Gene expression profiles in microdissected neurons from human hippocampal subregions

Article (PDF Available)inMolecular Brain Research 127(1-2):105-14 · September 2004with36 Reads
DOI: 10.1016/j.molbrainres.2004.05.017 · Source: PubMed
Abstract
Pyramidal neurons in hippocampal subregions are selectively vulnerable in certain disease states. To investigate, we tested the hypothesis that selective vulnerability in human hippocampus is related to regional differences in neuronal cell death and cell receptor gene expression in CA1 vs. CA3 subregions. We used laser capture microdissection to remove approximately 600 CA1 and 600 CA3 pyramidal neurons each from five fresh-frozen normal post-mortem brains, extracted total RNA and double-amplified mRNA. This was reverse transcribed and labeled for hybridization onto human cDNA array chips containing probes to 10,174 genes and unknown ESTs. RNA from additional microdissections was pooled for replicate hybridizations and quantitative RT-PCR validation. Gene expression differences were few (< 1%). We found 43 enriched genes in CA1 neuronal samples that included peripheral benzodiazipine receptor-associated protein, nicotinic cholinergic receptor, two chemokine receptors (CCR1 and CCR5) and several transcriptional factors. We found 17 enriched genes in the CA3 neuronal samples that included fibroblast growth factor receptor and prostaglandin-endoperoxide synthase 1. We found no differential gene expression for 23 calcium channel proteins; nine transporter proteins; 55 cell death and apoptotic regulator proteins; and an additional 497 cell receptors, including 24 glutamate receptors. Quantitative RT-PCR of four differentially expressed genes confirmed the microarray data. The results confirm the ability to examine gene expression profiles in microdissected neurons from human autopsy brain. They show only minor gene expression differences between two distinct neuronal populations in the hippocampus and suggest that selective hippocampal vulnerability is due to factors other than intrinsic differential expression in glutamate receptors and cell death genes.

Figures

Research report
Gene expression profiles in microdissected neurons from human
hippocampal subregions
Jorge E. Torres-Mun
˜
oz
a,
*
, Corina Van Waveren
b
, Martha G. Keegan
a
,
Richard J. Bookman
c,d
, Carol K. Petito
a
a
Department of Pathology, University of Miami School of Medicine (R-5), 1550 NW, Tenth Avenue, Miami, FL 33136, USA
b
Department of Cell Biology and Anatomy, University of Miami School of Medicine (R-5), 1550 NW, Tenth Avenue, Miami, FL 33136, USA
c
Department of Molecular and Cellular Pharmacology, University of Miami School of Medicine (R-5), 1550 NW, Tenth Avenue, Miami, FL 33136, USA
d
Department of Neuroscience Program, University of Miami School of Medicine (R-5), 1550 NW, Tenth Avenue, Miami, FL 33136, USA
Accepted 2 May 2004
Available online 14 July 2004
Abstract
Pyramidal neurons in hippocampal subregions are selectively vulnerable in certain disease states. To investigate, we tested the hypothesis
that selective vulnerability in human hippocampus is related to regional differences in neuronal cell death and cell receptor gene expression in
CA1 vs. CA3 subregions. We used laser capture microdissection to remove approximately 600 CA1 and 600 CA3 pyramidal neurons each
from five fresh-frozen normal post-mortem brains, extracted total RNA and double-amplified mRNA. This was reverse transcribed and
labeled for hybridization onto human cDNA array chips containing probes to 10,174 genes and unknown ESTs. RNA from additional
microdissections was pooled for replicate hybridizations and quantitative RT-PCR validation. Gene expression differences were few ( < 1%).
We found 43 enriched genes in CA1 neuronal samples that included peripheral benzodiazipine receptor-associated protein, nicotinic
cholinergic receptor, two chemokine receptors (CCR1 and CCR5) and several transcriptional factors. We found 17 enriched genes in the CA3
neuronal samples that included fibroblast growth factor receptor and prostaglandin-endoperoxide synthase 1. We found no differential gene
expression for 23 calcium channel proteins; nine transporter proteins; 55 cell death and apoptotic regulator proteins; and an additional 497
cell receptors, including 24 glutamate receptors. Quantitative RT-PCR of four differentially expressed genes confirmed the microarray data.
The results confirm the ability to examine gene expression profiles in microdissected neurons from human autopsy brain. They show only
minor gene expression differences between two distinct neuronal populations in the hippocampus and suggest that selective hippocampal
vulnerability is due to factors other than intrinsic differential expression in glutamate receptors and cell death genes.
D 2004 Elsevier B.V. All rights reserved.
Theme: Cellular and molecular biology
Topic: Gene structure and function: general
Keywords: Laser capture microdissection; Amplified mRNA; Microarrays; Selective vulnerability; Human hippocampus
1. Introduction
The hippocampal formation is the site where short-term
memory is laid down and consolidated into long-term
memory, a process that is lost in patients with bilateral
injury to the hippocampus [64,76]. Its pyramidal neurons
are divided into CA1 to CA4 subregions on the basis of their
cytoarchitecture, cell morphology, immunoreactivity and
synaptic connections [2,11,35,37]. A characteristic feature
of the hippocampus is the regional vul nerability of its
pyramidal neurons in different subregions. CA1 neurons
are more vulnerable than CA3 neurons following global
ischemia [28,53,58] and with Alzheimers Disease [47] and
epilepsy [41]. In contrast, CA3 neurons are more vulnerable
in patients with schizophrenia [25] and follow ing exposure
to corticosteroids [19,62], tri-methyl-tin intoxication [4] and
intraventricular kainic acid [46]. Underlying mechanisms
for t his selective vulnerability may differ according to
disease states. Differential modulation of CA1 vs. CA3
NMDA receptors [24] may underlie CA1 v ulnerability
0169-328X/$ - see front matter D 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.molbrainres.2004.05.017
* Corresponding author. Tel.: +1-305-243-6787; fax: +1-305-243-
4086.
E-mail address: jtorres@med.miami.edu (J.E. Torres-Mun
˜
oz).
www.elsevier.com/locate/molbrainres
Molecular Brain Research 127 (2004) 105 114
following ischemia, whereas high expression levels of
chemokine receptors in the CA3 neurons renders them more
vulnerable to chemokine or human immunodeficiency virus
(HIV)-induced cell death in vitro [26] and in patients with
HIV encephalitis [54].
To test the hypothesis that expression levels of neuronal
receptor or cell death genes contribute to selective hippo-
campal vulnerability, we compared gene expression profile
of CA1 pyramidal neurons with those of CA3 pyramidal
neurons with cDNA microarray chips. We used the Arcturus
PixCell IIe laser capture microscope (LCM) to remove
individual neurons from normal fresh-frozen autopsy brains.
The technique of LCM allows direc t microscopic identifi-
cation of specific cell types for subsequent microdissection
without appreciable loss of their DNA or RNA
[18,21,38,60]. D ouble round ampl ification of extracted
RNA provides sufficient material for subsequent microarray
analysis of differential gene expression [23,39]. The feasi-
bility of study ing mRNA from post-mortem brain is con-
firmed by recent studies [52,57,58,59,68,71] . We identified
neurons by their pyramidal shape and Nissl positivity and
distinguished the hippocampal subregions by their morphol-
ogy and microscopic organization, as cited above. Large
nuclei and a two layered structure distinguished CA2
neurons from the smaller, three-layered CA1 neurons and
the tightly packed CA3 neurons allowed distinction from the
more loosely packed CA2 neurons. A preliminary report has
been published [66].
