex was required to mediate both the basal-level expression and the rapid induction of the
antiviral genes. Further analyses indicated that the BAF complex primed some IFN target promoters by
utilizing ATP-derived energy to maintain the chromatin in a constitutively open conformation, allowing faster
and more potent induction after IFN- treatment. We propose that constitutive binding of the BAF complex
is an important mechanism for the IFN-inducible promoters to respond rapidly to IFN and virus stimulation.
As an important host defense mechanism against virus in-
fection, the type 1 interferons (IFNs) are rapidly induced to
activate antiviral activities in infected and neighboring unin-
fected cells. Upon the binding of alpha IFN (IFN-) to its cell
surface receptor, the signal transducer and the activator of
transcription proteins (STAT1 and STAT2) become tyrosine
phosphorylated and associate with p48 (IRF-9/ISGF3)to
form the trimeric ISGF3 complex. ISGF3 is relocated to the
nucleus and binds to the IFN-stimulated response elements
(ISREs) to activate the transcription of target genes (7, 23, 36).
Viral infection as well as stimulation by double-stranded RNA
poly(I)/poly(C) induces type 1 IFN genes (such as IFN-) and
a set of IFN-inducible genes. The antiviral efficiency of this
system depends on the rapid transcriptional induction of a
number of IFN target genes. It has been suggested that the
chromatin structure plays important roles in the regulation of
the IFN target genes (3, 5, 29). The chromatin-remodeling
BAF or hSWI/SNF complexes (17, 19, 42) have been reported
to elevate the basal-level expression and the induction of a
subset of IFN-inducible genes (16, 24, 25). However, it is not
clear whether the BAF complexes are required for the cellular
antiviral activities, and it is not known how the chromatin
structure controls the readiness of a promoter to be activated
by IFN or viral infection and how the chromatin structure itself
is controlled.
The ATP-utilizing chromatin-remodeling complexes are im-
plicated in mediating gene activation in vitro and in vivo by
antagonizing chromatin-mediated repression (1, 11, 14, 26, 37,
39, 44). The current view is that upon stimulation, the chro-
matin-remodeling complexes are recruited to their target pro-
moters, where they alter the local chromatin structure to fa-
cilitate subsequent assembly of the transcription machinery
and therefore transcriptional activation (2, 6, 8, 22, 30, 32). In
order to clarify how the chromatin barrier is overcome for
rapid induction upon stimulation, we analyzed the function
and mechanism of the BRG1-containing complexes in the
IFN-mediated antiviral activities. BRG1 itself, which is the
essential ATPase of the complexes, was found to contain nu-
cleosome remodeling activity in an in vitro assay. BAF47 (also
known as INI1) is required for the elevated remodeling activity
of BRG1 in vitro, and its yeast homologue, Snf5p, coordinates
the assembly and remodeling activity of the yeast SWI/SNF
complex in vivo (12, 18, 31, 42). Moreover, mutations of
BAF47 have been linked to tumor formation in both human
and mouse models (13, 21, 33, 40). Therefore, we inhibited the
BAF complexes by expressing a small interference RNA
(siRNA) targeting BAF47 in HeLa cells. We found that the
BAF complex is required for transcriptional induction of the
majority of IFN-- and virus-inducible genes. Our data indi-
cate that the BAF complex plays essential roles in cellular
antiviral activities by controlling the chromatin structures of
the genes involved in the pathways.
MATERIALS AND METHODS
Cell culture, RNA interference construct, and transfection. SW-13 cells and
HeLa cells were maintained in Dulbecco modified Eagle medium supplemented
with 10% fetal calf serum and 1% penicillin-streptomycin mix and transfected
with Superfect transfecting reagent as described previously (25). The RNA
interference construct targeting BAF47 was constructed by inserting the cDNA
sequence of BAF47 (positions 912 to 934; 5GGACATGTCAGAGAAG
GAGAAC3) into pBS-U6 as described previously (38). The BAF47 sequence
together with the U6 promoter was then subcloned into pREP4-puro, which was
generated by deleting the RSK promoter and replacing the hygromycin B selec-
tion marker with puromycin in pREP4 (25). For RNA interference assays, HeLa
* Corresponding author. Mailing address: 9000 Rockville Pike,
Building 10, Room 7N311, Bethesda, MD 20892-1674. Phone: (301)
496-2098. Fax: (301) 480-0961. E-mail: zhaok@nhlbi.nih.gov.
4476
cells were transfected with the siRNA constructs and selected in 1 g of puro-
mycin/ml for 2 days, followed by DNA microarray, reverse transcription (RT)-
PCR, restriction enzyme accessibility, and viral infection analyses.
RT-PCR analysis. RT-PCR analyses for the experiments shown in Fig. 1, 2,
and 3 were performed as described previously (25) by using total RNAs isolated
from HeLa cells treated with 500 U of IFN- per ml (8 h), 10 g of poly(I)/
poly(C) per ml (6 h), or virus (0 to 24 h).
RT-PCR analyses for the experiments shown in Fig. 5 were performed as
described below. SW-13 cells and HeLa cells grown in Dulbecco modified Eagle
medium supplemented with 1% fetal calf serum and 1% penicillin-streptomycin
mix were treated with 500 U of IFN-/ml for various times. Total RNAs were
extracted with TRIzol reagent (Invitrogen) and reverse transcribed by using the
oligo(dT) 12-18 primer with an Invitrogen kit (catalog no. 12371-019). The
cDNA (20 ng) was amplified with IFITM1, ISG15, or actin-specific primers for
12 cycles under PCR conditions of 94°C for 30 s, 55°C for 30 s, and 72°C for 1
min. One-tenth of the PCR product was slot blotted onto a nylon membrane and
detected by hybridization with a
32
P-labeled cDNA probe amplified with the
same primers. The membranes were visualized by autoradiography or quantified
by PhosphorImager analysis. Histograms were plotted after normalization to
actin signals.
ChIP. The chromatin immunoprecipitation (ChIP) assays were performed as
described previously (24). The antibodies used were BRG1 (19), AcH4 (41),
Plo II (sc-9001; Santa Cruz), STAT (S21220; Transduction Laboratories), and
p48 (sc-496; Santa Cruz). For the detection of the ChIP products, IFITM1
promoter primers 5CCAACACTTAGGAAGTCACTAGTC3 (197F) (for-
ward) and 5CTCCTTTCCCCTGTCGTTTCAGTT3 (reverse), the IFITM1 3
untranslated-region primers 5CGGTCCTGTGACCCCTTAATGGT3 (for-
ward) and 5GTTGGGAAGACAGCTTCGACTCC3 (reverse), and the CSF1
far-upstream-region primers 5CACTATGTTAGCCAGGATGGTCTC3 (for-
ward) and 5CTCTTCCTCCTGATAGCTCCATGA3 (reverse) were used.
Nucleosome mapping and restriction enzyme accessibility assays. The nucleo-
somal structure of the IFITM1 promoter was mapped by using microccocal
nuclease and ligation-mediated PCR as described previously (24). The restriction
enzyme accessibility assays were performed according to a published procedure
(43) with the following modifications. SW-13 cells transfected with pBJ5-BRG1
for 24 h or HeLa cells were treated with 500 U of IFN-/ml for various times.
