Article

Matera, I., Bachetti, T., Puppo, F., Di Duca, M., Morandi, F., Casiraghi, G. M. et al. PHOX2B mutations and polyalanine expansions correlate with the severity of the respiratory phenotype and associated symptoms in both congenital and late onset Central Hypoventilation syndrome. J. Med. Genet. 41, 373-380

University of Groningen, Groningen, Groningen, Netherlands
Journal of Medical Genetics (Impact Factor: 6.34). 06/2004; 41(5):373-80. DOI: 10.1136/jmg.2003.015412
Source: PubMed

Full-text

Available from: Francesca Puppo
LETTER TO JMG
PHOX2B mutations and polyalanine expansions correlate
with the severity of the respiratory phenotype and
associated symptoms in both congenital and late onset
Central Hypoventilation syndrome
I Matera, T Bachetti, F Puppo, M Di Duca, F Morandi, G M Casiraghi, M R Cilio, R Hennekam,
R Hofstra, J G Scho¨ber, R Ravazzolo, G Ottonello, I Ceccherini
...............................................................................................................................
J Med Genet 2004;41:373–380. doi: 10.1136/jmg.2003.015412
C
ongenital Central Hypoventilation syndrome (CCHS
(MIM 209880)) is a rare disorder, with fewer than 200
patients currently reported worldwide, characterised by
absence of adequate autonomic control of respiration with
decreased sensitivity to hypercapnia and hypoxia, in the
absence of neuromuscular or lung disease, or an identifiable
brain stem lesion.
1
Children with CCHS show an adequate
ventilation while awake but hypoventilate during sleep. More
severely affected children hypoventilate both when awake
and during sleep.
1
CCHS has been reported in association
with several disorders, among which aganglionic megacolon
(Hirschsprung disease, HSCR) and tumours of neural crest
origin, reflecting a common molecular pathogenesis sus-
tained by defects of one or more genes that control the correct
development of neural crest derived cell lineages.
1–3
A genetic aetiology has long been hypothesised for
CCHS based on recurrence reported in siblings, in half
siblings and in affected children born to women with CCHS.
2–6
More recently, a generalised autonomic nervous system
(ANS) imbalance has been observed among children with
CCHS and an increased incidence of ANS dysfunctions
(ANSD) reported among relatives of 56 patients with CCHS,
as against relatives of 56 matched controls.
7
A family
transmission study has shown that the risk of developing
an ANSD symptom including CCHS, regarded as the most
severe expression of ANS imbalance, mainly depends on the
genotype at a major locus, while significant residual variants
could be due to additional minor genes, modifying loci effects
or environmental factors.
8
Genes involved in the ANS development, like the RET
proto-oncogene, its ligand GDNF, the Endothelin 3 gene, the
Brain Derived Neurotrophic Factor (BDNF) and the RNX
genes, have been tested and a few mutations found, showing
no cosegregation with the disease phenotype in CCHS
families.
9–13
The PHOX2B gene encodes a 314 amino acids paired box
homeodomain transcription factor which is expressed in the
developing hindbrain and peripheral nervous system as well
as in all noradrenergic centres and visceral motor and
branchiomotor neurones of the cranial nerves. Its expression
has also been detected in neuronal groups, such as those
involved in the medullary control reflexes of autonomic
functions.
14
Phox2b-/- mice have shown lack of intestinal
innervation and of all central and peripheral neurones that
express noradrenergic traits.
15
Two heterozygous frameshift
mutations and 16 polyalanine triplet duplications of 5–9
residues, occurred in a 20 alanine tract in the C terminus of
the PHOX2B gene, have been described in a total of 29
patients with CCHS (62%).
16
More recently, a mutation
screening of the PHOX2B gene performed in 10 patients has
revealed polyalanine expansions in four patients with CCHS
and one frameshift mutation in a fifth patient (50%),
17
while
65 polyalanine expansions and one nonsense mutation of the
same gene have been detected on a total of 67 patients with
CCHS (98.5%).
18
Thus, PHOX2B is confirmed as playing a
crucial role in the correct development of the central
respiratory control system and appears to be a master
regulatory gene of the ANS.
................................................................
Abbreviations: ANS, autonomic nervous system; ANSD, ANS
dysfunctions; CCHS, congenital Central Hypoventilation syndrome;
HSCR, Hirschsprung’s disease; LOCHS, late onset Central
Hypoventilation syndrome; SNP, single nucleotide polymorphism
Key points
N
We have carried out mutation screening of the
PHOX2B gene in a set of 27 patients affected with
congenital Central Hypoventilation syndrome (CCHS),
three of whom showed association with Hirschsprung’s
disease (HSCR), and also including three familial cases
with affected sibling pairs and three late onset central
hypoventilation cases (LOCHS).
N
Three heterozygous frameshift mutations, two of which
occurred de novo, and 22 in-frame changes leading to
5–13 polyalanine expansions of the PHOX2B gene in
25 out of 27 CCHS patients studied (93%) have been
identified. Polyalanine triplet expansion has also been
detected in the affected siblings of two familial cases
and in two asymptomatic parents, one of whom is the
mother of a sporadic case.
N
A genotype-phenotype correlation is shown between
the size of the PHOX2B expanded allele and the
severity of both the respiratory phenotype and
associated symptoms, and the age of onset.
N
We demonstrate that in individuals heterozygous for
length variants of the polyalanine stretch of PHOX2B
exon 3, the largest allele is always prone to
unsuccessful amplification by DNA polymerase. An
improved methodological approach is proposed to
avoid misleading in vitro amplification that can cause
mistakes in recording individuals’ genotypes.
