Download full-text PDF

Increased Expression of the Drosophila Vesicular Glutamate Transporter Leads to Excess Glutamate Release and a Compensatory Decrease in Quantal Content

Article (PDF Available) inThe Journal of Neuroscience : The Official Journal of the Society for Neuroscience 24(46):10466-74 · December 2004with62 Reads
DOI: 10.1523/JNEUROSCI.3001-04.2004 · Source: PubMed
Abstract
Quantal size is a fundamental parameter controlling the strength of synaptic transmission. The transmitter content of synaptic vesicles is one mechanism that can affect the physiological response to the release of a single vesicle. At glutamatergic synapses, vesicular glutamate transporters (VGLUTs) are responsible for filling synaptic vesicles with glutamate. To investigate how VGLUT expression can regulate synaptic strength in vivo, we have identified the Drosophila vesicular glutamate transporter, which we name DVGLUT. DVGLUT mRNA is expressed in glutamatergic motoneurons and a large number of interneurons in the Drosophila CNS. DVGLUT protein resides on synaptic vesicles and localizes to the presynaptic terminals of all known glutamatergic neuromuscular junctions as well as to synapses throughout the CNS neuropil. Increasing the expression of DVGLUT in motoneurons leads to an increase in quantal size that is accompanied by an increase in synaptic vesicle volume. At synapses confronted with increased glutamate release from each vesicle, there is a compensatory decrease in the number of synaptic vesicles released that maintains normal levels of synaptic excitation. These results demonstrate that (1) expression of DVGLUT determines the size and glutamate content of synaptic vesicles and (2) homeostatic mechanisms exist to attenuate the excitatory effects of excess glutamate release.
Cellular/Molecular
Increased Expression of the Drosophila Vesicular Glutamate
Transporter Leads to Excess Glutamate Release and a
Compensatory Decrease in Quantal Content
Richard W. Daniels,
1
* Catherine A. Collins,
1
* Maria V. Gelfand,
1
Jaime Dant,
1
Elizabeth S. Brooks,
2
David E. Krantz,
2
and Aaron DiAntonio
1
1
Department of Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, Missouri 63110, and
2
Department of
Psychiatry and Biobehavioral Sciences, The David Geffen School of Medicine at University of California Los Angeles, Los Angeles, California 90095
Quantal size is a fundamental parameter controlling the strength of synaptic transmission. The transmitter content of synaptic vesicles is
one mechanism that can affect the physiological responsetothe release of a single vesicle. At glutamatergic synapses, vesicular glutamate
transporters (VGLUTs) are responsible for filling synaptic vesicles with glutamate. To investigate how VGLUT expression can regulate
synaptic strength in vivo, we have identified the Drosophila vesicular glutamate transporter, which we name DVGLUT. DVGLUT mRNA
is expressed in glutamatergic motoneurons and a large number of interneurons in the Drosophila CNS. DVGLUT protein resides on
synaptic vesicles and localizes to the presynaptic terminals of all known glutamatergic neuromuscular junctions as well as to synapses
throughout the CNS neuropil. Increasing the expression of DVGLUT in motoneurons leads to an increase in quantal size that is accom-
panied by an increase in synaptic vesicle volume. At synapses confronted with increased glutamate release from each vesicle, there is a
compensatory decrease in the number of synaptic vesicles released that maintains normal levels of synaptic excitation. These results
demonstrate that (1) expression of DVGLUT determines the size and glutamate content of synaptic vesicles and (2) homeostatic mech-
anisms exist to attenuate the excitatory effects of excess glutamate release.
Key words: synaptic vesicle; quantal size; vesicular glutamate transporter; Drosophila; glutamate; synaptic transmission
Introduction
Synaptic strength is determined both by quantal content (QC),
the number of synaptic vesicles (SVs) released by the presynaptic
terminal, and by quantal size, the postsynaptic response to the
transmitter released from each vesicle. The regulation of postsyn-
aptic receptor activity is the best-studied mechanism for control-
ling quantal size (Malinow and Malenka, 2002); however, the
time course and concentration of transmitter in the synaptic cleft
also affect the postsynaptic response (Choi et al., 2000; Renger et
al., 2001; Liu, 2003; Pawlu et al., 2004). Therefore, the transmitter
content of synaptic vesicles represents another potential determi-
nant of quantal size. Because vesicular neurotransmitter trans-
porters load vesicles with transmitter, their expression and activ-
ity may determine the transmitter content of synaptic vesicles.
Three families of vesicular neurotransmitter transporters have
been identified: the vesicular transporters for monoamines
(VMATs) and acetylcholine (VAChT) (Erickson et al., 1992,
1994; Liu et al., 1992; Roghani et al., 1994), the vesicular trans-
porter for GABA and glycine (VGAT or VIAAT) (McIntire et al.,
1997), and the three recently isolated vesicular glutamate trans-
porters (VGLUTs 1–3) (Bellocchio et al., 2000; Takamori et al.,
2000; Fremeau et al., 2002). Expression of these transporters can
regulate the transmitter content of vesicles and quantal size; over-
expression of VMAT (Colliver et al., 2000; Pothos et al., 2000),
VAChT (Song et al., 1997), and VGLUT1 (Wojcik et al., 2004) in
various cultured cells increases quantal size. For monoamines,
this increase in quantal size is accompanied by an increase in
vesicular volume (Colliver et al., 2000; Gong et al., 2003). The
relationship among transporter expression, transmitter content,
and vesicle size has not been investigated for classical fast trans-
mitters such as glutamate.
VGLUTs load synaptic vesicles with glutamate. The deletion
of VGLUT1 in the mouse leads to a dramatic impairment of
glutamatergic transmission (Fremeau et al., 2004; Wojcik et al.,
2004). Conversely, overexpression of VGLUT1 in cultured gluta-
matergic neurons increases quantal size at autaptic synapses
(Wojcik et al., 2004); however, the functional consequences of
excess glutamate for the efficacy of an intact synapse are
unknown.
To explore how the expression of VGLUT within its normal
synaptic milieu regulates synaptic strength, we identified and
Received July 22, 2004; revised Oct. 12, 2004; accepted Oct. 12, 2004.
This work was supported by grants from the National Institute of Neurological Disorders and Stroke (NS043171),
the Keck Distinguished Young Scholars Program, and the McKnight Scholars Award (A.D.), a National Institutes of
Health training grant (GM08151) (R.W.D.), the Damon Runyon Foundation (C.A.C.), a Howard Hughes Medical
Institute summer fellowship (M.V.G.), and grants from the National Institute of Mental Health (MH01709), the
NationalInstituteofDiabetesandDigestiveand Kidney Diseases (DK60857), theNational Institute of Environmental
HealthSciences (ES-02-03), and the EdwardMallinckrodt Jr and EJLBFoundations (D.E.K.). We thank RegisKelly and
Vivian Budnik for reagents and Sylvia Johnson and Scott Portman for technical assistance.