The nuclei isolated from the cells were digested with 2 l of HgiAI or AvaII (20
U) for 10 min at 37°C, followed by the addition of 150 l of stop buffer (10 mM
Tris [pH 7.5], 10 mM EDTA, 0.4% sodium dodecyl sulfate, 0.6 mg of proteinase
K/ml) and incubation at 50°C for 3 h. The DNA (2 g) purified by phenol-
chloroform extraction and precipitation was digested to completion with 1 lof
BclI (10 units) in 50 l of the restriction buffer for2hat55°C. Following Klenow
enzyme treatment to blunt the DNA ends, the DNA was ligated to a universal
linker (28). The cleavage sites were detected by PCR with reaction mixtures
containing 10 l of DNA, 5 lof10 PCR buffer [(NH
4
)
2
SO
4
], 5 lof25mM
MgCl
2
,5l of 1 mM deoxynucleoside triphosphates, 2 lof2.5M long
universal primer, 2 lof2.5M gene-specific primer (IFITM1/197F), 20 lof
H
2
O, and 1 lofTaq polymerase (5 U) under the following conditions: 25 cycles
of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, followed by 72°C for 5 min.
The PCR products were labeled by the addition of
32
P-labeled IFITM1/170F
(5ACTTGAGTTTCTGATGAGGAAGCC3) to a concentration of 0.05 M
and subjected to two PCR cycles of 94°C for 2 min, 55°C for 2 min, and 72°C for
2 min. The labeled products were purified and resolved on 9% acrylamide–6 M
urea–1 Tris-borate-EDTA gel and visualized by autoradiography and quanti-
tated by PhosphorImager analysis.
Viral infection. Equal numbers (1 10
5
) of control and BAF-inhibited HeLa
cells were infected with Newcastle disease virus (NDV) (100 hemolytic units
[HU]/ml) for 1 h. Following infection, virus was washed off and cells were
incubated in the media described above for the indicated time periods. To study
the effect of IFN on virus replication, cells were infected with various doses of
virus (0.01, 1, and 100 HU/ml) with or without the addition of IFN- (1,000
U/ml). IFN was added 18 h prior to infection and was present throughout
infection (20). cDNA was prepared by using Superscript II RNase H
reverse
transcriptase (Invitrogen) and random primers. The NDV nucleocapsid protein
(NP) transcripts were measured as indices of viral replication (34). For real-time
PCR, the amplification of cDNA was monitored by using SYBER Green PCR
master mix (Applied Biosystems) in combination with the 7000 sequence detec-
tion system (ABI-PRISM). Transcript levels were normalized by GAPDH (glyc-
eraldehyde-3-phosphate dehydrogenase), expressed at comparable levels in con-
trol and BAF-inhibited cells. Primer sequences used for real-time PCR are
available on request.
RESULTS
The BAF complex is required for the basal and induced
levels of expression of the majority of the IFN--inducible
genes. In order to determine the requirement for the BAF
complexes in the IFN signaling pathways, we specifically
knocked down BAF47/INI1/hSNF5, a critical subunit of the
BRG1- and hBRM-containing complexes, by RNA interfer-
ence. Transfection of HeLa cells with an episomal BAF47
RNA interference construct for 2 days resulted in complete
inhibition of the BAF47 protein (Fig. 1A). Furthermore, both
BRG1 and BRM were also significantly down-regulated (Fig.
1A), possibly by the decreased stability in the absence of
BAF47. These experiments suggest that the function of the
BRG1- and BRM-containing complexes could be severely
compromised through the expression of the siRNA targeting
BAF47 in the cell. Therefore, mRNA samples were isolated
from HeLa cells transfected with the RNA interference con-
struct and were analyzed by DNA microarrays. The analysis
revealed that approximately 2.5% of the genes were repressed
and that 0.5% were activated more than threefold among the
44,000 cDNA and expressed sequence tag sequences (data not
shown). In sharp contrast to the low percentage of affected
genes in the whole genome, the expression of more than 90%
of the IFN--inducible genes was significantly down-regulated
in cells expressing the BAF47 siRNA (Fig. 1B, compare lanes
2 and 4, and data not shown). Moreover, upon IFN- stimu-
lation, the induction of these inducible genes was either dra-
matically reduced or completely inhibited (Fig. 1B, compare
lanes 1 and 3, and data not shown). The strongly inhibited
genes included those encoding the well-characterized antiviral
proteins such as the double-stranded RNA-dependent protein
kinase (PKR), the 2-5A system (OAS1, OAS2, and OAS3),
IFITM1, and the Mx proteins (36). The inhibition by the
BAF47 siRNA was not caused by nonspecific activity of anti-
sense RNA, since another siRNA construct, which targeted a
different region of the BAF47 sequence but was not able to
knock down the BAF47 mRNA, failed to inhibit the cellular
response to IFN- stimulation (data not shown). These data
strongly suggest the BAF complex is required for the normal
function of the IFN signaling pathways.
Knockdown of the BAF complex significantly inhibited the
cellular response to poly(I)/poly(C). To mimic the cellular
response to viral infection, control and BAF-inhibited
(siBAF47) HeLa cells were treated with double-stranded RNA
poly(I)/poly(C) and examined for the expression of IFN-induc-
ible genes. These experiments were of interest, since the
above-described microarray analysis found toll-like receptor 3
(TLR3) to be constitutively reduced in BAF-inhibited cells.
TLR3 specifically recognizes double-stranded RNA and is re-
quired for the poly(I)/poly(C) induction of IFN target genes
(4). As shown in Fig. 1C, poly(I)/poly(C) induced the expres-
sion of many antiviral genes, such as the Mx1, PKR, OAS3, and
IFITM1 genes, in control cells. However, the induction of
these genes was dramatically reduced or abolished in cells in
which the BAF complex was inhibited. These results indicate
that the establishment of antiviral activities is severely im-
paired when the BAF complex is inhibited.
The BAF complex is required for the elicitation of cellular
antiviral activities upon viral infection. To study whether the
VOL. 24, 2004 PROMOTER PRIMING BY THE BAF COMPLEX 4477
inhibition of the BAF complex affects cells’ ability to control
viral infection, control and BAF-inhibited HeLa cells were
infected with NDV. Infected cells were tested first for the
induction of the IFN- gene, an immediate early IFN gene
important for establishing an antiviral state in the cells (36).
Real-time RT-PCR analysis (Fig. 2A) showed that IFN- tran-
script levels were markedly elevated after viral infection in
control cells but that transcript levels were much lower in
siBAF47 cells at all three time points tested. The inhibition of
IFN- transcription was less severe at the 24-h point than the
6- and 12-h points. Therefore, we examined whether the extent
of the BAF47 knockdown diminishes at the 24-h point. As
shown in Fig. 2A, no difference in BAF47 knockdown levels
was observed during the course of stimulation. These experi-
FIG. 1. The BAF complex is required for cellular responses to IFN- and poly(I)/poly(C) stimulation. (A) BAF47 was efficiently knocked down
by RNA interference. HeLa cells were transfected with a control vector (lane 1) or a siRNA construct targeting BAF47 (lane 2) and selected for
2 days in puromycin. The remaining cells were lysed and analyzed by Western blotting with antibodies against BAF47, BRG1, BRM, or actin.