N
PHOX2B is confirmed as the major gene in CCHS
pathogenesis. Autosomal dominant inheritance with
reduced penetrance is demonstrated.
373
www.jmedgenet.com
Page 1
Here, we report a mutation screening of the coding region
of the PHOX2B gene in a total of 27 unrelated patients
affected with CCHS, including three familial cases with
affected sibling pairs and three cases with late onset CHS
(LOCHS).
19
Results support the notion of a simple Mendelian
inheritance in CCHS with dominant, incompletely penetrant
PHOX2B molecular defects recurring in the vast majority of
the patients and their families. Moreover, the size of the
polyalanine expansions detected correlates with the degree of
phenotypic severity.
METHODS
Subjects
We have analysed 27 individuals from Italy, Germany and
the Netherlands affected with CCHS, isolated or in associa-
tion with several autonomic nervous system dysfunctions.
Twenty one of them have isolated CCHS, three presented
with CCHS and HSCR, while the other three had a late onset
of the disease. Three isolated CCHS cases are familial,
showing affected siblings.
The diagnostic criteria of the American Thoracic Society
statement on CCHS
1
were used and the diagnosis of CCHS
was confirmed for each case by the referring clinician. Sixty
unrelated individuals who were phenotypically normal were
recruited from the blood donors of the Istituto Gaslini and
used as controls. DNA was extracted from peripheral blood
lymphocytes according to standard procedures.
Our study protocol was approved by the ethics committee
of the Department of Internal Medicine of the University of
Genova and informed consent was obtained from all patients’
parents before study enrolment.
Mutational screening and molecular analysis
To amplify the three coding regions, including intron-exon
boundaries, we designed four PCR primer pairs (table 1) on
the basis of the PHOX2B sequence available in GenBank
(accession number NT_022782) and using the Primer Express
2.0 software program.
Standard PCR reactions were set up in a total volume of
50 ml containing 200 ng of genomic DNA, 1 mM of primers,
16buffer, 200 mM of each dNTP except for G, which was
present at 150 mM+50 mM of 7-deaza-dGTP (Roche), and
1.25 U of Taq polymerase (PE Biosystems), and run for
35 cycles at 95
˚
C (45 s), the annealing temperature reported
in table 1 (1 min), and 72
˚
C (1 min).
PCR reactions specific for GC rich templates were set up in
a total volume of 50 ml containing 200 ng of genomic DNA,
400 nM primers, 16 of GC-RICH PCR buffer and 1 M GC-
RICH resolution (GC-RICH PCR System, Roche), 200 mMof
each dNTP and 2 U of GC-RICH PCR enzyme mix (Roche),
and run for 30 cycles at 95
˚
C (30 s), 60
˚
C (30 s), and 72
˚
C
(1 min).
PCR fragments were screened for mutations by direct
sequencing, using the Big Dye Terminator cycle sequencing
kit (Applied Biosystems) on an ABI 3100 DNA automated
Sequencer. PCR products were column purified before
sequencing (Microcon-PCR, Millipore).
The fifth primer pair reported in table 1 (145F+279R) was
used to amplify a small portion of exon 3. 15 ml of this 120 bp
PCR product were run on 8% (w/w) polyacrylamide gel, and
DNA bands on the gel were developed using ethidium
bromide.
We cloned the exon 3 PCR product (primers 10F+3.3R)
using DNA from patient 23 as a template, into the TOPO TA
vector (Invitrogen) following the manufacturer’s instruc-
tions. Plasmid DNA isolated from 35 clones was sequenced as
described above.
A restriction cleavage with AvaII of the 627 bp exon 3 PCR
amplimer (primers 10F+3.3R) of all patients, was carried out
and analysed through 4% agarose gel electrophoresis.
RESULTS
Mutation analysis of PHOX2B gene in CCHS patients
A mutation screening of the three exons spanning the entire
coding sequence of the PHOX2B gene has been performed in
27 CCHS patients, including three LOCHS cases, by direct
DNA sequencing analysis. We found three nucleotide
changes lying in the exon 3 and leading to out of frame
translation (fig 1A).
One heterozygous C deletion and one heterozygous G
insertion have been detected in two CCHS patients (27 and
21) within intervals c.614–618 and c.862–866 of the coding
sequence, respectively (fig 1B). In the former case, the frame
shift creates a premature stop codon and results in a 307
amino acid truncated protein, with the last 101 amino acids
not belonging to the PHOX2B sequence. In the latter case, the
resulting frame shift relocates the stop codon 132 bp beyond
its natural end, leading to disruption of 8.3% of the protein C-
terminus. Analysis of the two patients’ parents has revealed
that the c.614–618delC was inherited from the unaffected
mother, while the c.862–866insG occurred de novo in the
proband (data not shown). A 38 bp heterozygous deletion
within exon 3, removing nucleotides 721–758 of the coding
sequence and predicted to destroy the reading frame, has
been found in the third patient (24) (fig 1B). His parents
were found to carry no mutant PHOX2B allele, following
agarose gel analysis (fig 1C) and direct sequencing (data not
shown) of the exon 3 amplification product.
Expansion of the alanine stretch in our CCHS patients
To verify the presence of a possible expansion of the
polyalanine tract in the exon 3 of a proportion of the 24
remaining non-mutant patients with CCHS, a 120 bp PCR
product, resulting from amplification with primers 145F and
279R (table 1), was run on 8% acrylamide gel (fig 2A).