DOI:10.1523/JNEUROSCI.3001-04.2004
*R.W.D. and C.A.C. contributed equally to this work.
Correspondence should be addressed to Dr. Aaron DiAntonio, Department of Molecular Biology and Pharmacol-
ogy, Campus Box 8103, 660 South Euclid, Washington University School of Medicine, St. Louis, MO 63110. E-mail:
diantonio@wustl.edu.
Copyright © 2004 Society for Neuroscience 0270-6474/04/2410466-09$15.00/0
10466 The Journal of Neuroscience, November 17, 2004 24(46):10466 –10474
characterized the Drosophila VGLUT homolog, DVGLUT. DV-
GLUT localizes to synaptic vesicles, is expressed in glutamatergic
motoneurons and interneurons, and is present at the synaptic
terminals of all identified glutamatergic neuromuscular junc-
tions (NMJs). Overexpression of DVGLUT in motoneurons in-
creases quantal size by shifting the entire population of miniature
excitatory junctional potentials (mEJPs) to larger amplitudes.
This physiological change is accompanied by a morphological
change: synaptic vesicles are larger. This suggests that DVGLUT
expression can regulate the total glutamate content of a vesicle
but that the concentration of glutamate stays roughly constant.
Finally, we investigated the consequences of this excess glutamate
release for the function of the intact NMJ. Despite the increased
postsynaptic response to single vesicles, the response to the
evoked release of vesicles was unchanged because of a compen-
satory downregulation of presynaptic vesicle release. Hence, ho-
meostatic mechanisms exist at the Drosophila NMJ to attenuate
the excitatory effects of excess glutamate release.
Materials and Methods
Genetics. cDNAs for CG9887 (RH57669 and RH74545) and for CG4288
(AT07766 and AT14282) were obtained from the Berkeley Drosophila
Genome Project expressed sequence tag collection. The two cDNAs for
CG9887 were sequenced to completion and are identical. Both demon-
strated that the annotated predicted protein product for CG9887 is miss-
ing a 207 bp exon that was predicted to be part of the final intron. This
added exon encodes an additional transmembrane domain that is also
present in vertebrate VGLUTs.
To generate the upstream activating sequence (UAS)–DVGLUT line,
the CG9887 cDNA was synthesized by PCR using a 5 PCR oligo GG-
GAATTCATGAAGGGTCTGACGGCGTT that introduced an EcoRI site
(underlined) and 3 oligo CGGTACCTTACTGCTGCTGGTATCCCT
that introduced a KpnI site (underlined), sequenced, cloned into the
pUAST vector (Brand and Perrimon, 1993), and transformed into em-
bryos using standard techniques.
Drosophila were cultured using standard techniques. Crosses were
kept at 25°C on standard Drosophila medium. The BG380 Gal4 line ex-
presses in motoneurons and was a kind gift of Vivian Budnik (Budnik et
al., 1996). In all experiments, control larvae (referred to as wild type)
were BG380 Gal4 virgins out-crossed to Canton-S (CS) males.
In situ hybridization. Specific antisense probes were synthesized and
hybridized to a 24 hr collection of dechorionated embryos using conven-
tional methods described previously (Tautz et al., 1989). Briefly, we tran-
scribed RNA probe from linearized, phenol– chloroform-extracted DNA
from clone AT07766 for CG4288 and clone RH57669 for CG9887.
Biochemistry. Glycerol gradient fractionations were performed as de-
scribed (van de Goor et al., 1995) with minor modifications. Approxi-
mately 100 mg of frozen fly heads were crushed over dry ice using a
mortar and pestle and then homogenized in an ice bath in 0.5 ml of 1 m
M
EGTA, 0.1 mM MgCl
2
,10mM HEPES, pH 7.4, 1 mg/ml pepstatin,
2 mg/ml leupeptin, 20 mg/ml PMSF using eight strokes of a motorized
Teflon pestle on glass (Wheaton) at 900 rpm. After debris was sedi-
mented at 1000 g for 2 min at 4°C in a Microfuge, the homogenate was
loaded onto a 5–25% v/v glycerol gradient containing (in m
M): 150 NaCl,
1 EGTA, 0.1 MgCl
2
, 10 HEPES, pH 7.4. The gradient was generated using
a BioComp Gradient Master (Fredericton, New Brunswick, Canada) fol-
lowed by the addition of a 50% sucrose cushion at the bottom of the tube
to capture rapidly sedimenting membranes. After centrifugation at 40.4
K rpm in an SW41 rotor (Beckman) for 75 min at 4°C, fractions were
recovered from the bottom of the tube using a Beckman Fraction Recov-
ery System. Samples from each fraction were probed on Western blots
using primary antibodies to DVGLUT (1:10,000) and Drosophila synap-
tobrevin (1:2000), generously provided by Regis Kelly (University of
California San Francisco, San Francisco, CA), and late bloomer (lbm)
(1:100) (Kopczynski et al., 1996) followed by the appropriate HRP-
conjugated secondary antibody (Amersham Biosciences, Arlington
Heights, IL) and a chemiluminescent substrate (SuperSignal West Pico,
Pierce, Rockford, IL). Digital images were quantified using NIH Image.
Electrophysiology. Electrophysiological recordings were performed as
described previously (Marrus and DiAntonio, 2004; Marrus et al., 2004).
Briefly, wandering third-instar female larvae were dissected in ice-cold
Stewart’s HL-3 solution (Stewart et al., 1994) with no added calcium.
HL-3 solution contained (in m
M): 70 NaCl, 5 KCl, 20 MgCl
2
,10
NaHCO
3
, 5 trehalose, 115 sucrose, and 5 HEPES, pH adjusted to 7.2; 1 M
CaCl
2
was added to achieve the desired Ca
2
concentration. Intracellular
recordings were made from muscle 6, segments A3 and A4, with sharp
borosilicate electrodes with resistance of 17–20 M when filled with 3
M
KCl. Signals were acquired using an AxoClamp-2B amplifier (Axon In-
struments, Foster City, CA) in bridge mode and then filtered at 1 kHz and
amplified using a Model 410 amplifier (Brownlee Precision, San Jose,
CA). Data were digitized using a Digidata 1320A board and stored on a
computer using pClamp 9.0 software. Cells were selected for data analysis
if input resistance was 5M and membrane potential was less than
60 mV. All recordings were made at room temperature.
Spontaneous mEJPs were recorded in nominally Ca
2
-free HL-3 so
-
lution with 1
M TTX added to prevent action potentials. The largest
mEJP recorded from the DVGLUT-overexpressing larvae was 32 mV.
After recording from each cell, the nerve was stimulated 10 times to
ensure that no events could be evoked. At least 60 consecutive events
were measured per cell using MiniAnal (Synaptosoft, Decatur, GA) and
averaged to determine the mean mEJP. Events with a slow rise time course
were rejected as artifacts from neighboring electrically coupled muscle cells.