2. Methods
2.1. Brain processing and microdissection
We selected nine HIV-1-negative and hepatitis-negative
autopsy cases that had post-mortem intervals (PMI) < 22 h,
and normal brains on gross and microscopic examination.
We used in situ end-labeling of nuclear DNA fragments
(ApopTag kit, Oncor Laboratories, Gaithersburg, MD), to
exclude cases with neuronal cell death or au tolysis. At the
time of autopsy, we bisected the brain in the midsaggital
plane; coronally sectioned one cerebral hemisphere, rapidly
froze its slices in 2-methylbutanedry ice mix, and stored the
tissue at 70 jC for periods of up to 5 years. In some cases,
we dissected fresh hippocampus prior to freezing, embedded
it in Optimal Tissue Compound (OTC) and immersed the
block in liquid nitrogen prior to storage at 70 jC. We fixed
the contralateral hemisphere and the brain stem and cerebel-
lum in 10% buffered formalin for 2 weeks prior to exami-
nation and sectioning. Brains were obtained, in part, from the
University of Miami Brain and Tissue Bank, in contract to
the National Institute of Child Health and Development
(HD83284).
Fresh-frozen human hippocampal sections were cut 6
Am thick, briefly fixed with acetone and stained with brief
Nissl stain for neuronal identification, using published
procedures that avoid RNA degrada tion [22,61]. Before
initiating microdissection, we confirmed that the tissue
contained intact RNA by detecting 18S and 28S bands on
RNA 600 Nano LabChip (Agilent Technologies, Palo Alto,
CA) from total RNA extracted from a single, unstained 6
Am frozen section. We microdissected neurons with the
Arcturus PixCell II LCM (Arcturus Eng ineering, Mountain
View, CA), using a laser beam diameter of 7.5 Am and
adjusting the voltage and duration of the laser beam to
allow capture of neuronal cytoplasm without adjacent
tissue. The average voltage was 80 mV and average
duration was 1 ms. We used the HS Transfer Caps (Arc-
turus Engineering) to capture between 100 and 300 neurons
per cap, for a total sample size between 500 and 600
microdissected neurons from CA1 and from CA3 subregion
per case (Fig. 1AC). We remo ved tissue contaminants
from the transfer cap with Arcturuss CapSure sticky pad
(Fig. 1D). We distinguished the hippocampal subregions by
their neuronal morphology and cytoarchitecture as de-
scribed above. All procedures were done under RNAse-
free conditions.
2.2. RNA isolation, amplification and labeling
We isolated total RNA from the neuronal samples with
the Pico-Pure RNA Isolation kit (Arcturus Engineering). We
determined RNA quality in the microdissected samples by
amplifying human-beta-2-microglobulin (h-h2-M) gene by
RT-PCR with the Roche Light Cycler and using a commer-
cially available kit containing h-h2-M houseke eping pri-
Fig. 1. (A) Nissl-stained section of human hippocampus identifying its
subregions CA1, CA3 (label at junction with CA2) and CA4. (B and C)
Microscopic identification of pyramidal neuron (arrow) prior to microdis-
section (B) and following microdissection (C) with the Arcturus PixCell II
laser capture microscope. (D) Microdissected neuron on the transfer cap.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114106
mers and mRNA positive control standards (Roche Bio-
chemicals, Indianapolis, IN).
We performed double round amplification of CA1 and
CA3 mRNA from each case with the RiboAmp RNA
amplification kit, according to manufacturers instructions
(Arcturus, Mountain View, CA). First round amplification
used the oligonucleotide T7-Poly-T primer for first strand
cDNA synthesis and random primers for second strand
cDNA synthesis; second round amplification reversed this
sequence. This method has an expected yield of approxi-
mately one million (1,000,000) molecules of double-ampli-
fied RNA per original cDNA template. We assessed the
amplified RNA quality with the RNA 600 Nano LabChip
(Agilent Technologies) and its quantity by UV spectropho-
tometry at 260 nm wavelength.
For those cases with demonstrable high quality aRNA in
both CA1 and CA3 samples, we labeled 200 ng of the
double-amplified RNA by in vitro transcription (IVT) using
Cy3 and Cy5-prelabeled random nanomer primers (Incyte
Genomics, Palo Alto , CA) for CA1 neurons and CA3
neurons, respectively. We incubated bar-coded-labeled
microarray chips, containing 10,174 printed sequence-veri-
Fig. 2. (A) Electropherogram from double-round amplified mRNA shows the distribution of RNA molecules that measure between 200 and 600 bases in
length. The slope and single peak of the curve indicates expected amplification when compared to positive kit controls. Y-axis: fluorescence intensity. X-axis:
time (s). (B) Scatter plot of a self hybridization test, using amplified neuronal aRNA hybridized onto a 2112 array test chip, shows equal signal intensities
indicative of equal levels of gene expression. (C) Scatter plot across the five microarrays with 8232 expressed genes and unknown ESTs ( p < 0.05) shows
unequal signal intensities of a small number of genes, indicative of unequal levels of gene expression. Y-axis: CA1 amplified mRNA; X-axis: CA3 amplified
mRNA; outer lines delineate F 2 fold differences.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114 107
fied human cDNAs, with a mixture of labeled cDNAs diluted
in microarray hybridization solution (Incyte Genomics) for 7
hat65jC. Chips then were washed and dried.
To evaluate inter- array variability, we amplified and
pooled aRNA from an additional 600 neurons/region/case
to provide sufficient material for six replicate microarrays. To
validate our microarray results, we used the pooled RNA to
perform quantitative RT-PCR for two genes enriched in the
CA1 samples and two genes enriched in the CA3 samples.
2.3. Microarray chips scanning and analysis
We scanned the microarray chips with the Axon-GenePix
4000 scanner (Axon Instruments, Union City, CA) at 532 nm
and 635 nm wavelengths. We used the GemTools software
program (Incyte Genomics) to correct for background inten-
sity and to balance the fluorescent signals. We imported the
resultant data files from the individual microarrays into the
GeneSpring software program, Version 6 (Silicon Genetics,
Redwood City, CA) using data file format ‘Incyte’ for data
analyses. This procedure normalizes the data by ‘Per Spot’
and ‘Per Chip’ intensity dependent (Lowess) normalization;
applies a t-test of < 0.05 across the five microarrays for the
coding genes (microarrays minus kit ratio: control genes);
and filters the results for expres sion levels of F | 1.7| fold as
a cut off value. The six replicate microarrays using the
pooled amplified RNA were similarly analyzed.