Patients 8, 23, and 28 did show an extra band (with
heteroduplex formation) corresponding to a size compatible
with an expanded band. Indeed, DNA sequence of exon 3 had
Table 1 Primers and PCR conditions
Primers: name and sequence (59R39)
Amplimers Size, bp Forward Reverse T
a
,
˚
C
Exon 1* 320 35F: GGCTGAGCCATCCAGAACCT 35R: CCTATATACGGGCGGAAAGGC 62
Exon 2* 260 PH2F: TGCCGGCTGATTTGCTCAC PH2R: AGCGGGGTCGGTTTCCAGG 58
Exon 3 627 10F: TGCTTCACCGTCTCTCCTTCC 3.3R: TACCCGCTCGCCCACTCG 60
Exon 3 458 22F: GCACTGACCCGGACAGCACT 3.3R: TACCCGCTCGCCCACTCG 60
Exon 3* 120 145F: AACCCGGCAAGGGCGGC 279R: GAGCCCAGCCTTGTCCAGG 65
*Standard PCR reactions
GC rich templates PCR reactions
T
a
, temperature of annealing
374 Letter to JMG
www.jmedgenet.com
Page 2
shown, in a proportion of CCHS DNAs including 2, 3, 7, 11,
16, 23, and 28, but not 8, very weak and variable evidences of
the expansion of a number of alanines, ranging from 5 to 6
residues, with respect to the wild-type sequence. Such a
putative expansion had the shape of a double shifted
sequence displaying an intensity, in terms of height of the
single peaks, varying from 10% to 30% of the main wild-type
sequence, as shown in fig 2B, and could be observed, after
either polyacrylamide gel electrophoresis or sequencing
experiments, in seven individuals out of 27, and shown to
recur from 25% to 100% of the times the DNA from a same
individual was resequenced.
Cloning of an ‘‘alanine-expanded’’ allele
To confirm that the expanded sequence we observed did
correspond to a germline expansion of the PHOX2B allele,
carried by patients in their constitutive genomic DNA, we
undertook the cloning of an exon 3 PCR product (primers
10F+3.3R) using DNA from patient 23, which had already
shown evidence of alanine expansion, as a template. We used
a single nucleotide polymorphism (SNP) identified by us
during the mutational screening, a c870C.A change leading
to a silent substitution in codon P290 of exon 3, to
distinguish between the two alleles derived from DNA of
patient 23, who had proved to be heterozygous for this
variant (C/A). After amplification, we cloned the PCR product
and sequenced 35 clones, each corresponding to one of the
two single alleles originally present in the genomic DNA. Two
combinations of polyalanine length and SNP alleles were
obtained: the wild-type allele, containing 20 normal alanine
residues, associated with the A variant in 28 clones, while the
expanded allele, containing 25 alanine residues, associated
with the C variant in the other seven clones. This has allowed
us to verify that expansion was always associated with the
same allele, as expected in case of a genomic expansion and
to confirm a ratio of 1:4 of expanded:wild-type alleles which
reflects the fact that longer (expanded) fragments are
underrepresented in the PCR product. Moreover, the absence
of different combinations of SNP alleles and polyalanine
tracts allows the exclusion of both mosaicism in patient 23
and a possible artefact originated in vitro during DNA
amplification.
Amplification of the exon 3 GC-rich region
The presence of a polyalanine expansion seems to result in
the lack of amplification of the mutant allele. The sequence of
the PHOX2B exon 3, and especially of its polyalanine tract, is
highly GC rich (fig 1A). A probable explanation for the weak
or absent amplification observed during the sequencing of
our DNA samples is, therefore, that the presence of strong
secondary structures might inhibit the action of the DNA
polymerase during DNA amplification. In the attempt to
overcome this problem we had already modified the standard
amplification reaction by adding 10% glycerol or 7-Deaza-
dGTP or increasing the annealing temperature, or both, but
this might have not been sufficient to remove the impeding
secondary structures resulting in false negative responses. So,
to maximise the chance of correct amplification of both
Figure 1 PHOX2B frameshift mutations detected in the exon 3 of three CCHS patients. (A) Nucleotide and amino acid sequences of the coding portion
of the third and last exon of the PHOX2B gene are shown, along with the position of the single nucleotide deletion and insertion detected (underlined)
and the extent of the 38 bp interstitial deletion (boxed). (B) Sequence chromatograms of partial portions of exon 3 of the PHOX2B gene. From top to
bottom: c.614–618delC, c.862–866insG, and c.721–758del38nt. The position of the mutations is indicated. (C) AvaII enzymatic digestion of the
627 bp DNA fragment encompassing the c.721–758del38nt was obtained from genomic DNA of both a control (c) and the mother (m) and the father
(f) of the affected child (a). Unlike the first three samples, showing only bands derived from normal alleles (158 bp, 199 bp, and 270 bp), enzymatic
digestion of the patient’s sample showed an additional 232 bp band, corresponding to the deleted allele, as predicted from the sequence analysis.