There is no statistically significant difference in the resting potential from
wild-type and DVGLUT-overexpressing larvae (BG380 Gal4/ V
m
68.1 1.4 mV; BG380 Gal4/; UAS–DVGLUT
1
/ V
m
69.5 2.2 mV;
BG380 Gal4/; UAS–DVGLUT
2
/ V
m
69.5 2.2 mV). Failure analysis
was performed in HL-3 solution containing 0.23 m
M CaCl
2
, a level at which
approximately half of the stimulations elicited responses in the muscle in
larvae overexpressing DVGLUT. Failures were counted by hand in both
genotypes because of large fluctuations in the baseline voltage caused by large
electrically coupled events in neighboring muscles in overexpressing larvae.
Statistical analysis was performed and graphs were generated in Origin 7.0
(Origin Lab, Northampton, MA).
Antibody staining. Wandering third-instar larvae were dissected in ice-
cold PBS and fixed in Bouin’s fixative (1:5:15 ratio of acetic acid/forma-
lin/picric acid) for 5 min. For anti-cysteine string protein (CSP) staining,
larvae were fixed for 45 min in Bouin’s fixative. Larvae were then washed in
PBS containing 0.1% Triton-X (PBX) and blocked for 1 hr at room temper-
ature in 5% normal goat serum in PBX. Primary antibody was diluted in PBS
and incubated overnight at 4°C or at room temperature for 1 hr. Secondary
antibodies were used at 1:2000 for 1 hr at room temperature. After staining,
larvae were equilibrated in 70% glycerol in PBS and mounted with VectaSh-
ield (Vector Laboratories, Burlingame, CA).
Antibodies. The rabbit anti-DVGLUT antibody was raised against a
C-terminal peptide (–CQMPSYDPQGYQQQ) by Zymed Laboratories
(San Francisco, CA) and purified on an affinity column. Purified anti-
body was used at 1:10,000 –1:25,000. This antisera recognizes a single
band of approximately the expected size for CG9887 on an immunoblot
and detects the transgenic overexpression of CG9887. Mouse anti-CSP
(ab49) was kindly provided by Konrad Zinsmaier (University of Arizona,
Tucson, AZ) and used at 1:50. Cy3-conjugated goat anti-HRP (Jackson
ImmunoResearch, West Grove, PA) was used at 1:1000. Differences in
synaptic DVGLUT level were assessed using an Alexa-488-coupled DV-
GLUT antibody at 1:1000.
Comparison of protein levels. Larvae of different genotypes were dis-
sected and stained together to ensure uniform processing. Confocal mi-
crographs were taken with a Nikon C1 confocal microscope of the syn-
apse on muscle 4 of segments A3 and A4 using a 60 oil objective
(numerical aperture 1.40) with a pixel size of 200 nm. Gain was set to
just below saturation on the sample with the highest staining intensity.
Complete Z-stacks through the synapse were flattened into a maximum
projection and saved for analysis. Analysis of staining was performed
using MetaMorph software (Universal Imaging, West Chester, PA).
Briefly, images were thresholded using the color threshold function, the
Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume J. Neurosci., November 17, 2004 24(46):10466 –10474 10467
synaptic region was defined in the HRP channel, and the intensity of
DVGLUT within that region was measured.
Electron microscopy. Larvae were dissected in freshly prepared Sylgard-
lined Petri dishes with new insect pins in nominally Ca
2
-free HL-3
solution and fixed for 1 hr at 4°C in electron microscopy grade 2.0%
paraformaldehyde, 2.5% glutaraldehyde, and 1% tannic acid in 0.1
M
cacodylic acid buffer, pH 7.2 (CB). Larvae were then unpinned and trans-
ferred into 1% OsO
4
in CB for 1 hr at room temperature and stained en
bloc with 1% uranyl acetate in H
2
O. Tissue was dehydrated in a progres
-
sive concentration series of ethanol and propylene oxide and embedded
in Epon resin (Electron Microscopy Sciences, Hatfield, PA). Blocks were
sectioned in an RMC Ultra microtome at 70 nm thickness with a Del-
aware diamond knife (Wilmington, DE) and poststained for 1 hr in
Reynolds lead citrate and uranyl acetate. Sections were viewed and mi-
crographs taken on a JOEL 100C transmission electron microscope.
Image analysis. Electron micrographs were taken from a total of 201
active zones from muscles 7 and 6 from segments A2–A4 from two larvae
of each genotype. A total of 35 boutons from four nerves were used in
overexpressors, and 31 boutons from six nerves were used in wild type.
Each active zone was cropped in Photoshop and randomly coded. The
diameters of vesicles near active zones were measured blind to genotype
using MetaMorph software. Seventeen hundred vesicle diameters from
each genotype were used for the histograms shown in Figure 5.
Results
A Drosophila homolog of vertebrate VGLUT
We searched the Drosophila genome for sequences that could
encode an ortholog of the vertebrate VGLUT genes. The closest
Drosophila relative is an uncharacterized predicted gene called
CG9887, which shows 41% identity with human VGLUT1, 40%
identity with both mouse and rat VGLUT2, and 39% identity
with the Caenorhabditis elegans VGLUT1 homolog EAT-4 (Fig.
1a). In addition to having a well conserved sequence, CG9887
also has a very similar hydrophobicity profile to the vertebrate
VGLUTs (Fig. 1b). Both CG9887 and the VGLUTs are highly
hydrophobic, with many predicted membrane-spanning do-
mains. Amino acid identity within this highly hydrophobic re-
gion is 53%. After CG9887, the nearest Drosophila homolog to
the vertebrate VGLUTs is the uncharacterized gene CG4288. It
shows 35% identity to VGLUT1 and also has a similar hydropho-
bicity profile (data not shown).
Expression and vesicular localization of DVGLUT
The Drosophila vesicular glutamate transporter must be ex-
pressed in glutamatergic cells and localized to synaptic vesicles at
glutamatergic synapses. The Drosophila NMJ is glutamatergic, so
we would expect to find mRNA for the bona fide transporter in
the cell bodies of motoneurons. In situ hybridization demon-
strates that CG9887 mRNA is expressed in a subset of central
neurons in embryos (Fig. 2a), including RP motoneurons as well
as a group of lateral cells that are likely to be the lateral motoneu-
ron cluster. CG9887 mRNA is expressed at a number of other
sites in the embryonic CNS; it is first detected at embryonic stage
13 in a small group of segmentally repeating cells and later in a
large number of cells that are likely to be interneurons. In con-
trast, we were unable to detect expression of CG4288 mRNA in
any embryonic neurons (data not shown). Because the expres-
sion pattern of CG9887, but not CG4288, is consistent with that
expected for the Drosophila VGLUT, we initiated an analysis of
the protein encoded by CG9887.