We also examined our results by reanalyzing the data as
one signal hybridization microarrays. Data files were
imported using format ‘custom’’. This procedure allowed
Table 1
CA1>1.7 folds enriched expressed gene list
Folds of expression GenBank ID Gene name
3.4 F 0.82 NM
_
002750 mitogen-activated protein kinase B
3.1 F 0.43 XM
_
003248 chemokine (C-C motif) receptor 1 (CCR1)
2.9 F 0.70 AF009962 chemokine (C-C motif) receptor 5 (CCR5)
2.9 F 0.36 J04162 Fc fragment of IgG
2.7 F 0.52 AU121430 keratin 15
2.7 F 0.47 D13264 macrophage scavenger receptor
2.7 F 0.50 NM
_
002193 inhibin, beta B
2.7 F 0.41 NM
_
014735 KIAA0215 gene product
2.6 F 0.43 AF043101 caveolin 3
2.6 F 0.47 AI015138 ectodermal dysplasia
2.6 F 0.32 AI081830 semaphorin
2.6 F 0.48 BE466662 KIAA1025 protein
2.6 F 0.41 BE885525 UDP-galactose transporter
2.5 F 0.48 AI498125 human transcription unit PVT gene
2.4 F 0.55 BF969830 ribose 5-phosphate isomerase A
2.3 F 0.50 NM
_
000742 cholinergic receptor, nicotinic (NChR)
2.1 F 0.50 AL035737 cartilage glycoprotein
2.1 F 0.49 AW377268 CF transmembrane conductance regulator
2 F 0.40 BF343807 CCAAT/EBP alpha
2 F 0.36 BG235918 epiregulin
1.9 F 0.32 AA029190 survival of motor neuron
1.9 F 0.40 AU146354 GTP-binding protein
1.9 F 0.34 XM
_
011235 protocadherin gamma B 6
1.8 F 0.42 NM
_
002648 pim-1 oncogene
1.8 F 0.36 XM
_
012491 crystallin, mu
1.7 F 0.23 AA862471 mitogen-activated protein kinase 9
1.7 F 0.30 AB014512 peripheral benzodiazepine receptor-associated protein 1
1.7 F 0.36 AI476817 cell division cycle 34
1.7 F 0.41 AI537920 SDH complex
1.7 F 0.37 AL049570 protein tyrosine Phosphatase
1.7 F 0.41 AL533269 clusterin
1.7 F 0.26 BC004518 B/K protein
1.7 F 0.29 BF339435 c-fos promoter activator
1.7 F 0.45 BG033853 KIAA0964 protein
1.7 F 0.47 BG110603 KIAA0368 protein
1.7 F 0.48 BG281822 ribose 5-phosphate isomerase 11
1.7 F 0.35 BG282988 CMP-NeuAC
1.7 F 0.34 BG392606 ubiquitin specific protease
1.7 F 0.46 N39944 activating transcription factor 3 (ATF3)
1.7 F 0.30 NM
_
000393 collagen, type V
1.7 F 0.38 NM
_
001585 chromosome 22 open reading frame
1.7 F 0.48 W39546 CCAAT/EBP beta
1.7 F 0.41 X55039 centromere protein
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114108
us to separately select columns of values corresponding
each signal (Cy3 and Cy5) plus the gene identifier column.
The data was normalized to the fiftieth p ercentile per chip
and to the median value per gene, and filtered by applying
analysis of variance ( p < 0.05) and for expression levels of
F | 1 .7| fold.
2.4. Quantitative RT-PCR (Q-RT-PCR)
We validated our microarray results by two step quanti-
tative RT-PCR for four of the enriched genes, normaliz ing
the data to expression levels of h-h2-M gene. First, we
reverse transcribed 20 ng of amplified aRNA from CA1
and CA3 neuronal samples by incubating the material in a
reaction mix containing 10U of AMV reverse transcripts, 20
AM random primers and 100AM dNTP (Promega, Madison,
WI)for1hat42jC in the Mas ter-Cycler Gradient
(Eppendorf, Westbury, NY). Second, we determined optimal
annealing temperature (Tm) for each of the four primer sets
in a temperature gradient-controlled PCR, 4565 jC using
the Master-Cycler Gradient (Eppendorf). We prepared stand-
ards for each gene making five 10-fold serial dilutions of
each human cloned cDNA, obtained from normal cultured
fibroblasts mRNA. These ranged from 5
10
6
to 5
10
2
transcript copies per Al. Quan titative RT-PCR was done for
chemokine (C-C motif) receptor 5 (CCR5), activating tran-
scription factor 3 (ATF-3), fibroblast growth factor receptor 1
(FGFR1) and prostaglandin-endoperoxide synthase 1
(PGES-1). Primer sequences included: CCR5: forward 5V-
ACAATGGGCT CCCTACAACATTG-3V/backward 5V-
CACAACTCTTGACTGGGTCAC-3V); ATF-3: forward
5V-CACGAGCAGA GCTAAGCAGTC-3V/ backward 5V-
GACACTGCTGCCTGAATCTAA3V): FGFR1: forward
3V-GACGGGACACCACCTACTTCTCCG-3V/backward
5V-GGCACCACAGAGTCCATTAT-3V); and PGES-1: for-
ward 5V-CATCTCAGGGAGTCTCGGGAGA-3V/backward
5V-GACAGGTCTTGGTGTTGAAGG-3V. Forward pri-
mers were labeled with the LUX Fluorogenic dye, 6-car-
boxy-fluorescein (Invitrogen, Life Technologies, Carlsbad,
CA). The PCRs were performed with the Real-Time Light
Cycler System (Roche Biochemicals) in glass capillaries
containing 2 Al test cDNA and 18 Al master mix (0.6 Units
of Platinum Quantitative PCR SuperMix-UDG, 0.6 Units of
Platinum Taq DNA polymerase, 400 AM NTPs, 4mM MgCl
2
and 5 Ag BSA Invitrogen, Life Technologies) plus 200nM 6-
carboxy-fluorescein-labeled forwa rd primer and 200 nM
backward unlabeled primer. Five standards and four replicas
were done for each g ene and for each neuronal cDNA.
During each PCR, fluorescence signals generated by pre-
quantitated standard dilutio ns, incre ased alon g the PCR
cycles, allo wed the creation of a calibration curve where
the copy number per reaction versus the threshold cycle (Ct)
of each PCR were plot ted. We calculated the copy num-
ber F S.D. of each transcript by plotting the crossing point of
each sample on the standard curves by using the LightCycler
System soft ware (Roche Biochemicals).
3. Results
Five of the nine cases had mRNA of sufficient quality for
microarray analyses in both of their neuronal samples. Their
double round amplified RNA ranged between 200 and 600
bases in length and had electropherograms with one single
broad peak (Fig. 2A). Self-hybridization tests on test micro-
arrays showed no significant differences in signal intensities
(Fig. 2B and C). Their PMI averaged 16.9 h (range 14 21.5
h); their age averaged 35.4 years (range 2248); and three
were men.
After normalization and t-test filtering for significant
hybridization signals ( p < 0.05), the arrays contained 8323
coding genes and ESTs. Sixty-one genes (0.7%) were
enriched >1.7 fold (44 in CA1 neuronal samples and 17
in CA3 neuronal samples) . Enriched genes in CA1 sam-
ples included peripheral benzodiazipine receptor-associated
protein, nicotinic cholinergic receptor (NChR), two chemo-
kine receptors (CCR1 and CCR5) and several transcription
factors (Table 1). Enriched genes in the CA3 samples
included FGFR1 and PGES-1 (Table 2). The average
correlation coefficient between t he five arrays was
0.9943 for the CA1 samples and 0.9953 for the CA3
samples.