Letter to JMG 375
www.jmedgenet.com
Page 3
alleles, we set up a PCR reaction making use of a couple of
primers (10F+3.3R) delimiting the whole exon 3 and of a
system properly developed for GC rich templates. Direct
sequencing of DNA amplification products thus obtained
allowed us to detect polyalanine triplet expansions in
samples which had previously shown neither variants nor
weak double sequences. In particular, we identified 22 in
frame changes leading to polyalanine expansions resulting
from duplications, inserted in different positions of the
polyalanine tract, ranging from 5 to 13 alanine residues and
involving the last 15–39 bp before the insertion. An AvaII
enzymatic digestion of the 627 bp exon 3 PCR amplimer
allowed us to confirm presence of extra bands as shown in
fig 3A. In particular, bands of 158 bp, 199 bp, and 270 bp,
this latter containing the 20 alanine stretch, were obtained
from enzymatic digestion of wild-type amplification products
while expanded alleles could be recognised by the replace-
ment of the largest fragment with an extra band of size
variable from 285 to 309 bp (duplicates from 5 to 13 alanine
residues). A summary of all the polyalanine expansions
observed in our patients is reported in figure 3B. Polyalanine
triplet expansion has also been detected in the affected
siblings of two familial CCHS cases (4F and 11F). Inheritance
by the asymptomatic mother could be proven for one of
Figure 2 Expansion of the 20 alanine residues tract of PHOX2B. (A) Polyacrylamide Gel Electrophoresis of a 120 bp fragment obtained with primers
145F and 279R in DNA from 16 patients and 1 control. Patient 23, and to a lesser extent also patients 8 and 28, show extra large bands accompanied
by heteroduplexes at a higher size. Such a pattern is compatible with the presence of two PCR products and presumably with an alanine expansion. (B)
28 nucleotides sequence chromatogram of an exon 3 portion of the PHOX2B gene (selected at the end of the polyalanine stretch) obtained from patient
23, who shows a double band in the polyacrilamide gel electrophoresis analysis of the 145F+279R PCR product (see panel (A)). The sequence pattern
of patient 23 is in agreement with an expanded PCR product present with an intensity much lower than the wild-type sequence.
376 Letter to JMG
www.jmedgenet.com
Page 4
these, while, in the other case, the mother does not carry the
Ala expansion and DNA from the father is not available (data
not shown). The asymptomatic mother of a sporadic case
with an 18 bp expansion of the alanine stretch has resulted
in carrying the same mutant allele (data not shown). Patients
17 (LOCHS) and 25 (CCHS) showed neither mutations nor
expansions of the polyalanine stretch in exon 3. Loss of
heterozygosity could be excluded at a SNP locus identified by
us in exon 3 (c.552C.T leading to S184S) only for patient 25,
who was found to be heterozygous (C/T). A summary of all
the results is reported in table 2, along with clinical details of
each patient.
None of the mutations found in the present study were
present in 120 normal control chromosomes. On the other
hand, in agreement with a mechanism of non-homologous
recombination generating the polyalanine expansion in
disease associated mutant alleles, and according to what
had already been reported,
16–18
an alanine triplet contraction
was found in one control DNA.
Selective amplification of the shortest allele in
heterozygous individuals
During our mutational screening we had already collected
evidence to support the fact that in individuals heterozygous
for length variants of the polyalanine region of the PHOX2B
exon 3, the largest allele might have undergone unsuccessful
amplification by DNA polymerase during the PCR reaction.
To confirm such hypothesis, we have performed PCR
amplification of three DNA samples, selected to be hetero-
zygous for length variants of the polyalanine stretch, using
two different methods: the standard protocol and the GC rich
system protocol. As shown in fig 4, by using the standard
protocol we could observe no amplification from the wild-
type allele of a control’s DNA bearing a contraction of seven
alanine residues (control c93), the expanded allele of a
patient’s DNA with a duplication of five alanine residues
(patient 3), or the wild-type allele of the patient DNA with
the 38 bp deletion (patient 24). Therefore, under standard
conditions of amplification, each of the three individuals was
found to be homozygous for the shortest of his or her two
alleles. In fact, using the GC rich system protocol, two
different alleles could be amplified from each of the same
DNA samples, thus confirming the heterozygous status of the
three individuals at the polyalanine tract locus (fig 4).
DISCUSSION
Congenital Central Hypoventilation syndrome (CCHS) is a
rare disorder characterised by abnormal ventilatory response
to hypoxia and hypercapnia, often associated with other
autonomic nervous system dysfunctions.
1
A mutational screening of the PHOX2B gene in a set of 29
CCHS cases has revealed heterozygous 5–9 alanine expan-
sions within a stretch of 20 alanine in the C terminus of the
gene in 16 patients, and heterozygous frameshift mutations
in two patients (62%).
16
More recently, two similar studies
have reported both polyalanine expansions and a few
missense, nonsense and out-of-frame nucleotide changes in
exon 3 of the PHOX2B gene, reflecting mutation frequencies
of 50% and 98.5% in 10 and 67 patients respectively.
17 18
Here, we report the identification of three heterozygous
frameshift mutations and 22 in frame changes leading to
polyalanine expansions of the PHOX2B gene in a total of 27
CCHS patients studied, including three LOCHS cases (93%).
Two of the three frameshift mutations, a c.862–866insG and
a 38 bp deletion of nucleotides c.721–758, have occurred de
novo in two probands, while the third one, a novel c.614–
618delC, was inherited from the asymptomatic mother. Of
the remaining 24 patients, 20 have 5–7 extra alanine residues
in the polyalanine stretch of PHOX2B exon 3, in addition to
two other patients showing 11 and 13 polyalanine expan-
sions. We have not detected expansions of fewer than five
residues. Polyalanine triplet expansions have also been
detected in the affected siblings of two familial CCHS cases.
Inheritance from an asymptomatic parent could be proven for
only one of these cases. Parents of sporadic cases have been
found to carry no PHOX2B molecular changes with the
exception of the asymptomatic mothers of two patients with
CCHS, one already mentioned with the c.614–618delC, and
the other with an expansion of 18 alanine residues, who
demonstrated transmission of the mutant allele to their
affected children.