(B) The BAF complex is required for the induction of IFN target genes by IFN-. HeLa cells were transfected with the siRNA construct targeting
BAF47 (siBAF47) and selected for 2 days with puromycin. Following stimulation with 500 U of IFN-/ml for 8 h, the total RNAs were isolated
for RT-PCR analysis with the primers indicated on the left sides of the panels. (C) The BAF complex is required for the induction of IFN target
genes by poly(I)/poly(C). HeLa cells were transfected and selected as described above. Following stimulation with poly(I)/poly(C), total RNAs
were isolated and analyzed as described above.
4478 CUI ET AL. MOL.CELL.BIOL.
ments suggest that the BAF complex is required for the rapid
and full induction of IFN-. Consistent with the data for
poly(I)/poly(C), the induction of all antiviral proteins shown in
Fig. 1C was markedly attenuated or completely blocked in
siBAF47 HeLa cells after NDV infection, while these genes
were robustly induced in control cells (data not shown). We
next assessed whether inhibition of the BAF complex has an
effect on viral replication. To this end, the levels of the NDV
NP transcripts were measured by real-time RT-PCR at various
time points following infection (Fig. 2B). In siBAF47 cells,
levels of viral transcripts increased more than 70-fold by 24 h,
while the transcripts in control cells increased less than 15-fold
over the same period. These results indicate that inhibition of
the BAF complex reduces cells’ ability to control viral growth,
most likely by inhibiting the expression of IFN- and other
antiviral proteins. To examine whether the inhibition of the
BAF complex compromises IFNs antiviral activities, we mea-
sured NDV NP transcript levels in cells that had been treated
with IFN- for 18 h prior to NDV infection for 12 h. As seen
in Fig. 2C, IFN treatment potently inhibited NDV nucleocap-
sid transcript expression in control HeLa cells at three doses of
NDV, while the treatment did not have discernible inhibitory
effects on siBAF47 cells at any viral dose tested. These results
indicate that IFN fails to confer antiviral activities on cells in
which the BAF complex is inhibited. Similar experiments were
performed with vesicular stomatitis virus. Consistent with the
data presented above for NDV infection, IFN fully protected
control cells from the cytopathic effect of vesicular stomatitis
virus. However, it had no protective effects on siBAF47 cells,
leading to uncontrolled destruction of the cells (data not
shown), confirming that the BAF complex has a critical role in
establishing IFNs antiviral activities.
The BAF complex controls the chromatin accessibility at the
IFITM1 promoter. To elucidate the mechanisms by which the
BAF complex mediates the action of IFN-, we asked whether
the BAF complex directly regulates the promoter activity of
one IFN- target gene, the IFITM1 gene. We cloned 200 bp of
the IFITM1 promoter region into the chromatin-forming epi-
somal pREP4-luc vector. HeLa cells were cotransfected with
the promoter reporter construct and the RNA interference
construct targeting BAF47. As shown in Fig. 3A, when cotrans-
fected with a control vector into HeLa cells, the IFITM1 pro-
moter was robustly stimulated by IFN-. However, siRNA
targeting BAF47 strongly inhibited the basal-level activity of
the promoter and completely inhibited induction by IFN-
(Fig. 3A), indicating that the BAF complex is required for the
activity of the IFITM1 promoter. The expression of siBAF47
had no detectable effect on the activity of the claudin promoter
(Fig. 3B), indicating that the inhibition of the IFITM1 pro-
moter was specific.
To clarify how the BAF complex controls the activity of the
IFITM1 promoter, we examined the chromatin structure of the
endogenous IFITM1 promoter. As shown in Fig. 3C, microc-
cocal nuclease digestion identified a nucleosome between po-
sitions 5 and 145 relative to the transcription start site. The
ISRE (positions 21 to 35) is located within the nucleosome.
In order to determine whether the BAF complex is required to
remodel the nucleosomal structure, we probed the chromatin
structure by restriction enzyme accessibility assay. Nuclei iso-
lated from HeLa cells were briefly digested with AvaII, which
recognizes a sequence beginning at position 68 upstream of
the transcription start site (Fig. 3C). Following complete di-
gestion of the purified DNA with HgiAI, the cleavage sites
were detected by linker ligation-mediated PCR (28, 43). As
FIG. 2. The BAF complex is required for the induction of cellular
antiviral activities. (A) Expression of IFN- upon NDV infection.
Control or BAF-inhibited (siBAF47) HeLa cells were infected with
NDV (100 HU/ml) for 1 h, and IFN- levels at the indicated time
points were measured by real-time PCR. The inset shows the results of
RT-PCR analyses of BAF47 and actin mRNAs after 0 and 24 h of
viral infection in HeLa cells transfected with the control vector (lanes
1 and 3) or the siBAF47 construct (lanes 2 and 4). (B) Assessment of
NDV replication. Cells were infected with NDV, and NDV NP tran-
script levels were measured at the indicated time points by real-time
PCR. The increase (fold) is shown. (C) Effect of IFN- on NDV
replication. Cells were infected with different doses of NDV (0.01, 1,
and 100 HU/ml) in the presence or absence of IFN- (1,000 U/ml),
and viral replication by NDV NP was assessed by real-time PCR at
12 h after infection. Values on the right y axis correspond to transcript
levels obtained with 0.01 HU/ml, while those on the left y axis corre-
spond to transcript levels with 1 and 100 HU of NDV/ml.
VOL. 24, 2004 PROMOTER PRIMING BY THE BAF COMPLEX 4479
shown in Fig. 3D, stimulation of the control HeLa cells with
IFN- for 2 h strongly elevated the accessibility of the pro-
moter to AvaII (compare lanes 3 and 4) about 5.2-fold, indi-
cating that the chromatin was remodeled to a more open
structure in response to IFN-. The BAF47 siRNA abolished
the increase in chromatin accessibility (compare lanes 1 and 2),
indicating that the BAF complex is required for the chromatin
remodeling induced by IFN- signaling. To determine whether
the knockdown of BAF47 changed the levels of histone acet-
ylation at the IFITM1 promoter, we performed ChIP experi-
ments with antibodies against tetra-acetylated histone H4 tail.