The six replicate microarrays from the pooled samples
had identical gene profiles and contained similar enriched
Table 2
CA3>1.7 folds enriched expressed gene list
Folds of
expression
GenBank ID Gene name
3.2 F 0.28 AW247798
a
chromogranin B (secretogranin 1)
3.1 F 0.37 NM
_
002522
a
neuronal pentraxin I
2.9 F 0.27 NM
_
000237
a
lipoprotein lipase
2.7 F 0.27 BF982854 adaptor-related protein complex 2,
sigma 1 subunit
2.7 F 0.24 NM
_
023111
a
fibroblast growth factor receptor 1
(fms-related tyrosine kinase 2,
Pfeiffer syndrome)
2 F 0.25 NM
_
004796
a
neurexin 3
XM
_
003225 cholecystokinin
1.9 F 0.27 AW273142 KIAA0913 protein
1.9 F 0.28 AA432143 Cbp/p300-interacting transactivator,
with Glu/Asp-rich carboxy-terminal
domain, 1
1.8 F 0.29 D87470 KIAA0280 protein
1.8 F 0.28 BC000185 carnitine palmitoyltransferase I, liver
1.8 F 0.27 AW951196 regenerating islet-derived 1 beta
(pancreatic stone protein, pancreatic
thread protein)
1.7 F 0.26 U63846 prostaglandin-endoperoxide synthase
1 (prostaglandin G/H synthase and
cyclooxygenase)
1.7 F 0.31 BG026179 nectin 3; DKFZP566B0846 protein
1.7 F 0.29 BE614630 N-acetylneuraminic acid phosphate
synthase; sialic acid synthase
1.7 F 0.27 AI937520 slit (Drosophila) homolog 1
1.7 F 0.22 AI588970 scrapie responsive protein 1
a
Including two NMDA glutamate receptors.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114 109
gene lists a s described above: pooled CA1 samples
contained 33 enriched genes and pooled CA3 samples
contained 17 enriched genes; all were included in the above
gene lists described in Tables 1 and 2. In addition, when we
reanalyzed the data as single color hybridizations, the
resultant list of enriched genes was longer (61 in CA1 and
48 in CA3) but included 39 of the 43 enriched genes in CA1
and 15 of the 17 enriched genes in CA3.
We organized the expressed genes according to function-
al groups (using the Gene Ontology program in the Gene-
Spring software) (Table 3). Four of 501 cell receptors were
enriched in CA1 neuronal samples, including CCR1, CCR5,
MSR and NChR and one was enriched in the CA3 neurona l
samples (FGFR1). CA1 samples also contained enriched
genes for two transcriptional factors (ATF-3 and TA of the
c-fos promoter), whe reas non e were enriched i n CA3
samples. We did not detect differences in gene expression
profiles for the remaining 497 cell receptors, which included
24 glutamate receptors and seven chemo kine receptors
(Table 3). We found no differentially expressed genes for
23 calcium channel s and nine transporter proteins, incl uding
two for glutamate. Lastly, no differentially expressed genes
were present for cell death and apoptotic regul ation (n = 55),
cell growth and maintenance (n = 348), cytoskeleton
(n = 209), and cytokines (n = 26).
We further validated the results of the microarrays by
quantitative RT-PCR for CCR5, ATF-3, FGFR1 and PGES-
1, normalizing the data to h-h2-M copy numbers. CCR5 and
ATF-3 gene copy numbers were higher in CA1 samples than
in CA3 samples and FGFR1 and PGES-1 copy numbers
were higher in CA3 than in CA1 samples (Fig. 3). These
results correspond to the gene enrichment in the data
analysis of the five individual microarray experiments in
which CCR5 and ATF-3 were enriched in CA1 samples and
FGFR1 and PGES-1 were enriched in CA3 samp les.
4. Discussion
Microdissection offers the opportunity to study cell-
specific DNA and RNA by permitting removal of single
cell types. Sufficient RNA from as few as one to 100
microdissected cells of rat brain provides sufficient ampli-
fied mRNA to perform reliable microarrays [8,31]. When
RNA is limited, eith er by examining a single cell or by
using tissues with partially degraded RNA, as in our autopsy
specimens, double round amplification is feasible without
loss of accuracy or reproducibility [23,39]. As described, we
optimized the methodology to minimize RNA degeneration
and tissue contamination. We confirmed the specificity of
neuronal dissection by the absence of glial and microglial-
specific gene expression on the microarrays. We selected 1.7
fold as cut-off values for differential gene expression since
brain contains large numbers of genes with low expression
levels [14]. Because certain hippocampal mRNAs have up
to a 23 fold difference even in the same animal or between
inbred animal strains [1,31], we analyzed the individual
microarrays across the five cases rather than the across
replicated microarrays of the pooled samples. The limited
number of cases precluded stratification according to patient
age and sex.
Because our mRNA quantity was limited, we only
could confirm four of the differentially expressed genes
by quantitative RT-PCR. Consequently, we compared
our microarray results with prior in situ hybridization
(ISH) studies of normal human autopsy hippocampus.
Table 3
Gene groups according to functional categories
a
Functional groups Expressed
genes
Enriched
genes, CA1
Enriched
genes, CA3
Biological properties 861 7 1
Cell communications 399 3 1
Signal transduction 190 1 0
Cell death
b
55 0 0
Cellular component 690 4 1
Chemokine receptors 9 2 0
Centromerre 6 1 0
Collagen 43 1 0
Cytokines 26 0 0
Cytoskeleton 209 0 1
Enzymes 1199 5 4
Mitochondria
b
63 0 0
Molecular functions 2097 10 4
Receptors 501 7 1
Glutamate
b
24 0 0
Chemokine 9 2 0
Growth factors 106 3 1
Signal transduction 482 3 0
Signal transducer 182 0 1
Transcription factors 140 2 0
a
Functional categories according to the Gene Ontology annotations
included in the GeneSpring software program. Many of the genes appear in
more than one gene ontology functional group and subgroup.
Fig. 3. Quantitative RT-PCR shows increased chemokine (C-C) receptor 5
(CCR5) and activating transcription factor 3 (ATF-3) in CA1 neurons and
increased fibroblast growth factor receptor 1 (FGFR1) and prostaglandin-
endoperoxide synthase 1 (PGES-1). Data are normalized to human h2-
microglobin housekeeping gene and expressed as average copy num-
bers F S.D.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114110
Fifteen genes were differentially expressed by ISH
[6,7,10,13,20,34,36,40,55,63,65,70].Ofthese,three
(20%) were differentially expressed by the microarray
studies.TengenesweresimilarlyexpressedbyISH
[13,16,27,29,43,45,48,50,56,69,72] and also by our mic ro-
arrays. Thus, a positive correlation between the two tech-
niques was 52%. We found no ISH studies that inversely
correlated with the microarray data. Three glutamate-kainic
acid receptor genes had conflicting ISH results [42,56] so
these are not included in the above comparison. The
following factors may underlie the disparate results with
ISH and microarrays in human autopsy tissues.
First, there are inherent biological variables in gene
expression that have been found in the same cell removed
by microdissection from the same animal [31] as well as in
brain regions by different inbred anima ls [1].Tothese
normal heterogeneities are added the inter-patient variables
associated with age, gender, pre-mortem state and post-
mortem condition [5,57]. Technical variables giving rise to
false-positive or false-negatives include low probe specific-
ity and sensitivity [33] or statistical errors during the data
analysis of large numbers of genes with relatively few
samples [44] for microarrays and non-specific probe binding
or inadequate stringency during the hybridization step for
ISH. In addition, ISH results may vary when analyzed by
different methods (optical density analysis versus investiga-
tor determination by microscopic examination). Lastly,
results from cDNA microarrays represent an average hy-
bridization of multiple targets (unknown labeled cDNA
molecules) to multiple probes (known spotted cDNA mol-
ecules). In contrast, ISH generally uses a single known
labeled probe to hybridize to one mRNA gene fragment.
The change of mismatch between labeled targets and
spotted probes are higher with cDNA microarrays due to
the possible presence of slice variants for a particular gene
of interest.