Vesicular glutamate transporters function at the synapse on
synaptic vesicles. If CG9887 encodes the Drosophila VGLUT, it
should be present at glutamatergic terminals. Drosophila NMJs
can be differentiated into type Ib, Is, II, and III based on bouton
morphology and muscle target. Type Ib and Is terminals are the
classic glutamatergic terminals that mediate excitatory transmis-
sion, whereas type II terminals contain neuropeptides and are
thought to be neuromodulatory, and the type III terminals likely
secrete an insulin-like peptide. The type II terminals, however,
also contain high levels of glutamate as assayed by an anti-
glutamate antibody, and ionotropic glutamate receptors cluster
opposite not only Ib and Is synapses but also type II synapses
(Johansen et al., 1989; Marrus et al., 2004). We generated an
antibody to a unique C-terminal peptide from CG9887. This
antisera to CG9887 intensely stains all type Ib, Is, and II boutons
but not the type III terminal. Additionally, staining for CG9887
shows complete colocalization at type I and II terminals with
staining for the CSP, a known synaptic vesicle protein (Fig. 2b)
(Zinsmaier et al., 1994).
Although immunocytochemistry is consistent with a vesicular
localization for CG9887, we wanted to test directly whether the
CG9887 protein is present on synaptic vesicles. We performed
biochemical isolation of synaptic vesicles from fly-head extracts
using glycerol gradient centrifugation. Because synaptic vesicles
are relatively small and uniform in size, they migrate more slowly
Figure 1. Sequence of DVGLUT. a, Sequence and alignment of DVGLUT (Drosophila CG9887)
and human VGLUT1 with identical residues shaded. Overall amino acid identity is 41%. b,
Hydropathy plots of human VGLUT1 and DVGLUT demonstrate that both proteins have very
similar hydrophobicity profiles and are likely to have similar membrane topology.
10468 J. Neurosci., November 17, 2004 24(46):10466 –10474 Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume
than the plasma membrane and other organelles, which rapidly
sediment to the bottom of this gradient, as shown previously for
both cultured neuroendocrine cells and Drosophila neurons
(Clift-O’Grady et al., 1990; van de Goor et al., 1995). The
v-soluble N-ethylmaleimide-sensitive factor attachment protein re-
ceptor (SNARE) n-synaptobrevin (DiAntonio et al., 1993; van de
Goor et al., 1995) cosediments with the CG9887 protein in fractions
enriched for synaptic vesicles (Fig. 3), indicating that CG9887 local-
izes to synaptic vesicles. In contrast, lbm (Kopczynski et al., 1996), a
tetraspanin that localizes to the plasma membrane, sediments to the
bottom of the gradient. Together, these results demonstrate that
CG9887 has high homology to VGLUTs, is expressed in known glu-
tamatergic cells, localizes to synaptic terminals, and is a synaptic
vesicle protein. Therefore, we suggest that CG9887 is the Drosophila
VGLUT and therefore rename CG9887 as DVGLUT.
Increased quantal size with DVGLUT overexpression
It was demonstrated recently that viral overexpression of mouse
VGLUT1 in cultured hippocampal neurons leads to an increase
in quantal size at autaptic synapses (Wojcik et al., 2004). We
wanted to investigate whether the expression of DVGLUT could
regulate quantal size in vivo when overexpressed in its normal
synaptic environment. To achieve tissue-specific overexpression
of DVGLUT, we used the Gal4/UAS transcriptional activation
system (Brand and Perrimon, 1993). We generated transgenic
flies in which the DVGLUT cDNA is under the control of the
yeast UAS promoter (UAS–DVGLUT). To restrict expression to
neurons, we crossed these flies to the neuronal Gal4 line BG380
Gal4 (Budnik et al., 1996). This led to a large increase of DV-
GLUT protein at the synapse; synaptic staining for DVGLUT in
larvae overexpressing the DVGLUT transgene was increased ap-
proximately threefold compared with controls (Fig. 4a)(n 16
NMJs; p 0.001).
To test the hypothesis that DVGLUT levels can regulate quan-
tal size in vivo, we recorded spontaneous mEJPs from muscle 6 of
segments A3 and A4 from control larvae and larvae overexpress-
ing DVGLUT. These mEJPs represent the electrical response in
the muscle to the spontaneous fusion of a single synaptic vesicle
with the presynaptic membrane. The amplitude of the mEJP de-
pends in part on the activity of the postsynaptic glutamate recep-
tors. Because these receptors are not saturated at this synapse, the
amplitude of the mEJP should also depend on the amount of
glutamate released from each vesicle (Karunanithi et al., 2002).
When DVGLUT is overexpressed presynaptically, we find an in-
crease in the mEJP amplitude, a result that is consistent with an
increase in the amount of glutamate loaded into synaptic vesicles.
Sample traces from control and overexpressing larva are shown
in Figure 4, c and d. We observed an 60% increase in mean
mEJP amplitude, from 0.98 0.07 mV in controls to 1.59
Figure 2. Expression pattern of DVGLUT. a, Embryonic in situ hybridization to DVGLUT tran-
script demonstrates expression in a subset of cells in the ventral nerve cord, including putative
motoneuron cell bodies and interneurons. b, Confocal fluorescence microscopy of muscle 12 in
athird-instar larva revealsthat DVGLUT (green) colocalizeswith the synapticvesicle protein CSP
(red) in type Ib and Is NMJs. Note in the merged image that DVGLUT is not expressed at the type
III input (indicated with an asterisk) onto muscle 12. Scale bar, 5
m.
Figure 3. DVGLUT is a synaptic vesicle protein. a, DVGLUT cosediments with the synaptic
vesicle protein n-synaptobrevin after glycerol gradient fractionation. Individual fractions from
the gradient were analyzed by immunoblot with antisera against DVGLUT (top),
n-synaptobrevin (syb; middle), and lbm (bottom). b, Quantitation of the immunoblot in a
demonstrates that DVGLUT and n-synaptobrevin cosediment but lbm does not. Fractions rep-
resenting the top and bottom of the gradient are indicated. A sample of the homogenate that
was loaded onto the gradient was included for comparison (input).
Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume J. Neurosci., November 17, 2004 24(46):10466 –10474 10469
0.1 mV in overexpressing larvae ( p 0.001; n 12). Indepen-
dent insertions of the UAS–DVGLUT transgene show significant
increases in mean quantal size (Fig. 4e), so this phenotype is
caused by the presence of the transgene and not its site of inser-
tion in the genome. The change in quantal size requires the ex-
pression of DVGLUT, because UAS–DVGLUT transgenes in the
absence of GAL-4 had no significant effect on mean quantal size
( p 0.2; n 10; data not shown).
This increase in quantal size could be caused by the addition of
a few very large events or a shift in the size of all events. To
investigate these two possibilities, we constructed cumulative
probability histograms of mEJP amplitudes from control and
DVGLUT-overexpressing larvae (Fig. 4f ). These two distribu-
tions are significantly different by the Kolmogorov–Smirnov test
(p 0.001). The cumulative probability shown in Figure 4d is
an average cumulative probability SEM from 12 cells for each
genotype. Beginning at the third bin (0.25 mV), the two cumula-
tive probabilities are significantly different in each bin by the t test
( p 0.05). This analysis suggests that the entire population of
events is increased in size, with the median increasing by 35%. In
fact, when we scale the control mEJP distribution by 1.35 and
compare it with the distribution from overexpressing larvae,
these distributions overlap almost completely and are not statis-
tically different (Kolmogorov–Smirnov test; p 0.09).