As shown in Fig. 3E, the IFITM1 promoter band intensity from
FIG. 3. The BAF complex regulates IFITM1 promoter activity by modulating its chromatin structure. (A) Inhibiting the BAF complexes
abolished the induction of the IFITM1 promoter by IFN-. HeLa cells were transfected with the IFITM1 promoter reporter construct,
pREP4-IFITM1pr-luc, together with a control vector or the siRNA construct targeting BAF47 (siBAF47) for 48 to 72 h. Following treatment with
500 U of IFN-/ml for 12 h, the luciferase activity was analyzed with a dual luciferase system from Promega. (B) Knockdown of BAF47 did not
inhibit claudin promoter activity. HeLa cells were transfected with the claudin promoter reporter construct and analyzed as described for panel
A. (C) The IFITM1 promoter has a positioned nucleosome. The genomic DNA or nuclei isolated from HeLa or SW-13 cells was digested with
microccocal nuclease. The double-stranded cleavages in the nucleosomal linker regions were detected by ligation-mediated PCR with primers
specific for the IFITM1 promoter sequence (PCR primer 273F [5ACAGTGAGGTCCTGTACTTGCTGG3] and labeling primer 261F
[5TGTACTTGCTGGCCTGGGGTG3]). The open oval on the right indicates the regions protected by the nucleosomal structure. The
transcription start site (1) and direction are indicated. The filled square indicates a potential binding site for ISGF3 (ISRE). The recognition sites
for the restriction enzymes (AvaII and HgiAI) are indicated. (D) The BAF complex is required for the chromatin remodeling of the IFITM1
promoter upon IFN- stimulation. HeLa cells were transfected with control vector or siRNA targeting BAF47 (siBAF47) and selected as described
in the legend to Fig. 1. After stimulation with 500 U of IFN-/ml for 2 h, the cells were permeabilized and briefly digested with AvaII enzyme,
followed by complete digestion of the purified genomic DNA with HgiAI enzyme. The cleavage sites were detected by linker ligation-mediated
PCR with IFITM1 promoter-specific primers. The data were quantified by PhophorImager analysis. The intensity of the bands produced by AvaII
digestion after normalization to the HgiAI digestion is indicated below the panel. The experiments were repeated three times, and similar results
were obtained. Size markers are indicated on the left side of the panel. (E) Knocking down BAF47 reduced histone H4 acetylation at the IFITM1
promoter. The HeLa cells were transfected with control vector or siRNA targeting BAF47 (siBAF47) and selected as described in the legend to
Fig. 1. The chromatin lysates were prepared and immunoprecipitated with preimmune serum and antibodies against tetra-acetylated histone H4
tail as described previously (24). The IFITM1 promoter sequence and the CSF1 upstream sequence (control) in the immunoprecipitated DNA
were analyzed by PCR. The chromatin (chr) input was diluted three times at each step.
4480 CUI ET AL. M
OL.CELL.BIOL.
the cells transfected with the siBAF47 construct was signifi-
cantly weaker than that from the cells transfected with the
control vector (compare lanes 5 and 10, upper panel), while the
intensities for the CSF1 gene upstream control sequence were
similar (compare lanes 5 and 10, lower panel). Quantification
with the PhosphorImager indicates that the IFITM1 promoter
signal was threefold higher in the control cells than in the
siBAF47 cells. The acetylation levels in the regions 4 kb up-
stream and 4 kb downstream of the promoter region were not
significantly changed by siBAF47 (data not shown), suggesting
that the effect of the BAF complex on the acetylation of his-
tone H4 is not global but is localized in the promoter region.
These data indicate that the inhibition of BAF47 resulted in
lower levels of histone H4 acetylation and a less open chro-
matin structure at the promoter.
An active BAF complex is required for rapid and full induc-
tion of the IFITM1 promoter by IFN-. To confirm that the
BAF complex prepares the chromatin structure of the IFITM1
promoter for rapid induction by IFN-, we examined the ex-
pression of the IFITM1 gene in HeLa cells as well as in SW-13
cells, which do not have an active BAF complex due to the
absence of BRG1 and hBRM subunits (10, 27). Transient
expression of BRG1 reconstitutes the active BAF complex in
SW-13 cells (45). IFITM1 was induced to high levels in HeLa
cells by treatment with IFN-, with maximal induction occur-
ring between 4 and 8 h (Fig. 4A and B). In contrast, the levels
of induction of IFITM1 mRNA by IFN- were much lower in
SW-13 cells, and the induction did not reach its plateau until
approximately 12 h. However, the kinetics and levels of induc-
tion of another IFN target gene, ISG15, in HeLa cells and
SW-13 cells were similar (Fig. 4C), suggesting that the deficient
induction of IFITM1 in SW-13 cells was not caused by a defect
in IFN signaling.
To determine whether the slower kinetics and lower levels of
induction of the IFITM1 gene in SW-13 cells was caused by the
absence of the BRG1 protein, we transiently expressed BRG1
in SW-13 cells before the treatment with IFN-. As shown in
Fig. 4D, the expression of BRG1 alone induced low levels of
IFITM1 expression and IFN- treatment of BRG1-transfected
cells resulted in synergistic activation of the gene. Induction
with IFN- alone reached a plateau at 12 h, but IFN- treat-
ment in the presence of BRG1 induced the expression of the
gene at much higher levels, with an earlier plateau (at approx-
imately 4 h) (Fig. 4E). The expression of BRG1 in SW-13 cells
did not alter the induction of the ISG15 gene by IFN- (data
not shown). The expression of the ATPase-dead form of
BRG1 did not have a significant effect on the induction of
IFITM1 (data not shown), suggesting that the chromatin-re-
modeling activity of the BAF complex is required for rapid and
high-level induction of this gene by IFN-.
FIG. 4. Expression of BRG1 results in more rapid kinetics and higher levels of the IFITM1 gene induction in SW-13 cells in response to IFN-.
(A) Analysis of IFITM1 mRNA expression induced by treatment with IFN-. Total RNAs extracted from HeLa cells and SW-13 cells treated with
IFN- were reverse transcribed, amplified by PCR with IFITM1 primers, slot blotted onto nylon membrane, and detected by hybridization with
a
32
P-labeled IFITM1 cDNA probe. (B) The slot blot was quantified by PhosphorImager analysis and plotted after normalization to actin signals.
(C) The same samples were amplified with ISG15 primers and analyzed as described above. (D) SW-13 cells were transfected with pBJ5 or
pBJ5-BRG1 for 24 h, followed by treatment with 500 U of IFN-/ml for various times. The total RNAs were analyzed as described for panel A.
(E) Quantification of the samples in panel D by PhosphorImager analysis.
V
OL. 24, 2004 PROMOTER PRIMING BY THE BAF COMPLEX 4481
BRG1 increases the accessibility of the IFITM1 promoter.
In order to confirm the mechanism by which BRG1 facilitates
the induction of the IFITM1 gene in response to IFN- by
remodeling its chromatin structure, we examined restriction
enzyme accessibility at the IFITM1 promoter in the absence
and presence of BRG1. SW-13 cells were transiently trans-
fected with a BRG1 expression vector for 24 h, followed by
stimulation with IFN-. Nuclei were isolated and subjected to
brief digestion with AvaII or HgiAI. Following complete di-
gestion of the purified DNA with BclI, the cleavage sites were
detected by linker ligation-mediated PCR as described above.