Our results suggest that gene expression in normal
human CA1 and CA3 neuron is similar since less than 1%
of coding genes (after normalization and t-testing) were
differentially expressed, a lower percent difference from that
found in two prior rodent studies. Zhao et al. [75] found a
2.4% difference in CA1 vs. CA3 subregions, with a cut off
fold expression of 1.5 folds and using Affymetrix murine
subA and subB array sets containing 11,000 genes and
ESTS prior to normalization and t-testing. Bonaventure et
al. [8] found a 5% difference in CA1 vs. CA3 pyramidal cell
layer, using in-house printed cDNA microarrays containing
2145 coding genes after normalization and t-testing, using
an expression fold cut off of 1.5. These authors extracted
RNA from the entire pyramidal cell layer, removed with the
same LCM as emp loyed in the pr esent human stu dy.
Methodological and statistical differences may underlie the
higher percent difference in CA1 vs. CA3 gene expression
in rodent brain when compared to our human studies. There
is unavoidable RNA degradation in autopsy material that
may have reduced the number of statistically significant
genes that were differentially expressed. Second, differences
in statistical analyses may alter the number of differentially
expressed genes from 1% and 6% using the same data set
and different statistical methods [51]. Third, the source of
the mRNA differed among these three studies; we used
microdissected neurons, whereas the rodent studies used
whole tissue [75] or the entire pyramidal cell layer [8].
Lastly, technological differences between s potted cDN A
arrays and Affymetrix oligonucleotide arrays may alter the
calculation of fold differences in gene expression, as dis-
cussed by Kothapalli et al. [33].
The differential gene profi le for CA1 vs. CA3 neurons
is unlikely to be due to agonal ischemia or post-mortem
autolysis (warm ischemia). None of the gene alterations
commonly associated with either of these events, or their
related models, were enriched in the present study
[12,15,30,32,73,74]. Such genes include immediate/early
transcription factors, heat shock proteins, cytokines, adhe-
sion molecules, and cell-death associated genes. While it is
likely that warm ischemia did induce gene changes, it is
probable that this insult affected both neuronal groups
equally. A1 enrichment of the TA for c-fos, and of neuronal
injury-associated genes activating transcript factor 3 and
clusterin [9,49,67] may represent intrinsic differences rather
than selective injury since differential expression of other
early response genes was absent.
Our data suggests that selective vulnerability and selec-
tive resistance in hippocampal subregions are unrelated to
intrinsic differences in the expression of those genes asso-
ciated with cell death, apoptotic regulation, cell growth and
cell maintenance. Similarly, selective vulnerability or resis-
tance are unrelated to intrinsic differences in neuronal
receptor genes, including 24 expressed glutamate receptors,
including two NMDA receptors, a finding that correlates
with most of the prior ISH studies [20,34,42,55,63]. Gluta-
mate receptors 6 and 7 and kainic acid receptor 2 gene
expression were increased in normal CA3 in one ISH study
[56] but similarly expressed in a second ISH study [42] and
in our microarray study. In addition, gene expression was
similar for 23 calcium channel genes and nine transporter
genes. We did find differential gene expression for certain
growth factor receptor genes (three in CA1 and one in
CA3); these may participate in selective resistance if there
are changes in extracellular levels of their respec tive growth
factors.
We can speculate on the biological significance of
several of the differentially expressed genes. The increased
gene expression of fibroblast growth factor receptor on the
CA3 neurons, confirmed by our quantitative RT-PCR anal-
ysis and by Takami et al.’s [65] ISH study, may underlie the
selective resistance of this neuronal group. Fibroblast
growth factor (FGF) is a well-known neuroprotective agent
[17]; thus, increased FGF receptors on CA3 neurons may
render them more responsive to this growth factor in disease
states. The elevated expression levels of CA1 trans cription
factors gene expression, including ATF-3, the TA of the c-
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114 111
fos promoter, and several downstream transcription factors
of cAMP, may be related to the importance of this neuronal
population in long-term potentiation [3].
Acknowledgements
The auth ors gratefully acknowledge the insightfu l
critiques and revie w by Carlos Moraes, PhD; technical help
by Ms Brenda Roberts; technical support from Alexi Zubiria
from Silicon Genetics, GeneSpring software and the
secretarial assistance of Ms Gloria Diaz. Grant support:
This work was supported by the National Institutes of
Health (RO1 NS39177, NS39177-S1 and NS39177-S2).
References
[1] J. Alfonso, G.D. Pollevick, A. Cestensson, E. Jazin, A. Frasch, Anal-
ysis of gene expression in the rat hippocampus using real time PCR
reveals high inter-individual variation in mRNA levels, J. Neurosci.
Res. 67 (2002) 225 234.
[2] D.G. Am aral, R. Insausti, Hippocampal formation, in: G Paxino s
(Ed.), The Human Nervous System, Academic Press, San Diego,
CA, 1990, pp. 711 755.
[3] C.H. Bailey, D. Bartsch, E.R. Kandel, Toward a molecular definition
of long-term memory storage, Proc. Natl. Acad. Sci. U. S. A. 93
(1996) 13445 13452.
[4] C.D. Balaban, J.P. O’Callaghan, M.L . Billingsley, Trimethltin-in-
duced neuronal damage in the rat brain: comparative studies using
silver degeneration stains, immunocytochemistry and immunoassay
for neuronotypic and gliotypic protei ns, Neuroscience 26 (1988)
337 361.
[5] A.J. Barton, R.C. Pearson, A. Najlerahim, P.J. Harrison, Pre and post-
mortem influences on brain RNA, J. Neurochem. 61 (1993) 1 11.
[6] L. Baum, L. Chen, E. Masliah, Y.S. Chan, H.K. Ng, C.P. Pang,
Lipoprotein lipase mutations and Alzheimers disease, Am. J. Med.
Genet. 88 (1999) 136 139.
[7] A. Billinton, V.H. Baird, M. Thom, J.S. Duncan, N. Upton, N.G.
Bowery, GABAB(1) mRNA expression in hippocampal sclerosis as-
sociated with human temporal lobe epilepsy, Mol. Brain Res. 86
(2001) 84 89.
[8] P. Bonaventure, H. Guo, B. Tian, L. Xuejun, A. Bittner, B. Roland,
R. Salunga, X.J. Ma, F. Kamme, B. Meurers, M. Bakker, M. Jurzak,
J.E. Leysen, M.G. Erlander, Nuclei and subnuclei gene expression
profiling in mammalian brain, Brain Res. 943 (2002) 38 47.
[9] A.S. Bonnard, P. Chan, M. Fontaine, Expression of clusterin and C4
mRNA during rat peripheral nerve regeneration, Immunopharmacol-
ogy 38 (1997) 81 86.
[10] L. Caberlotto, K. Fuxe, Y.L. Hurd, Characterization of NPY mRNA-
expressing cells in the human brain: co-localization with Y2 but not
Y1 mRNA in the cerebral cortex, hippocampus, amygdala and stria-
tum, J. Chem. Neuroanat. 20 (2000) 327 337.
[11] M.D. Cassell, M.W. Brown, The distribution of Timm’s stain in the
nonsulphide-perfused human hippocampal formation, J. Comp. Neu-
rol. 222 (1984) 461 471.
[12] L.W. Chiang, J.M. Grenier, L. Ettwiller, L.P. Jenkins, D. Ficenec, J.
Martin, F. Jin, P.S. DiStefano, A. Wood, An orchestrated gene expres-
sion component of neuronal programmed cell death revealed by cDNA
array analysis, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 2814 2819.
[13] M. Cimino, W. Balduini, P. Marini, F. Cattabeni, J.A. Court, M.
Bianchi, M. Magnani, Expression of hexokinase mRNA in human
hippocampus, Mol. Brain Res. 53 (1998) 297 300.
[14] C. Colantuoni, A.E. Purcell, C.M.L. Bouton, J. Pevsner, High
throughput analysis of gene expression in human brain, J. Neurosci.