These observations provide a straightforward confirmation
of simple dominant inheritance in CCHS with incomplete
penetrance. So, the actual large proportion of sporadic cases
might be explained by the very high mortality of patients
with CCHS at a very young age or during the perinatal period
until a few decades ago.
Two cases, one familial CCHS and one LOCHS, have been
found to carry no PHOX2B molecular changes but we cannot
exclude yet that defects either impairing correct expression or
splicing of the gene, or residing outside the transcription unit
(position effects) are present. Genetic heterogeneity could
also explain the non-mutant patients.
As expected on the basis of data already reported,
7
in
addition to the respiratory phenotype each mutant patient
shows a different and variable range of symptoms, mostly
regarded as ANS dysfunctions (table 2). It is noticeable that
the patient carrying the 38 bp deletion (24) is the most
seriously affected, with complete apnoea during sleep, severe
hypoventilation during wakefulness and an extremely severe
form of HSCR with total aganglionosis from duodenum to
anus. Also patients 10 and 14, carrying the 11th and 13th
largest polyalanine expansions respectively, show an ex-
tremely severe respiratory phenotype with the need of
Figure 3 Expansion of the 20 alanine residues tract of PHOX2B in
CCHS patients. (A) Examples of various duplication lengths (+15 to +39
nucleotides corresponding to +5to+13 alanine residues) are provided
and shown as extra bands of size variable from 285 to 309 bp,
obtained after enzymatic digestion with AvaII of the 627 bp PCR product
of PHOX2B exon 3 (primers 10F+3.3R) and migration on a 4% agarose
gel (158 bp, 199 bp, and 270 bp are the expected, wild-type bands).
On the top of each lane the length of duplication is reported as number
of nucleotides. (B) Summary of the polyalanine expansions observed in
our patients. The duplicated codons are shown in grey boxes. An
asterisk is used to distinguish between different positions at which
expansions of the same size have occurred.
Letter to JMG 377
www.jmedgenet.com
Page 5
ventilatory support during the day time, the latter patient
presenting HSCR too. In the attempt to draw a genotype-
phenotype correlation, we subdivided, on the basis of
available information, patients into two groups according to
their capacity to maintain sufficient oxygenation and
ventilation for at least 30–60 minutes of sleep after removing
mechanical ventilator support.
20
In particular, in the most
severely affected group, in which hypoxia and hypercapnia
occurred after a few minutes of spontaneous ventilation,
there are children affected with Hirschsprung disease and
children with awake hypoventilation. This is the case of the
patient carrying the 38 bp deletion, the two patients with the
largest polyalanine expansions already mentioned and of
some patients showing 6 or 7 alanine duplications. On the
other hand, patients included in the least severely affected
group, with children able to sustain 30–60 minutes of
spontaneous ventilation before the PCO
2
rises to 65 mmHg
in non-rapid eye movement sleep, neither presented with
Hirschsprung nor demonstrated inadequate ventilation while
awake, and all of them showed polyalanine expansions of
15 bp (five alanine residues). This is also the case of the two
LOCHS patients found to carry five extra Ala residues, who
showed the first mild respiratory symptoms when two years
old or later. Therefore, the differential diagnosis between
LOCHS
19
and CCHS needs to be revisited since, at least at the
respiratory level, the two so far clinically distinct conditions
seem to reflect the same molecular disorder. Overall, these
observations confirm the hypothesis of a genotype-phenotype
correlation with phenotypic severity increasing with the
polyalanine expansion size, and are in agreement with
similar observations, recently made on the basis of the mean
number of ANSD symptoms and the daily duration of
ventilatory support.
18
The 20 trinucleotide repeat of the polyalanine tract in
PHOX2B is imperfect (fig 1). Therefore, replication slippage is
unlikely and expansions are most probably caused by
recombination between two mispaired alleles (unequal
crossing over), as already proposed.
21 22
Such a mispairing
mechanism is expected to result in expansions as well as
Table 2 Clinical and molecular characterisation of our CCHS patients
Country of
origin Patients Ventilation ANSD Gastro-intestinal symptoms Mutation Transmission
I 01 LOCHS during sleep dup15 de novo
I 02 during sleep O dup18 de novo
I 03 during sleep dysrhythmia, loss of
consciousness
dup18* de novo
I 04 F during sleep O constipation dup15 inherited
I 05 during sleep O, decreased heart rate
variability
dup21 de novo
I 06 during sleep O dup21 de novo
I 07 during sleep dup18 de novo
I 08 during sleep dup18* de novo
I 09 during sleep dup18* inherited
I10
24 hr O constipation dup33 de novo
G 11 F during sleep dup15* ?
G 12 during sleep dup18* ?
G 13 24 hr dup21 ?
G 14 24 hr HSCR dup39 ?
I 15 LOCHS during sleep dup15 de novo
I 16 during sleep loss of consciousness abdominal pain dup15* de novo
I 17 LOCHS during sleep ne
I 18 during sleep dup18* de novo
I 19 during sleep gastroesophageal reflux dup15 de novo
I 20 during sleep O, loss of consciousness,
altered sweating
dysphagia dup21 ?