Stimulation of SW-13 cells with IFN- for 2 h slightly increased
the accessibility of the promoter to AvaII (Fig. 5A and B,
compare lanes 1 and 3) and HgiAI (Fig. 5C and D, lanes 1 to
3). Interestingly, IFN- signaling in the presence of BRG1
dramatically increased the accessibility of the promoter to the
restriction enzymes (Fig. 5A, compare lanes 1 and 4, and C,
lanes 4 and 5). BRG1 alone without IFN- stimulation also
significantly increased accessibility (Fig. 5A, compare lanes 1
and 2, and C, compare lanes 1 and 4), suggesting that the
recruitment of BRG1 to the IFITM1 promoter does not re-
quire IFN- stimulation and that the BAF complex constitu-
tively remodels the chromatin structure at the IFITM1 pro-
moter to a more “open” conformation that is more accessible
to transcription activators and RNA polymerase machinery.
Constitutive association of BRG1 with the IFITM1 pro-
moter allows rapid recruitment of ISGF3 complex and RNA
polymerase II. Using ChIP assays, we determined whether the
BAF complex binds directly to the IFITM1 promoter (Fig.
6A). Compared to the 3 untranslated region, the IFITM1
promoter sequence was reproducibly enriched about twofold
by the BRG1 antibody from SW-13 cells transiently expressing
BRG1 (Fig. 6A, panel a). Interestingly, BRG1 binding was
observed even in the absence of IFN- stimulation (Fig. 6A,
FIG. 5. Expression of BRG1 controls both basal and induced chromatin remodeling of the IFITM1 promoter. (A) Nuclei isolated from SW-13
cells transfected with pBJ5 or pBJ5-BRG1 for 24 h before treatment with IFN- for 2 h were briefly digested with AvaII. The purified genomic
DNA was digested to completion with BclI. The cleavage sites were detected by linker ligation-mediated PCR with the IFITM1 promoter-specific
primers as described in the legend to Fig. 3B. (B) Quantification of the data in panel A by PhosphorImager analysis. (C) Nuclei isolated from
SW-13 cells transfected with pBJ5 or pBJ5-BRG1 for 24 h before treatment with IFN- for various times were briefly digested with HgiAI and
analyzed as described for panel A. (D) Quantification of the data in panel C by PhosphorImager analysis. The experiments were repeated three
times, with similar results.
4482 CUI ET AL. M
OL.CELL.BIOL.
compare lanes 1 to 3 and lanes 4 to 6 in panel a), consistent
with the persistent open chromatin structure at the IFITM1
promoter in the presence of the active BAF complex. Further-
more, transient expression of BRG1 in SW-13 cells without
IFN- stimulation up-regulated the basal-level expression of
the IFITM1 gene, as demonstrated by RT-PCR analysis (Fig.
4D) and by the activity of an IFITM1 luciferase reporter con-
struct (Fig. 6B). The constitutive association of BRG1 with the
IFITM1 promoter was not an artifact resulting from the over-
expression of BRG1, since the endogenous BRG1 in HeLa
cells was also associated with the IFITM1 promoter indepen-
dent of IFN- stimulation (Fig. 6C). In contrast, STAT2 asso-
ciation required stimulation with IFN- (Fig. 6C). No BRG1
or STAT2 binding to the 3 untranslated region of the IFITM2
gene was detected. Thus, the association of BRG1 with the
IFITM1 promoter appears to be constitutive and does not
require stimulation with IFN-.
Next, we evaluated the levels of histone H4 acetylation at the
IFITM1 promoter in the presence and absence of BRG1 and
IFN-. We found that the presence of BRG1 increased the
acetylation of histone H4 about threefold at the IFITM1 pro-
moter region compared to the level at the 3 untranslated
region (Fig. 6A, compare lanes 1 and 4 in panel b), consistent
with a more open chromatin structure at the promoter region.
IFN- stimulation for 2 h further increased the H4 acetylation
at the promoter about 10-fold (Fig. 6A, panel b), resulting in a
more open chromatin structure, as demonstrated by the re-
striction enzyme accessibility data (Fig. 5).
FIG. 6. BRG1 is constitutively associated with the IFITM1 promoter. (A) SW-13 cells transfected with pBJ5 or pBJ5-BRG1 for 24 h were
treated with 500 U of IFN-/ml for indicated periods of time. Chromatin lysates were prepared and immunoprecipitated as described in the legend
to Fig. 3C with the antibodies indicated on the left side of the panel. After reverse cross-linking, the immunoprecipitated DNA was analyzed by
PCR with primers specific to the IFITM1 promoter region (Pr), the 3 untranslated region (3U), or the 5 far-upstream region of the CSF1 gene
(5UCSF). The quantification of the data is shown below each panel. (B) The IFITM1 promoter in the pREP4 reporter vector was cotransfected
with pBJ5 or pBJ5-BRG1 into SW-13 cells. Luciferase activity was determined after 24 h of transfection. (C) BRG1 is constitutively associated with
the IFITM1 promoter in HeLa cells even without IFN- stimulation. HeLa cells were stimulated with 500 U of IFN-/ml for 30 min, followed by
chromatin preparation and chromatin immunoprecipitation as described in the legend to Fig. 3C. The purified DNA was analyzed by PCR with
the IFITM1 promoter primers (top two panels) or primers for the 3 untranslated region of the IFITM2 gene (bottom panel). The chromatin (chr)
input was diluted 5 times at each step. The preimmune serum (PreIm) and antibodies are indicated above the panels. The quantification of the
data after normalization to the preimmune serum is shown below each panel.
V
OL. 24, 2004 PROMOTER PRIMING BY THE BAF COMPLEX 4483
IFN- signaling activates the ISGF3 complex consisting of
STAT1, STAT2, and p48, which relocates to the nucleus and
binds to its target promoters (7). As shown in Fig. 6A, panel c,
only low levels of STAT2 were associated with the IFITM1
promoter without BRG1, while in the presence of BRG1,
IFN- induced a strong association of STAT2 with the pro-
moter (compare lanes 1 to 3 and lanes 4 to 6). A similar
observation was made for p48 (data not shown). As expected,
RNA polymerase II binding to the IFITM1 promoter was also
enhanced by the presence of BRG1 and stimulation with
IFN- (Fig. 6A, panel d, compare lanes 1 to 3 and lanes 4 to 6).
However, significant binding to the 3 untranslated region
(data not shown), but not to the 5 far-upstream region of
CSF1 promoter, was also detected in the presence of BRG1
and IFN-. The data indicate that significant binding of RNA
polymerase II does not occur at the IFITM1 promoter until
after IFN- stimulation. This finding shows that although the
chromatin structure of the promoter is already remodeled by
the prebound BAF complex, the transcription machinery is not
present on the promoter in a poised state. Instead, its assembly
is dependent on the cellular signaling cascade. These results
show that constitutive binding of the BAF complex facilitated
histone H4 acetylation, ISGF3 binding, and the transcription
machinery assembly on the IFITM1 promoter upon stimula-
tion with IFN-.
DISCUSSION
The BAF complex regulates the IFN signaling pathways by
multiple mechanisms. The effectiveness of the cellular antivi-
ral activities is dependent on the rapid transcriptional activa-
tion of IFNs and their target genes. Viral infection first acti-
vates transcription factors such as IRF3 and NF-B that bind
to their recognition sites in the IFN promoters and activate
transcription. Induced IFNs bind to their cell surface receptors
and induce the activation of the ISGF3 complex that binds to
ISREs and triggers the induction of genes involved in antiviral
activities. That the BAF complex has a pivotal role in the
expression of not only IFN-inducible genes but also virus-
inducible genes is supported by the marked reduction of a
series of IFN and poly(I)/poly(C)-inducible genes.
