Article

Leptin Receptor Signaling in POMC Neurons Is Required for Normal Body Weight Homeostasis

Department of Pediatrics, Columbia University, New York, New York, United States
Neuron (Impact Factor: 15.05). 07/2004; 42(6):983-91. DOI: 10.1016/j.neuron.2004.06.004
Source: PubMed

ABSTRACT

Neuroanatomical and electrophysiological studies have shown that hypothalamic POMC neurons are targets of the adipostatic hormone leptin. However, the physiological relevance of leptin signaling in these neurons has not yet been directly tested. Here, using the Cre/loxP system, we critically test the functional importance of leptin action on POMC neurons by deleting leptin receptors specifically from these cells in mice. Mice lacking leptin signaling in POMC neurons are mildly obese, hyperleptinemic, and have altered expression of hypothalamic neuropeptides. In summary, leptin receptors on POMC neurons are required but not solely responsible for leptin's regulation of body weight homeostasis.

Download full-text

Full-text

Available from: Robert A McGovern, Aug 15, 2014
  • Source
    • "backbone of RP23-352G18 BAC DNA were replaced via homologous recombination [25] by an ampicillin resistance gene cassette generated via PCR amplification of a PGEM-T-Easy vector template with the primer sets: 5 0 GATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAACATGAG- AATTGATCCGGATATATGAGTAAACTTGGTCTGAC and 5 0 GTTAACCGGGCTGCATCCGATGCAAGTGTGTCGCTGTCGACGGTGACC- CTATAGTCGAGGCGGTATTTTCTCCTTACGCATC. The modified RP23- 352G18 BAC DNA was then purified and microinjected in its circular state into pronuclei of fertilized embryos of C57Bl/6J mice using standard methods [24]. By genotyping of tail biopsies using the following primer sets 5 0 TTGCTCTTGCGGGAAGCCCG and 5 0 GATACCGAGGGCGCCGTTCG (specific to the pBACe3.6 "
    [Show abstract] [Hide abstract]
    ABSTRACT: Objective Available treatment for obesity and type 2 diabetes mellitus (T2DM) is suboptimal. Thus, identifying novel molecular target(s) exerting protective effects against these metabolic imbalances is of enormous medical significance. Sirt6 loss- and gain-of-function studies have generated confounding data regarding the role of this sirtuin on energy and glucose homeostasis, leaving unclear whether activation or inhibition of SIRT6 may be beneficial for the treatment of obesity and/or T2DM. Methods To address these issues, we developed and studied a novel mouse model designed to produce eutopic and physiological overexpression of SIRT6 (Sirt6BAC mice). These mutants and their controls underwent several metabolic analyses. These include whole-blood reverse phase high-performance liquid chromatography assay, glucose and pyruvate tolerance tests, hyperinsulinemic-euglycemic clamp assays, and assessment of basal and insulin-induced level of phosphorylated AKT (p-AKT)/AKT in gastrocnemius muscle. Results Sirt6BAC mice physiologically overexpress functionally competent SIRT6 protein. While Sirt6BAC mice have normal body weight and adiposity, they are protected from developing high-caloric-diet (HCD)-induced hyperglycemia and glucose intolerance. Also, Sirt6BAC mice display increased circulating level of the polyamine spermidine. The ability of insulin to suppress endogenous glucose production was significantly enhanced in Sirt6BAC mice compared to wild-type controls. Insulin-stimulated glucose uptake was increased in Sirt6BAC mice in both gastrocnemius and soleus muscle, but not in brain, interscapular brown adipose, or epididymal adipose tissue. Insulin-induced p-AKT/AKT ratio was increased in gastrocnemius muscle of Sirt6BAC mice compared to wild-type controls. Conclusions Our data indicate that moderate, physiological overexpression of SIRT6 enhances insulin sensitivity in skeletal muscle and liver, engendering protective actions against diet-induced T2DM. Hence, the present study provides support for the anti-T2DM effect of SIRT6 and suggests SIRT6 as a putative molecular target for anti-T2DM treatment.
    Full-text · Article · Sep 2015 · Molecular Metabolism
  • Source
    • "Generation of GalR1-mCherry-[neo + ] and GalR2-hrGFP-[neo + ] knockin mice Mouse genomic clones including either GalR1 or GalR2 genes from the bMQ mouse strain 129S7 (129Sv) bacterial artificial chromosome (BAC) library (inserts 89–178 kb; Source BioScience; Adams et al., 2005) were electroporated into strain EL250 Escherichia coli (Lee et al., 2001). This allowed temperature-inducible, lambda Red-mediated, homologous recombination into the BAC (Copeland et al., 2001; Lee et al., 2001) of PCR products from either vector hrGFP-FRTneoFRT (Balthasar et al., 2004; Parton et al., 2007; hrGFP derived from Stratagene-Agilent vector phrGFP-1, Zeng et al., 2003; Fig. 2A, middle panel) flanked by GalR2 homologous sequence or vector mCherry- FRTneoFRT (hrGFP exchanged for mCherry; Shaner et al., 2004) flanked by GalR1 homologous sequence. Within the latter PCR product an AseI restriction site was introduced immediately downstream of the 3′ FRT site (Fig. 1A, middle panel), for use in Southern blot digests, and the mCherry/hrGFP heterologous 3′-untranslated region (UTR) has identity to nt 705–1193 of vector pCMV-Script (AF028239) which includes the SV40 early region poly(A) site (Connelly and Manley, 1988; J02400, nt 2828–2547). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The neuropeptide galanin has diverse roles in the central and peripheral nervous systems, by activating the G protein-coupled receptors Gal1 and Gal2 and the less studied Gal3 (GalR1-3 gene products). There is a wealth of data on expression of Gal1-3 at the mRNA level, but not at the protein level due to the lack of specificity of currently available antibodies. Here we report the generation of knock-in mice expressing Gal1 or Gal2 receptor fluorescently tagged at the C-terminus with, respectively, mCherry or hrGFP (humanized Renilla green fluorescent protein). In dorsal root ganglia (DRG) neurons expressing the highest levels of Gal1-mCherry, localization to the somatic cell membrane was detected by live-cell fluorescence and immunohistochemistry, and that fluorescence decreased upon addition of galanin. In spinal cord, abundant Gal1-mCherry immunoreactive processes were detected in the superficial layers of the dorsal horn, and highly expressing intrinsic neurons of the lamina III/IV border showed both somatic cell membrane localization and outward transport of receptor from the cell body, detected as puncta within cell processes. In brain, high levels of Gal1-mCherry immunofluorescence were detected within thalamus, hypothalamus and amygdala, with a high density of nerve endings in the external zone of the median eminence, and regions with lesser immunoreactivity included the dorsal raphe nucleus. Gal2-hrGFP mRNA was detected in DRG, but live-cell fluorescence was at the limits of detection, drawing attention to both the much lower mRNA expression than to Gal1 in mice and the previously unrecognized potential for translational control by upstream open reading frames (uORFs). Copyright © 2015. Published by Elsevier Inc.
    Full-text · Article · Aug 2015 · Molecular and Cellular Neuroscience
  • Source
    • "EGFP - TVA signals were colocalized with POMC or AgRP immunoreactivity in the majority ( ∼95% ) of the neurons in the ARC ( Figures 1C , D ) , confirming the accuracy of these two driver mouse lines ( Balthasar et al . , 2004 ; Tong et al . , 2008 ) . Starter neurons were characterized by the coexpression of RV - mCherry and EGFP - TVA , which was restricted within the ARC , unilateral to the injection site ( Figures"

    Full-text · Article · Mar 2015 · Frontiers in Neuroanatomy
Show more