These data strongly suggest that the increase in mean quantal
size is driven at least in part by the 35% increase in individual
mEJPs; however, we have also observed that 1.4% of mEJPs are
8 mV and occasional mEJPs are 20 mV. These large events
skew the mean quantal size, thus resulting in the 60% mean in-
crease but only a 35% median increase. We find that these occa-
sional large (8 mV) events persist in the presence of TTX and in
the absence of external calcium; therefore, they do not represent
evoked synaptic events that occur in response to residual nerve
activity and calcium– dependent exocytosis. To investigate
whether these events might contribute to evoked synaptic trans-
mission, however, we performed a failure analysis. At low exter-
nal Ca
2
concentrations, nerve stimulation usually results in the
fusion of either one vesicle (an event) or no vesicles (a failure).
We used a calcium concentration (0.23 m
M) that resulted in
50% failures in mutant larvae to bias events toward low num-
bers of vesicles released in response to a stimulus. We evoked
3000 events but did not observe any evoked event 8mVin
larvae overexpressing DVGLUT, in contrast to the relatively in-
frequent but consistently observed large spontaneous mEJPs; the
1.4% of mEJPs 8 mV represent 12 of 840 events. We conclude
that the large events are not evocable by an action potential. As
such, the median increase in quantal size of 35% more accurately
describes the functionally relevant increase in quantal size that
occurs when DVGLUT is overexpressed. Together, these data
demonstrate that overexpression of DVGLUT leads to (1) an
increase in the amplitude of the entire population of quantal
events and (2) the generation of a small population of very large
events that are not evocable. The demonstration that DVGLUT
overexpression shifts the entire distribution of mEJPs to larger
amplitudes supports recent similar findings with mouse
VGLUT1 (Wojcik et al., 2004).
In addition to the measured increase in mEJP amplitude, we
also observed a small increase in mEJP frequency in both geno-
types that overexpress DVGLUT (BG380 Gal4/⫹⫽2.0 0.3 Hz;
BG380 Gal4/; UAS–DVGLUT
1
/⫹⫽4.1 0.4 Hz; BG380
Gal4/; UAS–DVGLUT
2
/⫹⫽2.8 0.2 Hz; (n 12, 16, 12; p
0.05). This apparent increase in mEJP frequency suggests that in
wild type the smallest events may be lost in the noise of the re-
cordings. Hence, the measured increase in mEJP amplitude may
underestimate the true increase in quantal size, because these
smallest events are being measured in the DVGLUT overexpres-
sors but not in wild type.
DVGLUT expression increases SV volume
The increase in quantal size with DVGLUT overexpression indi-
cates that more glutamate is loaded in each vesicle. This may
occur by increasing the concentration of neurotransmitter in the
vesicle or by increasing the volume of the vesicle. For the storage
of neuromodulatory monoamine neurotransmitters in special-
ized secretory granules, an increase in vesicular loading is coupled
with an increase in vesicle volume (Colliver et al., 2000; Pothos et
al., 2002; Gong et al., 2003). In contrast to monoamines, fast
transmitters such as glutamate are stored exclusively in synaptic
vesicles, and the relationship between transporter expression and
synaptic vesicle volume has not been explored.
To investigate this issue using overexpression of DVGLUT, we
performed an ultrastructural analysis of synaptic vesicle size at
the Drosophila NMJ. We reasoned that if transmitter concentra-
tion remains constant, the increase in quantal size observed using
electrophysiological methods should correspond morphologi-
cally to an increase in vesicle volume. Alternatively, if the concen-
tration of transmitter within a vesicle represents a steady-state
value that can be changed by increased transporter activity, a
change in vesicle size would not be expected. To distinguish be-
Figure 4. DVGLUT regulates quantal size. a, b, Representative confocal projections of syn-
apses on muscle 4 in wild-type (BG380 Gal4/)(a) and DVGLUT-overexpressing (BG380
Gal4/; UAS-9887
2
/)(b) larvae stained with anti-DVGLUT. Synaptic DVGLUT immunoreac
-
tivity is increased approximately threefold with overexpression. c, d, Representative spontane-
ous mEJPs recorded from muscle 6 of wild-type ( c) and DVGLUT-overexpressing ( d) larvae in
nominally Ca
2
-free saline containing 1
M TTX. e, Histogram showing the mean SEM of
spontaneous mEJP amplitude of wild-type and DVGLUT-overexpressing larvae. Results from
two independent UAS–DVGLUT transgenes (UAS-9887
1
and UAS-9887
2
) are shown (**p
0.002).f,CumulativeprobabilityhistogramofmEJPamplitudesfromwild-type(closedsquares)
andDVGLUT-overexpressing (BG380 Gal4/;UAS-9887
2
/;open triangles) larvae.Each data
point represents the average cumulative probability SEM (n 12 cells). The population of
events in the overexpressor is shifted toward larger amplitude events compared with the wild-
type population. Calibration: 2 mV, 200 msec.
10470 J. Neurosci., November 17, 2004 24(46):10466 –10474 Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume
tween these two potential mechanisms of increasing glutamate
storage and release, we measured the size of 1700 synaptic vesicles
at the NMJ of the type Ib motoneuron that innervates muscles 6
and 7 from both wild-type larvae and larvae overexpressing
DVGLUT (Fig. 5a,b). We found a 14% increase in mean vesicle
outer diameter, from 40.0 0.1 nm in controls to 45.6 0.1 nm
in DVGLUT overexpressors, and a median increase in vesicle
outer diameter of 10% (39.7 0.1 nm in controls to 43.5 0.1
nm in DVGLUT overexpressors). We also measured SV mem-
brane thickness and subtracted it from the outer diameter mea-
surements to yield estimates of inner diameter, which are more
directly proportional to volume. With an average membrane
thickness of 8.7 0.1 nm, estimated vesicle volume changes by
61% (median) or 95% (mean).
The increase in vesicle diameter and hence volume is similar
to the increase in quantal size measured by electrophysiology. In
both cases, the entire populations are shifted to the right relative
to wild type, with the appearance of a few very large quanta and
vesicles that skew the distribution more to the right (Fig. 5c,d).
These results suggest that overexpression of DVGLUT increases
quantal size by increasing the volume of synaptic vesicles without
an increase in transmitter concentration.