I 21 during sleep O, dysrhythmia, loss of
consciousness
constipation insG de novo
G 22 during sleep HSCR dup21 de novo
I 23 during sleep altered perception of pain constipation dup15 de novo
I24
`
24 hr O HSCR del38 de novo
NL 25F during sleep ne
NL 27
1
during sleep delC inherited
I 28 during sleep O dup18 de novo
I, Italy; G, Germany; NL, The Netherlands; F, familial case; LO-CHS, late onset CHS; O, ocular anomalies
*distinguishes expansions of similar size but different localisation within the polyalanine stretch
Growth hormone deficiency;
`
died at 4 months;
1
tetralogy of
Fallot; ne, not expanded
Figure 4 Non-random amplification of the shortest allele in
heterozygous individuals. Wild-type and extra bands, obtained on a 4%
agarose gel electrophoresis after enzymatic digestion with AvaII of a
627 bp fragment (primers 10F and 3.3R) are shown. Three DNA
samples have been amplified using two different PCR methods: the
standard protocol and the GC rich system protocol. Using the standard
protocol, we could not observe any amplification from the wild-type
allele in a control DNA bearing a contraction of seven alanine residues
(c93), the expanded allele in a patient DNA with an expansion of five
alanine residues (3), or the wild-type allele in the patient DNA with the
38 bp deletion (24). In contrast, using the GC rich system protocol, two
different alleles could be amplified from each DNA sample thus
confirming the heterozygous status of the three individuals at the
polyalanine tract locus.
378 Letter to JMG
www.jmedgenet.com
Page 6
contractions, a phenomenon that has been reported so far
only in healthy individuals, and observed also in our control
set, in terms of the presence of a rare polymorphism having
no effect on the phenotype.
The existence of a mutational hotspot in the region coding
for the polyalanine domain of PHOX2B needs to be postulated
since 92% of all mutations we detected so far in this gene
leads to variations in the length of the polyalanine tract.
There are at least nine genes in which alanine expansions
have been shown to cause human disease.
22
Moreover, 31 out
of 98 sequences coding for polyalanine domains in the
human genome have been found polymorphic, thus suggest-
ing the opportunity of screening similar sequences in
different pathologies.
22
Although polyalanine tracts are
common in transcription factors, neither their normal
function nor the effects of their expansion are understood.
Polyalanine tracts have been found in repression motifs of
several proteins containing homeodomains and demon-
strated, in some cases, to be responsible for the repression
of target genes.
23
In other cases, polyalanine tracts act as
flexible spacer elements between functional domains.
24
Thus,
polyalanine expansions observed in PHOX2B may either
directly interfere with protein-protein interactions, distort
an essential secondary structure, or act as dominant negative
factors. The correlation between phenotypic severity and
expansion size observed in CCHS suggests that tracts of 25 or
more polyalanines might confer a progressive gain of
function to PHOX2B, a hypothesis which will require further
studies.
During our study we have collected proof that polyalanine
expansion corresponds to a PHOX2B allele carried by
patients in their constitutive genomic DNA. Indeed, at first
in our sequencing experiments alanine expansions had the
appearance of an unclear background lying behind the
normal DNA sequence in a small proportion of patients.
Under the hypothesis that in individuals heterozygous for
defects involving length changes of the polyalanine stretch
of exon 3, the largest allele is always prone to unsuccessful
amplification by DNA polymerase, and to avoid incorrect
interpretation of the genotype of some patients and
controls, we have developed a proper PCR protocol. Results
reported in fig 4 have confirmed our hypothesis, showing
different amplification outcomes when using different
experimental protocols: when DNA amplification occurs
under standard procedures, the shortest product is always
observed while the largest amplimer can remain undetect-
able, as in the case of alanine expanded against wild-type
alanine stretches and of wild-type alanine stretches against
both the del38 allele and an alanine contracted tract in a
control (fig 4). Such a misleading methodological aspect can
cause mistakes in recording individuals’ genotypes and we
therefore suggest great care when approaching PHOX2B
mutational screening and especially for PHOX2B molecular
diagnosis in relatives of affected children. Indeed, following
observation of recurrence of PHOX2B defects and potential
transmission of the CCHS phenotype to progeny, an accurate
detection of PHOX2B mutations represents the ground for
genetic counselling, which has become indispensable for
couples with an affected child to determine the recurrence
risk to a fetus.
In conclusion, PHOX2B is confirmed as the major gene in
CCHS pathogenesis and autosomal dominant inheritance
with reduced penetrance is now demonstrated. Moreover, a
correlation between phenotypic severity and expansion
length of the polyalanine tracts can be assumed and used
to predict onset and progression of the disease in mutation
carriers. Finally, molecular testing and genetic counselling
has now become feasible, thus giving hopes to many families
with CCHS.
ACKNOWLEDGEMENTS
We are extremely grateful to all the families who have participated in
this study and the clinicians who have reported details of patients
and provided blood samples. We want to thank Francesca Schena
and Giuseppe Santamaria for their technical help.
Authors’ affiliations
.....................
I Matera, T Bachetti, F Puppo, M Di Duca, R Ravazzolo, I Ceccherini,
Laboratorio di Genetica Molecolare, Istituto G Gaslini, Genova, Italy
M Di Duca, Laboratorio di Fisiopatologia dell’Uremia, Istituto G Gaslini,
Genova Italy
F Morandi, UO Pediatria, Ospedale ‘‘Sacra Famiglia’’, Erba (CO), Italy
G M Casiraghi, UO Anestesia e Rianimazione, Ospedale Mandic,
Merate (Lecco), Italy
M R Cilio, Divisione di Neurologia, Ospedale Bambino Gesu’, Roma,
Italy
R Hennekam, Departments of Paediatrics and Clinical Genetics,
University of Amsterdam, The Netherlands
R Hofstra, Department of Medical Genetics, University of Groningen,
The Netherlands
J G Scho¨ber, Kinderklinik Dritter Orden (vormals Lachnerklinik),
Mu¨nchen, Germany
R Ravazzolo, Dipartimento di Pediatria e CEBR, Universita` di Genova,
Italy
G Ottonello, UO Anestesia e Rianimazione, Istituto G Gaslini, Genova,
Italy
This study was begun with the financial support of Telethon Italy (grant
no E791) which is gratefully acknowledged. The completion of our work
has been guaranteed by a grant obtained from Compagnia di San
Paolo. Finally, we gratefully acknowledge the financial support of the
European Community (contract no QLG1-CT-2001–01646) and of the
Ministry of University (FIRB project to RR).