Clearly, the BAF complex mediates cellular antiviral activi-
ties by multiple mechanisms. First, this complex is required for
maintaining certain basal levels of the IFN target proteins of
the antiviral systems, such as Mx1, PKR, OAS3, IFITM1, and
ISG20. The existence of the antiviral protein pool at certain
levels in the cells may represent the first cellular defense or a
barrier against invading pathogens even before the induction
of the IFN signaling systems. Indeed, when these proteins were
down-regulated by the inhibition of BAF47, the NDV viral
yields were significantly higher, suggesting that the innate an-
tiviral activity was impaired (Fig. 2). Second, the BAF complex
is required for the induced levels of both the regulators and the
target proteins, suggesting that it may play essential roles in
IFN-mediated antiviral activities. Indeed, our results show that
IFN failed to protect the cells from virus in the absence of
BAF47 (Fig. 2). Therefore, the BAF complex controls the
antiviral systems at multiple steps in the pathways.
Promoter priming by the BAF complex. The BAF complex
regulates transcription by modifying the chromatin structure. It
has been suggested that chromatin-remodeling complexes are
recruited to target sites in situ at the time of stimulation (2, 35).
In this report, the following observations indicate that the BAF
complex regulates the IFN signaling process by a novel mech-
anism. (i) Reconstitution of the active BAF complex by tran-
sient expression of BRG1 in SW-13 cells enhanced the chro-
matin accessibility of the IFITM1 promoter (Fig. 5), increased
its levels of histone H4 acetylation (Fig. 6), and up-regulated
the basal-level expression of the IFITM1 gene (Fig. 4) in the
absence of IFN- treatment. (ii) Knockdown of the endoge-
FIG. 7. The BAF complex primes the chromatin structure of IFN target promoters for more rapid kinetics and higher levels of induction in
response to stimuli.
4484 CUI ET AL. M
OL.CELL.BIOL.
nous BAF complex in HeLa cells by expression of the siRNA
targeting BAF47 down-regulated the basal-level expression of
the IFITM1 gene (Fig. 1) and reduced the levels of histone H4
acetylation and chromatin accessibility of the IFITM1 pro-
moter (Fig. 3), suggesting that the BAF complex may play a
role in modifying the chromatin structure of the promoter even
without IFN- stimulation. (iii) Our ChIP results demonstrate
that BRG1 is directly bound to the IFITM1 promoter both in
the absence and in the presence of IFN- (Fig. 6). Further-
more, we found that BRG1 also binds constitutively to the
promoters of IFITM3, IFITM2, STAT2, Mx1, OAS3, and
TLR3 genes (data not shown). Because of the limited sensi-
tivity of the ChIP assays, we could not conclusively determine
whether BAF binding to these promoters was enhanced by
IFN treatment.
All of these data argue that the binding of the BAF complex
does not require IFN- stimulation, at least in a subset of the
IFN target promoters. Therefore, we suggest that in addition
to being recruited to some target promoters upon stimulation
(2), the BAF complex binds constitutively to a set of IFN-
inducible promoters and utilizes ATP-derived energy to main-
tain the promoters in an open configuration. Without prior
chromatin remodeling by the BAF complex, the ISGF3 com-
plex may not efficiently bind the IFITM1 promoter to activate
transcription. Following the binding of the ISGF3 complex,
histone acetylase such as p300/CBP or GCN5 is recruited to
the promoter and results in a more open and stable chromatin
structure, which promotes the assembly of the transcription
machinery and transcription initiation (5, 29). The chromatin
structure at the promoters remodeled by the BAF complex
may serve as a marker important for more rapid and higher
levels of induction in response to IFN stimulation, as illus-
trated in Fig. 7. Such a marker provides a mechanism to trigger
rapid cellular antiviral responses upon infection of the host.
There are two not-mutually-exclusive potential mechanisms
for the constitutive association of BRG1 with the target pro-
moters. One is the constitutive basal-level acetylation of his-
tones that may serve as the docking sites for the BAF complex
(9, 15). The other is the possible recruitment of the BAF
complex by unidentified transcription factors that bind consti-
tutively to the promoters and are required for the basal-level
expression of the genes. This hypothesis is currently under
investigation.
ACKNOWLEDGMENTS
We thank Tian Chi, John Kelly, Warren Leonard, and Carl Wu for
critical reading of the manuscript. K.Z. thanks Warren Leonard for
support.
This work was supported by intramural grants to the National Heart,
Lung, and Blood Institute, National Institutes of Health.
REFERENCES
1. Aalfs, J. D., and R. E. Kingston. 2000. What does chromatin remodeling’
mean? Trends Biochem. Sci. 25:548–555.
2. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos.
2000. Ordered recruitment of chromatin modifying and general transcription
factors to the IFN- promoter. Cell 103:667–678.
3. Agarwal, S., and A. Rao. 1998. Modulation of chromatin structure regulates
cytokine gene expression during T cell differentiation. Immunity 9:765–775.
4. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recog-
nition of double-stranded RNA and activation of NF-B by Toll-like recep-
tor 3. Nature 413:732–738.
5. Bhattacharya, S., R. Eckner, S. Grossman, E. Oldread, Z. Arany, A.
D’Andrea, and D. M. Livingston. 1996. Cooperation of Stat2 and p300/CBP
in signalling induced by interferon-alpha. Nature 383:344–347.
6. Cosma, M. P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of
transcription and chromatin remodeling factors to a cell cycle- and develop-
mentally regulated promoter. Cell 97:299–311.
7. Darnell, J. E., Jr., I. M. Kerr, and G. R. Stark. 1994. Jak-STAT pathways and
transcriptional activation in response to IFNs and other extracellular signal-
ing proteins. Science 264:1415–1421.
8. de La Serna, I. L., K. A. Carlson, and A. N. Imbalzano. 2001. Mammalian
SWI/SNF complexes promote MyoD-mediated muscle differentiation. Nat.
Genet. 27:187–190.
9. Dhalluin, C., J. E. Carlson, L. Zeng, C. He, A. K. Aggarwal, and M. M. Zhou.
1999. Structure and ligand of a histone acetyltransferase bromodomain.
Nature 399:491–496.
10. Dunaief, J. L., B. E. Strober, S. Guha, P. A. Khavari, K. Alin, J. Luban, M.
Begemann, G. R. Crabtree, and S. P. Goff. 1994. The retinoblastoma protein
and BRG1 form a complex and cooperate to induce cell cycle arrest. Cell
79:119–130.
11. Fry, C. J., and C. L. Peterson. 2001. Chromatin remodeling enzymes: who’s
on first? Curr. Biol. 11:R185–R197.
12. Geng, F., Y. Cao, and B. C. Laurent. 2001. Essential roles of Snf5p in Snf-Swi
chromatin remodeling in vivo. Mol. Cell. Biol. 21:4311–4320.