Res. 59 (2000) 1 10.
[15] A. Dash, I.P. Maine, S. Varambally, R. Shen, A.M. Chinnaiyan, M.A.
Rubin, Changes in differential gene expression because of warm is-
chemia time of radical prostatectomy specimens, Am. J. Pathol. 161
(2002) 1743 1748.
[16] S.L. Eastwood, P.J. Harrison, Detection and quantification of hip-
pocampal synatophysin messenger RNA in schizophrenia using
autoclaved, formalin-fixed, paraffin wax-embedded sections, Neuro-
science 93 (1999) 99 106.
[17] F.P. Eckenstein, Fibroblast growth factors in the nervous system, J.
Neurobiol. 25 (1994) 1467 1480.
[18] M.R. Emmert-Buck, R.F. Bonner, P.D. Smith, R.F. Chuaqui, Z.
Zhuang, S.E. Goldstein, R.A. Weiss, L.A. Liotta, Laser capture mi-
crodissection, Science 274 (1996) 998 1001.
[19] L.A. Galea, B.S. McEwen, P. Tanapat, T. Deak, R.L. Spencer, F.S.
Dhabhar, Sex differences in dendritic atrophy of CA3 pyramidal neu-
rons in response to chronic restraint stress, Neuroscience 81 (1997)
689 697.
[20] X.M. Gao, K. Sakai, R.C. Roberts, R.R. Conley, B. Dean, C.A.
Tamminga, Ionotropic glutamate receptors and expression of N-
methyl-
D-aspartate receptor subunits in subregions of human hippo-
campus: effects of schizophrenia, Am. J. Psychiatry 157 (2000)
1141 1149.
[21] S.R. Goldstein, P.G. McQueen, R.F. Bonner, Thermal modeling of
laser capture microdissection, Appl. Opt. 37 (1998) 7378 7391.
[22] S.M. Goldsworthy, P.S. Stockton, C.S. Trempus, J.F. Foley, R.R.
Maronpot, Effects of fixation on RNA extraction and amplification
from laser capture microdissected tissue, Mol. Carcinog. 25 (1999)
86 91.
[23] L.I. Gomes, R.L.A. Silva, B.S. Stolf, E.B. Cristo, R. Hirata Jr., F.A.
Soares, L.F.L. Reis, E.J. Neves, A.F. Carvalho, Comparative analysis
of amplified and nonamplified RNA for hybridization in cDNA
microarray, Ann. Biochem. 321 (2003) 244 251.
[24] A.A. Grishin, C.E. Gee, U. Gerber, P. Benquet, Differential calcium-
dependent modulation of NMDA currents in CA1 and CA3 hippo-
campal pyramidal cells, J. Neurosci. 24 (2004) 350 355.
[25] P.J. Harrison, S.L. Eastwood, Neuropathological studies of synaptic
connectivity in the hippocampal formation in schizophrenia, Hippo-
campus 11 (2001) 508 519.
[26] J. Hesselgesser, D. Taub, P. Baskar, M. Greenberg, J. Hoxie, D.L.
Kolson, R. Horuk, Neuronal apoptosis induced by HIV-1 gp120 and
the chemokine SDF-1 alpha is mediated by the chemokine receptor
CXCR4, Curr. Biol. 8 (1998) 595 598.
[27] Y.L. Hurd, E. Keller, P. Sotonyi, G. Sedvall, Preprotachykinin-A
mRNA expression in the human and monkey brain: an in situ hybrid-
ization study, J. Comp. Neurol. 411 (1999) 56 72.
[28] U. Ito, M. Spatz, J.T. Walker, I. Klatzo, Experimental cerebral ische-
mia in Mongolian gerbils: I. lig ht microscopic ob servations, Acta
Neuropathol. 32 (1975) 209 223.
[29] D. Jacques, Y. Tong, S.H. Shen, R. Quirion, Discrete distribution of
the neuropeptide Y Y5 receptor gene in the human brain: an in situ
hybridization study, Mol. Brain Res. 61 (1998) 100 107.
[30] K. Jin, X.O. Mao, M.W. Eshoo, T. Nagayama, M. Minami, R.P.
Simon, D.A. Greenberg, Microarray analysis of hippocampal gene
expression in global cerebral ischemia, Ann. Neurol. 50 (2001)
93 103.
[31] F. Kamme, R. Salunga, J. Yu, D.T. Tran, J. Zhu, L. Luo, A. Bittner,
H.Q. Guo, N. Miller, J. Wan, M. Erlander, Single-cell microarray
analysis in hippocampus CA1: demonstration and validation of cel-
lular heterogeneity, J. Neurosci. 23 (2003) 3607 3615.
[32] J. Koistinaho, T. Hokfelt, Altered gene expression in brain ischemia,
NeuroReport 8 (2) (1997) i viii.
[33] R. Kothapalli, S.J. Yoder, M. Shrika nt, T.P. Loughan, Microarray
results: how accurate are they? BMC Bioinformati cs 3 (2002)
22 32.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114112
[34] A.A. Lie, A. Becker, K. Behle, H. Beck, B. Malitschek, P.J. Conn, R.
Kuhn, R. Nitsch, M. Plaschke, J. Schramm, C.E. Elger, O.D. Wiestler,
I. Blumcke, Up-regulation of the metabotropic glutamate receptor
mGluR4 in hippocampal neurons with reduced seizure vulnerability,
Ann. Neurol. 47 (2000) 26 35.
[35] C. Lim, H.W. Blume, J.R. Madsen, C.B. Saper, Connections of the
hippocampal formation in humans: I. the mossy fiber pathway, J.
Comp. Neurol. 385 (1997) 251 325.
[36] J.F. Lopez, D.T. Chalmers, K.Y. Little, S.J. Watson, Regulation of
serotonin1A, glucocorticoid and mineralcorticoid receptor in rat and
human hippocampus: implications for the neurobiology of depression,
Biol. Psychiatry 43 (1998) 547 573.
[37] R. Lorente de No, Studies on the structure of the cerebral cortex: II.
Continuation of the study of the ammonic system, J. Psychol. Neurol.
46 (1934) 113 117.
[38] L. Luo, R.C. Salunga, H. Guo, A. Bittner, K.C. Joy, J.E. Galindo, H.
Xiao, K.E. Rogers, J.S. Wan, M.R. Jackson, M.G. Erlander, Gene
expression profiles of laser-captured adjacent neuronal subtypes,
Nat. Med. 5 (1999) 117 122.
[39] V. Luzzi, M. Mahadevappa, R. Raja, J.A. Warrington, M.A. Wat-
son, Accurate and reproducible gene expression profiles from laser
capture microdissection, transcript amplification and high density
oligonucleotide microarray analysis, J. Mol. Diagnostics 5 (2003)
9 14.
[40] M. Maki, N. Matsukawa, H. Yuasa, Y. Otsuka, T. Yamamoto, H.
Akatsu, T. Okamoto, R. Ueda, K. Ojika, Decreased expression of
hippocampal cholinergic neurostimulating peptide precursor protein
mRNA in the hippocampus in Alzheimer Disease, J. Neuropathol.
Exp. Neurol. 61 (2002) 176 185.
[41] G.W. Mathern, P.A. Kuhlman, D. Mendoza, J.K. Pretorius, Human
fascia dentata anatomy and hippocampal neur on densities differ
depending on the epileptic syndrome and age at first seizure, J. Neu-
ropathol. Exp. Neurol. 56 (1997) 199 212.