A homeostatic response to excess glutamate release
The Drosophila GAL4/UAS system allows us to overexpress
DVGLUT within its normal synaptic environment and thereby
test its effect in vivo on an intact synapse. Having demonstrated
that increased DVGLUT expression can regulate vesicular vol-
ume and quantal size, we wondered how this excess glutamate
release might affect the efficacy of synaptic transmission. To as-
sess synaptic function, we recorded evoked EJPs from muscle 6 of
segments A3 and A4 in saline containing 0.47 m
M Ca
2
(Fig.
6a,b). Surprisingly, we found no significant difference in the am-
plitude of evoked events (EJP: 17.4 1.0 mV in controls and
16.0 1.0 mV in larvae overexpressing DVGLUT; n 13), de-
spite the increase in the amplitude of single mEJPs. Because the
DVGLUT overexpressors show an increased response to a single
vesicle but an apparently wild-type response to the evoked release
of many vesicles, we hypothesized that fewer vesicles may be re-
leased in the overexpressor.
To assess whether fewer vesicles were released in the overex-
pressor we obtained an estimate of the QC. The simplest estimate
of QC is given by the direct method (QC EJP/mEJP), where
mEJP represents the mean value of observed mEJPs; however, the
mean increase in the mEJP that we observed is likely to overesti-
mate the increase in response to most individual vesicles, because
the rare and very largest events are not evocable and skew the
mean to the right. To minimize this potential error, we calculated
quantal content using the median instead of mean mEJP. Using
this variation, we found that quantal content decreased by 33%,
from 23.1 1.7 in controls to 15.6 0.9 in larvae overexpressing
DVGLUT (Fig. 6c)(n 13; p 0.01), strongly suggesting a
decrease in vesicle release. To obtain a second estimate of QC that
is independent of the observed size of the mEJP, we also calcu-
lated quantal content using failure analysis. Failure analysis does
not rely on the mEJP amplitude and does not assume that the
same vesicles contribute to spontaneous and evoked events. In-
stead, this method of estimating vesicle release is based on the
assumption that vesicular transmitter release will follow Poisson
statistics when the probability of release approaches zero from a
large number of release sites (Del Castillo and Katz, 1954). For
Figure 5. DVGLUT regulates synaptic vesicle size. a, b, Representative electron micrographs
of active zones surrounded by a halo of synaptic vesicles from the type Ib NMJ onto muscle 6
from wild-type (BG380 Gal4/)(a) and DVGLUT-overexpressing (BG380 Gal4/; UAS-
9887
2
/) larvae ( b). Scale bar, 50 nm. c, Frequency histogram of measured synaptic vesicle
outer diameter from wild-type (BG380 Gal4/; gray bars) and DVGLUT overexpressing (BG380
Gal4/; UAS-9887
2
/; hatched bars) larvae. d, Cumulative probability histogram of mea
-
sured synaptic vesicle outer diameter from wild-type (gray squares) and DVGLUT-
overexpressing (open triangles) larvae. The entire population of events in the overexpressor is
shifted toward larger diameters compared with the wild-type population.
Figure 6. A decrease in quantal content maintains normal evoked release in DVGLUT-
overexpressing larvae. Representative evoked junctional potentials from wild-type ( a) and
DVGLUT-overexpressing ( b) larvae. Analysis of a number of cells (n 13 for each genotype)
indicates that the amplitude of evoked events is not significantly different. c, Histogram show-
ing the mean SEM of the quantal content for wild-type and DVGLUT-overexpressing larvae
recorded in 0.47 m
M calcium. Quantal content is calculated by the direct method (QC EJP/
mEJP, where the median mEJP is used; see Results). d, Histogram showing the mean SEM of
the quantal content for wild-type and DVGLUT-overexpressing larvae recorded in 0.23 m
M
calcium and calculated by the method of failures [QC ln (trials/failures)]. Two independent
methods of estimating quantal content indicate that the number of synaptic vesicles released
from the DVGLUT overexpressors is decreased relative to wild type (**p 0.01; *p 0.05).
Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume J. Neurosci., November 17, 2004 24(46):10466 –10474 10471
this method, quantal content is estimated as the natural log of the
ratio of trials of nerve stimulation to the number of failures of the
nerve to release transmitter. Many previous studies demonstrate
that these assumptions are valid at the Drosophila NMJ under
conditions of low external calcium (Petersen et al., 1997; Davis
and Goodman, 1998; Haghighi et al., 2003), and we therefore
performed similar studies using 0.23 m
M external Ca
2
. Under
these conditions, synapses overexpressing DVGLUT were more
likely than wild-type synapses to fail to release a vesicle. Calculat-
ing by the method of failures demonstrated a 37% decrease in
quantal content (QC 1.01 0.15 in controls; QC 0.64
0.08 in overexpressing larvae; n 12; p 0.05) (Fig. 6d). There-
fore, two independent estimates of quantal content demonstrate
that when DVGLUT is overexpressed and more glutamate is re-
leased from a single vesicle, the synapse responds by releasing
fewer vesicles. This suggests that homeostatic mechanisms at this
synapse can decrease quantal content to maintain normal levels
of synaptic excitation in response to excess glutamate release.
Discussion
We have investigated how the expression of a vesicular glutamate
transporter regulates the strength of a glutamatergic synapse in
vivo. Our goal was to perform these studies at the Drosophila
neuromuscular junction, a well characterized glutamatergic syn-
apse, and thereby avoid the use of cultured neurons. We therefore
identified and characterized DVGLUT. We demonstrate that
DVGLUT is a synaptic vesicle protein that is present in the syn-
aptic terminals of all glutamatergic motoneurons as well as many
synaptic terminals in the CNS. Increased expression of DVGLUT
at the NMJ leads to an increase in quantal size. Hence, DVGLUT
expression can regulate the glutamate content of a synaptic vesi-
cle. We observe a corresponding increase in vesicle volume sug-
gesting that the vesicular glutamate concentration is likely to re-
main roughly constant despite excess glutamate content. Release
of this excess glutamate triggers a homeostatic mechanism that
downregulates the number of vesicles released by the motoneu-
ron, thereby maintaining normal levels of synaptic excitation.
A Drosophila vesicular glutamate transporter
We identified the predicted Drosophila protein CG9887 as a can-
didate DVGLUT because its amino acid sequence and hydropho-
bicity profile are similar to those of known VGLUTs and its
mRNA is strongly expressed in a subset of neurons. We have
demonstrated that CG9887 is a synaptic vesicle protein, is ex-
pressed at synaptic terminals of all known glutamatergic mo-
toneurons, and can regulate the glutamate content of synaptic
vesicles. Based on these findings, we conclude that CG9887 is a
Drosophila VGLUT. Because CG9887 is the only Drosophila gene
similar to the vertebrate VGLUTs that is expressed in neurons,
CG9887 may be the only Drosophila VGLUT.
Although the Drosophila NMJ is a well characterized glutama-
tergic synapse, the role of glutamate as a transmitter elsewhere in
the Drosophila nervous system has received little attention. We
detect widespread expression of DVGLUT in the synaptic neuro-
pil of the brain and nerve cord, suggesting that glutamate is an
important transmitter for interneurons. The ability to detect glu-
tamatergic terminals using the antibody to DVGLUT will aid in
the identification of the transmitter phenotype of identified cen-
tral neurons in Drosophila.