13. Guidi, C. J., A. T. Sands, B. P. Zambrowicz, T. K. Turner, D. A. Demers, W.
Webster, T. W. Smith, A. N. Imbalzano, and S. N. Jones. 2001. Disruption of
Ini1 leads to peri-implantation lethality and tumorigenesis in mice. Mol.
Cell. Biol. 21:3598–3603.
14. Hassan, A. H., K. E. Neely, M. Vignali, J. C. Reese, and J. L. Workman. 2001.
Promoter targeting of chromatin-modifying complexes. Front. Biosci.
6:D1054–D1064.
15. Hassan, A. H., K. E. Neely, and J. L. Workman. 2001. Histone acetyltrans-
ferase complexes stabilize swi/snf binding to promoter nucleosomes. Cell
104:817–827.
16. Huang, M., F. Qian, Y. Hu, C. Ang, Z. Li, and Z. Wen. 2002. Chromatin-
remodelling factor BRG1 selectively activates a subset of interferon-alpha-
inducible genes. Nat. Cell Biol. 4:774–781.
17. Imbalzano, A. N., H. Kwon, M. R. Green, and R. E. Kingston. 1994. Facil-
itated binding of TATA-binding protein to nucleosomal DNA. Nature 370:
481–485.
18. Kalpana, G. V., S. Marmon, W. Wang, G. R. Crabtree, and S. P. Goff. 1994.
Binding and stimulation of HIV-1 integrase by a human homolog of yeast
transcription factor SNF5. Science 266:2002–2006.
19. Khavari, P. A., C. L. Peterson, J. W. Tamkun, D. B. Mendel, and G. R.
Crabtree. 1993. BRG1 contains a conserved domain of the SWI2/SNF2
family necessary for normal mitotic growth and transcription. Nature 366:
170–174.
20. Kimura, T., K. Nakayama, J. Penninger, M. Kitagawa, H. Harada, T. Mat-
suyama, N. Tanaka, R. Kamijo, J. Vilcek, T. W. Mak, et al. 1994. Involve-
ment of the IRF-1 transcription factor in antiviral responses to interferons.
Science 264:1921–1924.
21. Klochendler-Yeivin, A., L. Fiette, J. Barra, C. Muchardt, C. Babinet, and M.
Yaniv. 2000. The murine SNF5/INI1 chromatin remodeling factor is essential
for embryonic development and tumor suppression. EMBO Rep. 1:500–506.
22. Krebs, J. E., M. H. Kuo, C. D. Allis, and C. L. Peterson. 1999. Cell cycle-
regulated histone acetylation required for expression of the yeast HO gene.
Genes Dev. 13:1412–1421.
23. Leonard, W. J., and J. J. O’Shea. 1998. Jaks and STATs: biological impli-
cations. Annu. Rev. Immunol. 16:293–322.
24. Liu, H., H. Kang, R. Liu, X. Chen, and K. Zhao. 2002. Maximal induction of
a subset of interferon target genes requires the chromatin-remodeling activ-
ity of the BAF complex. Mol. Cell. Biol. 22:6471–6479.
25. Liu, R., H. Liu, X. Chen, M. Kirby, P. O. Brown, and K. Zhao. 2001.
Regulation of CSF1 promoter by the SWI/SNF-like BAF complex. Cell
106:309–318.
26. Muchardt, C., and M. Yaniv. 1999. ATP-dependent chromatin remodelling:
SWI/SNF and Co. are on the job. J. Mol. Biol. 293:187–198.
27. Muchardt, C., and M. Yaniv. 1993. A human homologue of Saccharomyces
cerevisiae SNF2/SWI2 and Drosophila brm genes potentiates transcriptional
activation by the glucocorticoid receptor. EMBO J. 12:4279–4290.
28. Mueller, P. R., and B. Wold. 1989. In vivo footprinting of a muscle specific
enhancer by ligation mediated PCR. Science 246:780–786.
29. Paulson, M., C. Press, E. Smith, N. Tanese, and D. E. Levy. 2002. IFN-
stimulated transcription through a TBP-free acetyltransferase complex es-
capes viral shutoff. Nat. Cell Biol. 4:140–147.
30. Peterson, C. L., and J. L. Workman. 2000. Promoter targeting and chromatin
remodeling by the SWI/SNF complex. Curr. Opin. Genet. Dev. 10:187–192.
31. Phelan, M. L., S. Sif, G. J. Narlikar, and R. E. Kingston. 1999. Reconstitu-
tion of a core chromatin remodeling complex from SWI/SNF subunits. Mol.
Cell 3:247–253.
32. Reinke, H., P. D. Gregory, and W. Horz. 2001. A transient histone hyper-
acetylation signal marks nucleosomes for remodeling at the PHO8 promoter
in vivo. Mol. Cell 7:529–538.
33. Roberts, C. W., S. A. Galusha, M. E. McMenamin, C. D. Fletcher, and S. H.
VOL. 24, 2004 PROMOTER PRIMING BY THE BAF COMPLEX 4485
Orkin. 2000. Haploinsufficiency of Snf5 (integrase interactor 1) predisposes
to malignant rhabdoid tumors in mice. Proc. Natl. Acad. Sci. USA 97:13796–
13800.
34. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T.
Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, and T. Taniguchi. 2000. Dis-
tinct and essential roles of transcription factors IRF-3 and IRF-7 in response
to viruses for IFN-/ gene induction. Immunity 13:539–548.
35. Soutoglou, E., and I. Talianidis. 2002. Coordination of PIC assembly and
chromatin remodeling during differentiation-induced gene activation. Sci-
ence 295:1901–1904.
36. Stark, G. R., I. M. Kerr, B. R. Williams, R. H. Silverman, and R. D.
Schreiber. 1998. How cells respond to interferons. Annu. Rev. Biochem.
67:227–264.
37. Sudarsanam, P., and F. Winston. 2000. The Swi/Snf family nucleosome-remod-
eling complexes and transcriptional control. Trends Genet. 16:345–351.
38. Sui, G., C. Soohoo, E. B. Affar, F. Gay, Y. Shi, and W. C. Forrester. 2002. A
DNA vector-based RNAi technology to suppress gene expression in mam-
malian cells. Proc. Natl. Acad. Sci. USA 99:5515–5520.
39. Varga-Weisz, P. 2001. ATP-dependent chromatin remodeling factors: nu-
cleosome shufflers with many missions. Oncogene 20:3076–3085.
40. Versteege, I., N. Sevenet, J. Lange, M. F. Rousseau-Merck, P. Ambros, R.
Handgretinger, A. Aurias, and O. Delattre. 1998. Truncating mutations of
hSNF5/INI1 in aggressive paediatric cancer. Nature 394:203–206.
41. Wan, M., K. Zhao, S. S. Lee, and U. Francke. 2001. MECP2 truncating
mutations cause histone H4 hyperacetylation in Rett syndrome. Hum. Mol.
Genet. 10:1085–1092.