[42] G.W. Mathern, J.K. Pretorius, H.I. Kornblum, D. Mendoza, A. Loz-
ada, J.P. Leite, L. Chimelli, D.E. Born, I. Fried, A.C. Sakamoto, J.A.
Assirati, W.J. Peacock, G.A. Ojemann, P.D. Adelson, Altered hippo-
campal kainate-receptor mRNA levels in temporal lobe epilepsy
patients, Neurobiol. Dis. 5 (1998) 151 176.
[43] P. Meoni, B.H. Bunnemann, D.G. Trist, N.G. Bowery, N-terminal
splice variants of the NMDAR1 glutamate receptor subunit: differen-
tial expression in human and monkey brain, Neurosci. Lett. 249
(1998) 45 48.
[44] R.A. Miller, A. Galecki, R.J. Shmookler-Reis, Interpretation, design
and analysis of gene array expression experiments, J. Gerontal., Ser.
A, Biol. Sci. Med. Sci. 56 (2001) B52 B57.
[45] K.D. Murray, P.J. Isackson, T.A. Eskin, M.A. King, S.P. Montesinos,
L.A. Abraham, S.N. Roper, Altered mRNA expression for brain-de-
rived neurotrophic factor and type II calcium/calmodulin-dependent
protein kinase in the hippocampus of patients with intractable tempo-
ral lobe epilepsy, J. Comp. Neurol. 418 (2000) 411 422.
[46] J.V. Nadler, B. Perry, C. Gentry, C.W. Cotman, Degeneration of hip-
poca mpal CA3 pyramidal cells indu ced by intraventricular kainic
acid, J. Comp. Neurol. 192 (1980) 333 359.
[47] M.K. O’Banion, P.D. Coleman, L.M. Callahan, Regional neuronal
loss in aging and Alzheimers disease: a brief review, Semin. Neuro-
sci. 6 (1994) 307 314.
[48] T. Ohnuma, H. Kato, H. Arai, R.L.M. Faull, P.J. McKenna, P.C.
Emson, Gene expression of PSD95 in prefrontal cortex and hippo-
campus in schizophrenia, NeuroReport 11 (2000) 3133 3137.
[49] G.M. Pasinetti, S.A. Johnson, T. Oda, I. Rozovsky, C.E. Finch, Clus-
terin (SGP-2): a multifunctional glycoprotein with regional expression
in astrocytes and neurons of the adult rat brain, J. Comp. Neurol. 339
(1994) 387 400.
[50] M. Pasqualetti, M. Ori, M. Castagna, D. Marazziti, G.B. Cassano, I.
Nardi, Distribution and cellular localization of the serotonin type 2C
receptor messenger RNA in human brain, Neuroscience 92 (1999)
601 611.
[51] P. Pavlidis, W.S. Noble, Analysis of strain and regional variation in
gene expression in mouse brain, Gen. Biol. 2 (2001) 0042.1 042.15.
[52] C.W. Perrett, R.M. Marchbanks, S.A. Whatley, Characterization of
messenger RNA extracted post-mortem from the brains of schizo-
phrenic, depressed and control subjects, J. Neurol. Neurosurg. Psy-
chiatry 51 (1988) 325 331.
[53] C.K. Petito, E. Feldmann, W.A. Pulsinelli, F. Plum, Delayed hippo-
campal damage in humans following cardiorespiratory arrest, Neurol-
ogy 37 (1987) 1281 1286.
[54] C.K. Petito, B. Roberts, J.D. Cantando, A. Rabinstein, R. Duncan,
Hippocampal injury and alterations in neuronal chemokine co-recep-
tor expression in patients with AIDS, J. Neuropathol. Exp. Neurol. 60
(2001) 377 385.
[55] S. Pirker, C. Schwarzer, T. Czech, C. Baumgartner, H. Pockberger, H.
Maier, B. Hauer, W. Sieghart, S. Furtinger, G. Sperk, Increased ex-
pression of GABAA receptor ß-subunits in the hippocampus of
patients with temporal lobe epilepsy, J. Neuropathol. Exp. Neurol.
62 (2003) 820 834.
[56] R.H.P. Porter, S.L. Eastwood, P.J. Harrison, Distribution of kainate
receptor subunit mRNAs in human hippocampus, neocortex and cer-
ebellum, and bilateral reduction of hippocampal GluR 6 and KA2
transcripts in schizophrenia, Brain Res. 751 (1997) 217 231.
[57] P. Preece, N.J. Cairns, Quantifying mRNA in po stmor tem human
brain: influence of gender, age at death, postmortem interval, brain
pH, agonal state and inter-lobe mRNA variance, Mol. Brain Res. 118
(2003) 60 71.
[58] W.A. Pulsinelli, J.B. Brierley, F. Plum, Temporal profile of neuronal
damage in a model of transient forebrain ischemia, Ann. Neurol. 11
(1982) 491 498.
[59] B.M. Ross, J.T. Knowler, J. McCulloch, On the stability of messen-
ger RNA and ribosomal RNA in the brains of control human sub-
jects and patients with Alzheimer ’s disease, J. Neurochem. 58
(1992) 1810 1819.
[60] M.A. Rubin, Understanding disease cell by cell, Science 296 (2002)
1329 1330.
[61] R.C. Salunga, H. Guo, L. Luo, A. Bittner, K.C. Joy, J. Chambers, J.
Wan, M.R. Jackson, M.G. Erlander, Gene expres sion analysis via
cDNA microarrays of laser capture microdissected cells from fixed
tissue, in: M. Schena (Ed.), DNA Microarrays: A Practical Approach,
Oxford Univ. Press, Oxford, 1999.
[62] R.L. Sapolsky, L.C. Krey, B.S. McEwen, Prolonged glucocorticoid
exposure reduces hippocampal neuron number: implications for ag-
ing, J. Neurosci. 5 (1985) 1222 1227.
[63] C.R. Scherzer, G.B. Landwehrmeyer, J.A. Kerner, T.J. Counihan,
C.M. Kosinski, D.G. Standaert, L.P. Daggett, G. Velicelebi, J.B.
Penney, A.B. Young, Expression of N-Methyl-
D-Aspartate receptor
subunit mRNAs in the human brain: hippocampus and cortex, J.
Comp. Neurol. 390 (1998) 75 90.
[64] W.B. Scoville, B. Milner, Loss of recent memory after bilateral
hippocampal lesions, J. Neurol. Neurosurg. Psychiatry 20 (1957)
11 21.
[65] K. Takami, A. Matsuo, K. Terai, D.G. Walker, E.G. McGreer, P.L.
McGreer, Fibroblast growth factor receptor-1 expression in the cor-
tex and hippocampus in Alzheimers disease, Brain Res. 802 (1998)
89 97.
[66] J.E. Torres-Mun
˜
oz, P. Shapshak, B. Roberts, M.G. Keegan, A. Rose-
ndahl, R. Bookman, C.K. Petito, Differential gene expression in hu-
man CA1 vs CA3 hippoca mpal neurons, Neuroscience, (2002)
903.10.
[67] H. Tsujino, E. Kondo, T. Fukuoka, Y. Dai, A. Tokunaga, K. Miki, K.
Yonenobu, T. Ochi, K. Noguchi, Activating transcription factor 3
(ATF3) induction by axtomy in sensory and motor neurons: a novel
neuronal marker of nerve injury, Mol. Cell. Neurosci. 15 (2000)
170 182.