DVGLUT regulates quantal size
Overexpression of transporters for acetylcholine, monoamines,
and glutamate in cultured cells can increase quantal size (Song et
al., 1997; Colliver et al., 2000; Pothos et al., 2000; Wojcik et al.,
2004), suggesting that changing the expression or activity of ve-
sicular transporters may be a general mechanism for controlling
the transmitter content of vesicles. We have now tested this hy-
pothesis for a vesicular glutamate transporter at an intact synapse
in vivo.
We generated transgenic flies that overexpress DVGLUT at
the glutamatergic NMJ. Increased expression of DVGLUT led to
a large increase in the postsynaptic response to the fusion of single
vesicles. This increase in the mean response was attributable to
two factors. First, the entire population of spontaneous events
shifted to larger amplitude. The median amplitude increased by
35%, and the mEJP amplitude distribution was recapitulated by
scaling the wild-type distribution by a factor of 1.35. Second, a
small population of very large spontaneous events appeared with
DVGLUT overexpression. These events persisted in the presence
of TTX and absence of external calcium, so they do not represent
spontaneous evoked release and could not be evoked by an action
potential. Regardless of the nature of these rare events, the key
finding is that increasing the levels of synaptic DVGLUT in-
creases the postsynaptic response to the entire pool of synaptic
vesicles. Hence, the number of DVGLUT molecules in a vesicle
regulates the glutamate content of that vesicle.
Increased DVGLUT expression alters synaptic vesicle volume
The concentration and volume of glutamate in the vesicle will
affect the concentration and time course of glutamate in the syn-
aptic cleft, which are important determinants of the postsynaptic
response (Choi et al., 2000; Renger et al., 2001; Liu, 2003; Pawlu et
al., 2004). The overexpression of DVGLUT loads more glutamate
into vesicles, so either the concentration of glutamate or the size
of the vesicle must have increased. To determine which mecha-
nism is underlying the observed increase in quantal size, we mea-
sured the diameter of synaptic vesicles from wild-type and
DVGLUT-overexpressing synapses. We observed that the entire
population of synaptic vesicles is larger when DVGLUT is over-
expressed. The calculated increases in the median (61%) and
mean (95%) vesicle volume are more than sufficient to explain
the observed increase in the median (35%) and mean (60%)
quantal size. Therefore, it is likely that the glutamate concentra-
tion in the vesicle does not increase with DVGLUT overexpres-
sion; however, because quantal size does not change as much as
vesicular volume, the glutamate concentration may actually be
somewhat lower than in wild type. Alternatively, postsynaptic
glutamate receptors may be approaching saturation in the mu-
tant and unable to faithfully record the full extent of the increase
in released glutamate, although the increase in quantal size that
we observe demonstrates that in wild type the glutamate recep-
tors are not saturated.
In previous studies of VGLUT and VAChT overexpression,
the increases in quantal size were interpreted as increases in the
concentration of vesicular transmitter (Song et al., 1997; Wil-
liams, 1997; Schuske and Jorgensen, 2004; Wojcik et al., 2004).
This led to a steady-state model of vesicle filling, in which inflow
through the transporters is balanced by a leak from the vesicle:
more inflow caused by more transporter therefore leads to a
higher steady-state equilibrium concentration of transmitter.
This was contrasted with a set-point model, in which the concen-
tration of transmitter is held constant, and more transporters
would only be expected to increase the rate, but not the extent, of
vesicle filling (Williams, 1997); however, these models do not
take into account the possibility that the volume of the vesicle
could change. Our data argue for a modified set-point model: the
10472 J. Neurosci., November 17, 2004 24(46):10466 –10474 Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume
concentration of transmitter is held roughly constant, but the
vesicular volume is changed by the number of transporter mole-
cules in the vesicle. A similar model has been described for the
loading of monoamines into secretory vesicles (Colliver et al.,
2000; Gong et al., 2003). Our findings suggest that despite differ-
ences between secretory vesicles and synaptic vesicles, a similar
mechanism can increase transmitter content.
Two models could explain the relationship between trans-
porter expression and vesicle volume. First, the volume of the
vesicle may be affected by its transmitter content; more func-
tional transporter would add more glutamate, which by an un-
known mechanism would lead to a larger vesicle. Alternatively,
the vesicle volume may be sensitive to the physical addition of the
transporter with its many membrane-spanning domains. These
models could be distinguished by the expression of a nonfunc-
tional transporter.
A homeostatic response to excess glutamate release
Having used transgenic techniques to manipulate DVGLUT ex-
pression in vivo, we were able to ask about the physiological con-
sequences of this excess glutamate at an intact synapse. We find
that total synaptic excitation is unchanged despite the increase in
glutamate per vesicle because the presynaptic terminal releases
fewer vesicles with each evoked event. It is possible that overex-
pression of DVGLUT directly decreases release probability; how-
ever, it would be an unlikely coincidence that this would exactly
offset the increase in quantal size and produce a normal-sized
evoked event. Instead, we favor the model that a modest and
persistent increase in glutamate release from each vesicle leads to
a compensatory decrease in the number of released vesicles that
attenuates the excitatory effect of glutamate. Other homeostatic
mechanisms have been described at the fly NMJ. Various studies
have demonstrated that decreasing postsynaptic activity, either by
manipulating glutamate receptors or postsynaptic potassium chan-
nels, triggers a compensatory increase in presynaptic transmitter re-
lease (Petersen et al., 1997; Davis et al., 1998; Paradis et al., 2001). In
addition, nonvesicular leak of glutamate can homeostatically regu-
late postsynaptic glutamate receptor levels (Featherstone et al.,
2002). The current findings are the first to demonstrate that a change
in the release of vesicular glutamate can trigger a homeostatic change
in presynaptic release properties.
What could trigger this compensatory downregulation of pre-
synaptic release? Is it caused by increased postsynaptic excitation,
or is it a direct effect of the increased glutamate in the cleft? We
have previously manipulated postsynaptic expression of gluta-
mate receptors leading to an increase in quantal size that is com-
mensurate with the increase seen with DVGLUT overexpression.
With increased postsynaptic excitation but no change in extracel-
lular glutamate, there is no compensation; quantal content is
unchanged and evoked synaptic events are larger (Petersen et al.,
1997). So increasing glutamate release by overexpressing
DVGLUT induces compensation, whereas directly increasing
postsynaptic excitation by manipulating glutamate receptors
does not affect cleft glutamate and does not trigger a compensa-
tory decrease in quantal content. In summary, postsynaptic re-
ductions in quantal size do initiate homeostatic compensation
and postsynaptic increases in quantal size do not cause such com-
pensation, but presynaptic increases in quantal size do trigger
homeostatic decreases in presynaptic release. These data are con-
sistent with the model that increased glutamate in the cleft di-
rectly triggers a compensatory downregulation of release. Similar
findings in culture demonstrate that the persistent excitation of
vertebrate neurons leads to a compensatory decrease in gluta-
mate release (Moulder et al., 2004). Such homeostatic mecha-
nisms could serve to limit the spread of excitotoxicity.