Conflicts of interest: none declared.
Correspondence to: Isabella Ceccherini, Ph.D, Laboratorio Genetica
Molecolare, Istituto G Gaslini, L.go G Gaslini, 5, 16148 Genova, Italy;
isa.c@unige.it
Revised version received 14 November 2003
Accepted for publication 17 November 2003
REFERENCES
1 Weese-Mayer DE, Shannon DC, Keens TG, Silvestri JM. Idiopathic congenital
Central Hypoventilation syndrome. Am J Respir Crit Care Med
1999;160:368–73.
2 Haddad GG, Mazza NM, Defendini R, Blanc WA, Driscoll JM, Epstein MA,
Epstein RA, Mellins RB. Congenital failure of automatic control of ventilation,
gastrointestinal motility and heart Rate. Medicine (Baltimore)
1978;57:517–26.
3 Bower RJ, Adkins JC. Ondine’s curse and neurocristopathy. Clin Pediatr
(Phila) 1980;19:665–8.
4 Hamilton J, Bodurtha JN. Congenital central hypoventilation syndrome and
Hirschsprung’s disease in half sibs. J Med Genet 1989;26:272–4.
5 Weese-Mayer DE, Silvestri JM, Marazita ML, Hoo JJ. Congenital central
hypoventilation syndrome: inheritance and relation to sudden infant death
syndrome. Am J Med Genet 1993;47:360–77.
6 Silvestri JM, Chen ML, Weese-Mayer DE, McQuitty JM, Carveth HJ,
Nielson DW, Borowitz D, Cerny F. Idiopathic congenital central
hypoventilation syndrome: the next generation. Am J Med Genet
2002;112:46–50.
7 Weese-Mayer DE, Silvestri JM, Huffman AD, Smok-Pearsall SM, Kowal MH,
Maher BS, Cooper ME, Marazita ML. Case/control family study of autonomic
nervous system dysfunction in idiopathic congenital central hypoventilation
syndrome. Am J Med Genet 2001;100:237–45.
8 Marazita ML, Maher BS, Cooper ME, Silvestri JM, Huffman AD, Smok-
Pearsall SM, Kowal MH, Weese-Mayer DE. Genetic segregation analysis of
autonomic nervous system dysfunction in families of probands with idiopathic
congenital central hypoventilation syndrome. Am J Med Genet
2001;100:229–36.
9 Bolk S, Angrist M, Xie J, Yanagisawa M, Silvestri JM, Weese-Mayer DE,
Chakravarti A. Endothelin-3 frameshift mutation in congenital central
hypoventilation syndrome. Nat Genet 1996;13:395–6.
10 Amiel J, Salomon R, Attie T, Pelet A, Trang H, Mokhtari M, Gaultier C,
Munnich A, Lyonnet S. Mutations of the RET-GDNF signalling pathway in
Ondine’s curse. Am J Hum Genet 1998;62:715–7.
11 Sakai T, Wakizaka A, Matsuda H, Nirasawa Y, Itoh Y. Point mutation in exon
12 of the receptor tyrosine kinase proto-oncogene RET in Ondine-
Hirschsprung syndrome. Pediatrics 1998;101:924–6.
12 Weese-Mayer DE, Bolk S, Silvestri JM, Chakravarti A. Idiopathic congenital
central hypoventilation syndrome: evaluation of brain-derived neurotrophic
Letter to JMG 379
www.jmedgenet.com
Page 7
factor genomic DNA sequence variation. Am J Med Genet
2002;107:306–10.
13 Matera I, Bachetti T, Cinti R, Lerone M, Gagliardi L, Morandi F, Motta M,
Mosca F, Ottonello G, Piumelli R, Schober JG, Ravazzolo R, Ceccherini I.
Mutational analysis of the RNX gene in congenital central hypoventilation
syndrome. Am J Med Genet 2002;113:178–82.
14 Brunet JF, Pattyn A. Phox2 genes from patterning to connectivity. Curr Opin
Genet Dev 2002;12:435–40.
15 Pattyn A, Morin X, Cremer H, Goridis C, Brunet JF. The homeobox gene
Phox2b is essential for the development of autonomic neural crest derivatives.
Nature 1999;399:366–70.
16 Amiel J, Laudier B, Attie-Bitach T, Trang H, de Pontual L, Gener B, Trochet D,
Etchevers H, Ray P, Simonneau M, Vekemans M, Munnich A, Gaultier C,
Lyonnet S. Polyalanine expansion and frameshift mutations of the paired-like
homeobox gene PHOX2B in congenital central hypoventilation syndrome. Nat
Genet 2003;33:459–61.
17 Sasaki A, Kanai M, Kijima K, Akaba K, Hashimoto M, Hasegawa H, Otaki S,
Koizumi T, Kusuda S, Ogawa Y, Tuchiya K, Yamamoto W, Nakamura T,
Hayasaka K. Molecular analysis of congenital central hypoventilation
syndrome. Hum Genet 2003;114:22–6.