42. Wang, W., J. Cote, Y. Xue, S. Zhou, P. A. Khavari, S. R. Biggar, C. Mu-
chardt, G. V. Kalpana, S. P. Goff, M. Yaniv, J. L. Workman, and G. R.
Crabtree. 1996. Purification and biochemical heterogeneity of the mamma-
lian SWI-SNF complex. EMBO J. 15:5370–5382.
43. Weinmann, A. S., S. E. Plevy, and S. T. Smale. 1999. Rapid and selective
remodeling of a positioned nucleosome during the induction of IL-12 p40
transcription. Immunity 11:665–675.
44. Wu, J., and M. Grunstein. 2000. 25 years after the nucleosome model:
chromatin modifications. Trends Biochem. Sci. 25:619–623.
45. Zhao, K., W. Wang, O. J. Rando, Y. Xue, K. Swiderek, A. Kuo, and G. R.
Crabtree. 1998. Rapid and phosphoinositol-dependent binding of the SWI/
SNF-like BAF complex to chromatin after T lymphocyte receptor signaling.
Cell 95:625–636.
4486 CUI ET AL. MOL.CELL.BIOL.
    • "We also found that knockdown of BRG1, the chromatin remodeling protein, also completely suppressed IFITM1 expression in SUM149 cells. BRG1 is the ATP subunit of the chromatin remodeling complex BAF, and studies have shown that STAT2 and BRG1 interact to induce the expression of certain ISGs, including IFITM1, through noncanonical IFN signaling [56, 57] . There is also evidence that the recruitment of BAF to the IFITM1 promoter is mediated in part by the interaction of BRG1 with STAT2585960. "
    [Show abstract] [Hide abstract] ABSTRACT: Background: Inflammatory breast cancer (IBC) is a very aggressive and lethal subtype of breast cancer that accounts for about 4 % of all breast cancers diagnosed in the United States. Despite the efforts of several investigators to identify the molecular factors driving the aggressive phenotype of IBC, a great deal is still unknown about the molecular underpinnings of the disease. In the present study, we investigated the role of interferon-induced transmembrane protein 1 (IFITM1), a well-known interferon-stimulated gene (ISG), in promoting the aggressiveness of SUM149 IBC cells. Methods: Western blot and real-time polymerase chain reaction analyses were performed to assess the protein and messenger RNA (mRNA) levels of IFITM1 and other ISGs in three IBC cell lines: SUM149, MDA-IBC-3, and SUM190. IFITM1 expression and cellular localization were assessed by using immunofluorescence, while the tumorigenic potential was assessed by performing cell migration, invasion, and colony formation assays. Small interfering RNA and short hairpin RNA knockdowns, enzyme-linked immunosorbent assays, and luciferase assays were performed to determine the functional significance of IFITM1 and signal transducers and activators of transcription 1 and 2 (STAT1/2) in SUM149 cells. Results: We found that IFITM1 was constitutively overexpressed at the mRNA and protein levels in triple-negative SUM149 IBC cells, but that it was not expressed in SUM190 and MDA-IBC-3 IBC cells, and that suppression of IFITM1 or blockade of the IFNα signaling pathway significantly reduced the aggressive phenotype of SUM149 cells. Additionally, we found that knockdown of STAT2 abolished IFITM1 expression and IFITM1 promoter activity in SUM149 cells and that loss of STAT2 significantly inhibited the ability of SUM149 cells to proliferate, migrate, invade, and form 2-D colonies. Notably, we found that STAT2-mediated activation of IFITM1 was particularly dependent on the chromatin remodeler brahma-related gene 1 (BRG1), which was significantly elevated in SUM149 cells compared with SUM190 and MDA-IBC-3 cells. Conclusions: These findings indicate that overexpression of IFITM1 enhances the aggressive phenotype of triple-negative SUM149 IBC cells and that this effect is dependent on STAT2/BRG1 interaction. Further studies are necessary to explore the potential of IFITM1 as a novel therapeutic target and prognostic marker for some subtypes of IBCs.
    Full-text · Article · Dec 2016
    • "We also found that knockdown of BRG1, the chromatin remodeling protein, also completely suppressed IFITM1 expression in SUM149 cells. BRG1 is the ATP subunit of the chromatin remodeling complex BAF, and studies have shown that STAT2 and BRG1 interact to induce the expression of certain ISGs, including IFITM1, through noncanonical IFN signaling [56, 57] . There is also evidence that the recruitment of BAF to the IFITM1 promoter is mediated in part by the interaction of BRG1 with STAT2 [58][59][60]. "
    Full-text · Article · Aug 2015
    • "The shRNA constructs for IRF1 and IRF2 were generated by inserting the corresponding cDNA sequences into the pREP4-puro vector. pREP4- U6-shBAF47 construct was described previously [12]. The oligonucleotides for Sp1 and IRF-E site mutations are listed below: The Oligonucleotides used for shRNA constructs are listed below: Antibodies used in this study are from the following sources Anti-IRF1(sc-497X; Santa Cruz), anti-IRF2(sc-498X; Santa Cruz), anti-TLR3(H-125; Santa Cruz), anti- BRG1(sc-17796X; Santa Cruz), anti-hBRM(sc-6450; Santa Cruz), anti-BAF47(home made see paper), anti-p48(sc- 496; Santa Cruz), anti-Stat1(06–502; upstate), anti- Stat2(sc-346-G; Santa Cruz), anti-PloII (sc-899X; Santa Cruz), anti-CBP(ab10489; abcam), anti-H3K4me3(17– 614; Millipore), anti-H3k9ac/14 ac (ab4441;abcam), anti- H3(ab1791-100; abcam). "
    [Show abstract] [Hide abstract] ABSTRACT: Background Cellular antiviral activities are critically controlled by transcriptional activation of interferon-inducible genes, involving interferon regulatory factors (IRFs). Previous data suggested that IRF1 is an activator and IRF2 is a repressor, which functionally antagonize each other in transcriptional regulation. However, it is not clear how these two factors function to regulate cellular antiviral activities. Results We show that IRF2 is critically required for the induction of the TLR3 and other interferon-inducible genes in a chromatin environment. While both IRF1 and IRF2 directly interact with the BAF chromatin remodeling complex, IRF2 is associated with the TLR3 promoter in the unstimulated state and IRF1 binding to the promoter is strongly induced by stimulation with interferon, suggesting that these two factors may function at different stages of gene induction in the recruitment of the BAF complex. IRF2 acts to maintain the basal level expression, an open chromatin structure, and active histone modification marks (H3K9, K14 acetylation and H3K4 tri-methylation) of the TLR3 promoter in the unstimulated state, while IRF1 serves to rapidly activate the promoter upon stimulation. Conclusions IRF1 and IRF2 of the IRF family of transcription factors play distinct roles in cellular response to viral infection. IRF2 binds to TLR3 and other IFN-inducible gene promoters and maintains an active chromatin structure in the unstimulated state, which is required for their induction, while IRF1 binding to these promoters activates their transcription upon viral infection. Thus, the division of labor between the IRF transcription factor family members plays a pivotal role in coordinating the transcriptional activation in the cellular antiviral response.
    Full-text · Article · Apr 2015
Show more