[68] V. VanDeerlin, L.H. Gill, P.T. Nelson, Optimizing gene expression
analysis in archival brain tissue, Neurochem. Res. 27 (2002)
993 1003.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114 113
[69] M.J. Webster, C.S. Weickert, M.M. Herman, T.M. Hyde, J.E. Klein-
man, Synaptophysin and GAP-43 mRNA levels in the hippocampus
of subjects with schizophrenia, Schizophr. Res. 49 (2001) 89 98.
[70] W.R. Whitaker, R.L. Faull, M. Dragunow, E.W. Mee, P.C. Emson, J.J.
Clare, Changes in the m RNAs encoding voltage-gated sodium chan-
nel types II and III in human epileptic hippocampus, Neuroscience
106 (2001) 275 285.
[71] K. Yasojima, E.G. McGeer, P.L. McGeer, High stability of mRNAs
postmor tem and protocols for their assessment by RT-PCR, Brain
Res. Protoc. 8 (2001) 212 218.
[72] A.V. Yermakova, J. Rollins, L.M. Callahan, J. Rogers, M.K. O’Bann-
ion, Cyclooxygenase-1 in human Alzheimer and control brain: quan-
titative analysis of expression by microglia and CA3 hippocampal
neurons, J. Neuropathol. Exp. Neurol. 11 (1999) 1135 1146.
[73] N. Yokota, M. Uchijima, S. Nishizawa, H. Namba, Y. Koide,
Identification of differentially expressed genes in rat hippocampus
after transient global cer ebral ischemia using subtractive cDNA
cloning based on polymerase chain reaction, Stroke 32 (2001)
168 174.
[74] S. Zagulsky-Szymczak, R.K. Filipkowski, L. Kaczmarek, Kainate-
induced genes in the hippocampus: lessons from expression patterns,
Neurochem. Int. 38 (2001) 485 501.
[75] X. Zhao, E.S. Lein, A. He, S.C. Smith, C. Aston, F.H. Gage, Tran-
scriptional profiling reveals strict boundaries between hippocampal
subregions, J. Comp. Neurol. 441 (2001) 187 196.
[76] S. Zola-Morgan, L.R. Squire, D.G. Amaral, Human amnesia and the
medial temporal region: enduring memory impairment following a
bilateral lesion limited to field CA1 of the hippocampus, J. Neurosci.
6 (1986) 2950 2967.
J.E. Torres-Mun
˜
oz et al. / Molecular Brain Research 127 (2004) 105–114114
    • "Likewise, when we compare our disease results to a previous study of CA1 in AD run using a similar design [3], we find high agreement, in particular when including only highly expressed and significantly differentially expressed genes (Figure 1d;Figure S4 in Additional file 6). We next extended these analyses to all genes, including those with much more marginal differential expression , in a total of six studies: three assessing changes with AD progression in CA1 (Figure 1e) [3,4,20] and three finding CA1-and CA3-enriched genes in control hippocampus (Figure 1f)293031. We ranked all of our genes from the most CA1-enriched to the most CA3- enriched (or the ones most decreasing with AD to the ones most increasing), and then compared lists of differentially expressed genes from previous studies to our ranked lists (Materials and methods). "
    [Show abstract] [Hide abstract] ABSTRACT: Background Transcriptional studies suggest Alzheimer's disease (AD) involves dysfunction of many cellular pathways, including synaptic transmission, cytoskeletal dynamics, energetics, and apoptosis. Despite known progression of AD pathologies, it is unclear how such striking regional vulnerability occurs, or which genes play causative roles in disease progression. Methods To address these issues, we performed a large-scale transcriptional analysis in the CA1 and relatively less vulnerable CA3 brain regions of individuals with advanced AD and nondemented controls. In our study, we assessed differential gene expression across region and disease status, compared our results to previous studies of similar design, and performed an unbiased co-expression analysis using weighted gene co-expression network analysis (WGCNA). Several disease genes were identified and validated using qRT-PCR. Results We find disease signatures consistent with several previous microarray studies, then extend these results to show a relationship between disease status and brain region. Specifically, genes showing decreased expression with AD progression tend to show enrichment in CA3 (and vice versa), suggesting transcription levels may reflect a region's vulnerability to disease. Additionally, we find several candidate vulnerability (ABCA1, MT1H, PDK4, RHOBTB3) and protection (FAM13A1, LINGO2, UNC13C) genes based on expression patterns. Finally, we use a systems-biology approach based on WGCNA to uncover disease-relevant expression patterns for major cell types, including pathways consistent with a key role for early microglial activation in AD. Conclusions These results paint a picture of AD as a multifaceted disease involving slight transcriptional changes in many genes between regions, coupled with a systemic immune response, gliosis, and neurodegeneration. Despite this complexity, we find that a consistent picture of gene expression in AD is emerging.
    Full-text · Article · May 2013
    • "The physiological significance of this effect is unclear. In the adult hippocampus, CCR5 expression is mainly localized in neurons of the CA1 region and dentate gyrus (Torres-Munoz et al., 2004; Westmoreland et al., 2002) and within neural progenitor cells (Tran et al., 2007). Multipotential neural progenitor cells are still present in the adult hippocampus and are capable of giving rise to functional neurons and glial cells (Lledo et al., 2006). "
    Full-text · Dataset · Apr 2013 · Neurobiology of aging
    • "Most of the techniques developed to date require large amounts of input DNA, and wholetissue homogenates are mainly used for that purpose. However, cell-type-and subregion-specific changes, and neuronal loss occur in AD, which might alter the neurons/glia ratio when comparing AD brains to controls (Blalock et al., 2011; Ginsberg et al., 2012; Liang et al., 2008; Morrison and Hof, 2002; Torres-Munoz et al., 2004). Thus, novel epigenetic approaches using cell-sorting or lasercapture microdissected tissues and requiring less input material should be further developed. "
    [Show abstract] [Hide abstract] ABSTRACT: Epigenetic dysregulation of gene expression is thought to be critically involved in the pathophysiology of Alzheimer's disease (AD). Recent studies indicate that DNA methylation and DNA hydroxymethylation are 2 important epigenetic mechanisms that regulate gene expression in the aging brain. However, very little is known about the levels of markers of DNA methylation and hydroxymethylation in the brains of patients with AD, the cell-type specificity of putative AD-related alterations in these markers, as well as the link between epigenetic alterations and the gross pathology of AD. The present quantitative immunohistochemical study investigated the levels of the 2 most important markers of DNA methylation and hydroxymethylation, that is, 5-methylcytidine (5-mC) and 5-hydroxymethylcytidine (5-hmC), in the hippocampus of AD patients (n = 10) and compared these to non-demented, age-matched controls (n = 10). In addition, the levels of 5-hmC in the hippocampus of a pair of monozygotic twins discordant for AD were assessed. The levels of 5-mC and 5-hmC were furthermore analyzed in a cell-type and hippocampal subregion-specific manner, and were correlated with amyloid plaque load and neurofibrillary tangle load. The results showed robust decreases in the hippocampal levels of 5-mC and 5-hmC in AD patients (19.6% and 20.2%, respectively). Similar results were obtained for the twin with AD when compared to the non-demented co-twin. Moreover, levels of 5-mC as well as the levels of 5-hmC showed a significant negative correlation with amyloid plaque load in the hippocampus (rp = -0.539, p = 0.021 for 5-mC and rp = -0.558, p = 0.016 for 5-hmC). These human postmortem results thus strengthen the notion that AD is associated with alterations in DNA methylation and hydroxymethylation, and provide a basis for further epigenetic studies identifying the exact genetic loci with aberrant epigenetic signatures.
    Full-text · Article · Apr 2013
Show more