18 Weese-Mayer DE, Berry-Kravis EM, Zhou L, Maher BS, Silvestri JM,
Curran ME, Marazita ML. Idiopathic congenital central hypoventilation
syndrome: analysis of genes pertinent to early autonomic nervous system
embryologic development and identification of mutations in PHOX2b.
Am J Med Genet 2003;123A:267–78.
19 Katz ES, McGrath S, Marcus CL. Late-onset central hypoventilation with
hypothalamic dysfunction: a distinct clinical syndrome. Pediatr Pulmonol
2000;29:62–8.
20 Gaultier C, Trang-Pham H, Praud JP, Gallego J. Cardiorespiratory control
during sleep in the congenital Central Hypoventilation syndrome. Proceedings
from the first international symposium on the congenital Central
Hypoventilation syndrome—New Orleans, LA, May 11, 1996. Pediat
Pulmonol 1997;23:140–2.
21 Warren ST. Polyalanine expansion in synpolydactyly might result from
unequal crossing-over of HOXD13. Science 1997;275:408–9.
22 Lavoie H, Debeane F, Trinh QD, Turcotte JF, Corbeil-Girard LP, Dicaire MJ,
Saint-Denis A, Page M, Rouleau GA, Brais B. Polymorphism, shared functions
and convergent evolution of genes with sequences coding for polyalanine
domains. Hum Mol Genet 2003;12:2967–79.
23 Han K, Manley JL. Functional domains of the Drosophila Engrailed protein.
EMBO J 1993;12:2723–33.
24 Karlin S, Burge C. Trinucleotide repeats and long homopeptides in genes and
proteins associated with nervous system disease and development. Proc Natl
Acad Sci U S A 1996;93:1560–5.
380 Letter to JMG
www.jmedgenet.com
Page 8
  • Source
    • "A wide variety of mutations were identified. While the most frequently reported mutation was a variable expansion of a 20-alanine stretch ranging from +5 to +13 alanines within exon 3 of the PHOX2B gene, frameshift and missense mutations also occur but only occasionally within exon 1, 2 or 3 of the PHOX2B gene [30,31,39,40]. The presence of a PHOX2B mutation confirms the diagnosis of CCHS. "
    Full-text · Dataset · Nov 2015
  • Source
    • "The identification of PHOX2B as the disease-causing gene in CCHS (Amiel et al., 2003; Cummings et al., 2009; Matera et al., 2004; Sasaki et al., 2003) generated considerable interest in the role for this gene in CCHS as well as in prevalent conditions such as sleep apnea. PHOX2B mutations were recently found in adults with sleep-related hypoventilation and, in some instances, central apneas and severe hypoxemia, i.e., deficient blood oxygenation (Antic et al., 2006; Barratt et al., 2007; Diedrich et al., 2007; Doherty et al., 2007; Dubreuil et al., 2008; Gaultier et al., 2004; Hoppenbrouwers et al., 2005; Matera et al., 2004; Trochet et al., 2005). Thus, respiratory control disorders associated with PHOX2B mutations may be more prevalent than previously inferred from the very low incidence of CCHS in newborns. "
    Full-text · Dataset · Nov 2015
  • Source
    • "The objective of this examination of the autonomic nervous system in CCHS is to reveal the neural mechanisms underlying the major characteristics of the syndrome, to examine the impaired reflexive interactions contributing to those symptoms, and to suggest potential interventions which may be useful in managing the progression of the condition. Determination of the genetic processes underlying the syndrome reveals that mutations of the paired-like homeobox (PHOX2B) gene, which contributes to early development of autonomic neurons, are principally responsible for the broad range of symptoms encountered (Amiel et al., 2003; Sasaki et al., 2003; Matera et al., 2004; Patwari et al., 2010; Weese-Mayer et al., 2010). Variations in expression of those mutations result in differing degrees of severity or uniqueness in characteristics found in the syndrome. "
    [Show abstract] [Hide abstract] ABSTRACT: Congenital central hypoventilation syndrome (CCHS) patients show major autonomic alterations in addition to their better-known breathing deficiencies. The processes underlying CCHS, mutations in the PHOX2B gene, target autonomic neuronal development, with frame shift extent contributing to symptom severity. Many autonomic characteristics, such as impaired pupillary constriction and poor temperature regulation, reflect parasympathetic alterations, and can include disturbed alimentary processes, with malabsorption and intestinal motility dyscontrol. The sympathetic nervous system changes can exert life-threatening outcomes, with dysregulation of sympathetic outflow leading to high blood pressure, time-altered and dampened heart rate and breathing responses to challenges, cardiac arrhythmia, profuse sweating, and poor fluid regulation. The central mechanisms contributing to failed autonomic processes are readily apparent from structural and functional magnetic resonance imaging studies, which reveal substantial cortical thinning, tissue injury, and disrupted functional responses in hypothalamic, hippocampal, posterior thalamic, and basal ganglia sites and their descending projections, as well as insular, cingulate, and medial frontal cortices, which influence subcortical autonomic structures. Midbrain structures are also compromised, including the raphe system and its projections to cerebellar and medullary sites, the locus coeruleus, and medullary reflex integrating sites, including the dorsal and ventrolateral medullary nuclei. The damage to rostral autonomic sites overlaps metabolic, affective and cognitive regulatory regions, leading to hormonal disruption, anxiety, depression, behavioral control, and sudden death concerns. The injuries suggest that interventions for mitigating hypoxic exposure and nutrient loss may provide cellular protection, in the same fashion as interventions in other conditions with similar malabsorption, fluid turnover, or hypoxic exposure.
    Full-text · Article · Oct 2015 · Frontiers in Neuroscience
Show more