References
Bellocchio EE, Reimer RJ, Fremeau Jr RT, Edwards RH (2000) Uptake of
glutamate into synaptic vesicles by an inorganic phosphate transporter.
Science 289:957–960.
Brand AH, Perrimon N (1993) Targeted gene expression as a means of al-
tering cell fates and generating dominant phenotypes. Development
118:401–415.
Budnik V, Koh YH, Guan B, Hartmann B, Hough C, Woods D, Gorczyca M
(1996) Regulation of synapse structure and function by the Drosophila
tumor suppressor gene dlg. Neuron 17:627– 640.
Choi S, Klingauf J, Tsien RW (2000) Postfusional regulation of cleft gluta-
mate concentration during LTP at “silent synapses”. Nat Neurosci
3:330–336.
Clift-O’Grady LLA, Lowe AW, Grote E, Kelly RB (1990) Biogenesis of syn-
aptic vesicle-like structures in a pheochromocytoma cell line PC-12. J Cell
Biol 110:1693–1703.
Colliver TL, Pyott SJ, Achalabun M, Ewing AG (2000) VMAT-mediated
changes in quantal size and vesicular volume. J Neurosci 20:5276–5282.
Davis GW, Goodman CS (1998) Synapse-specific control of synaptic effi-
cacy at the terminals of a single neuron. Nature 392:82–86.
Davis GW, DiAntonio A, Petersen SA, Goodman CS (1998) Postsynaptic
PKA controls quantal size and reveals a retrograde signal that regulates
presynaptic transmitter release in Drosophila. Neuron 20:305–315.
Del Castillo J, Katz B (1954) Quantal components of the end-plate potential.
J Physiol (Lond) 124:560 –573.
DiAntonio A, Burgess RW, Chin AC, Deitcher DL, Scheller RH, Schwarz TL
(1993) Identification and characterization of Drosophila genes for synap-
tic vesicle proteins. J Neurosci 13:4924 4935.
Erickson JD, Eiden LE, Hoffman BJ (1992) Expression cloning of a
reserpine-sensitive vesicular monoamine transporter. Proc Natl Acad Sci
USA 89:10993–10997.
Erickson JD, Varoqui H, Schafer MK, Modi W, Diebler MF, Weihe E, Rand J,
Eiden LE, Bonner TI, Usdin TB (1994) Functional identification of a
vesicular acetylcholine transporter and its expression from a “cholin-
ergic” gene locus. J Biol Chem 269:21929 –21932.
Featherstone DE, Rushton E, Broadie K (2002) Developmental regulation
of glutamate receptor field size by nonvesicular glutamate release. Nat
Neurosci 5:141–146.
Fremeau Jr RT, Burman J, Qureshi T, Tran CH, Proctor J, Johnson J, Zhang
H, Sulzer D, Copenhagen DR, Storm-Mathisen J, Reimer RJ, Chaudhry
FA, Edwards RH (2002) The identification of vesicular glutamate trans-
porter 3 suggests novel modes of signaling by glutamate. Proc Natl Acad
Sci USA 99:14488–14493.
Fremeau Jr RT, Kam K, Qureshi T, Johnson J, Copenhagen DR, Storm-
Mathisen J, Chaudhry FA, Nicoll RA, Edwards RH (2004) Vesicular glu-
tamate transporters 1 and 2 target to functionally distinct synaptic release
sites. Science 304:1815–1819.
Gong LW, Hafez I, Alvarez de Toledo G, Lindau M (2003) Secretory vesicles
membrane area is regulated in tandem with quantal size in chromaffin
cells. J Neurosci 23:7917–7921.
Haghighi AP, McCabe BD, Fetter RD, Palmer JE, Hom S, Goodman CS
(2003) Retrograde control of synaptic transmission by postsynaptic
CaMKII at the Drosophila neuromuscular junction. Neuron 39:255–267.
Johansen J, Halpern ME, Johansen KM, Keshishian H (1989) Stereotypic
morphology of glutamatergic synapses on identified muscle cells of Dro-
sophila larvae. J Neurosci 9:710–725.
Karunanithi S, Marin L, Wong K, Atwood HL (2002) Quantal size and vari-
ation determined by vesicle size in normal and mutant Drosophila gluta-
matergic synapses. J Neurosci 22:10267–10276.
Kopczynski CC, Davis GW, Goodman CS (1996) A neural tetraspanin, en-
coded by late bloomer, that facilitates synapse formation. Science
271:1867–1870.
Liu G (2003) Presynaptic control of quantal size: kinetic mechanisms and
implications for synaptic transmission and plasticity. Curr Opin Neuro-
biol 13:324 –331.
Liu Y, Peter D, Roghani A, Schuldiner S, Prive GG, Eisenberg D, Brecha N,
Edwards RH (1992) A cDNA that suppresses MPP toxicity encodes a
vesicular amine transporter. Cell 70:539–551.
Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume J. Neurosci., November 17, 2004
24(46):10466–10474 10473
Malinow R, Malenka RC (2002) AMPA receptor trafficking and synaptic
plasticity. Annu Rev Neurosci 25:103–126.
Marrus SB, DiAntonio A (2004) Preferential localization of glutamate re-
ceptors opposite sites of high presynaptic release. Curr Biol 14:924–931.
Marrus SB, Portman SL, Allen MJ, Moffat KG, DiAntonio A (2004) Differ-
ential localization of glutamate receptor subunits at the Drosophila neu-
romuscular junction. J Neurosci 24:1406–1415.
McIntire SL, Reimer RJ, Schuske K, Edwards RH, Jorgensen EM (1997)
Identification and characterization of the vesicular GABA transporter.
Nature 389:870 876.
Moulder KL, Meeks JP, Shute AA, Hamilton CK, de Erausquin G, Mennerick
S (2004) Plastic elimination of functional glutamate release sites by de-
polarization. Neuron 42:423–435.
Paradis S, Sweeney ST, Davis GW (2001) Homeostatic control of presynap-
tic release is triggered by postsynaptic membrane depolarization. Neuron
30:737–749.
Pawlu C, DiAntonio A, Heckmann M (2004) Postfusional control of quan-
tal current shape. Neuron 42:607–618.
Petersen SA, Fetter RD, Noordermeer JN, Goodman CS, DiAntonio A
(1997) Genetic analysis of glutamate receptors in Drosophila reveals a
retrograde signal regulating presynaptic transmitter release. Neuron
19:1237–1248.
Pothos EN, Larsen KE, Krantz DE, Liu Y, Haycock JW, Setlik W, Gershon
MD, Edwards RH, Sulzer D (2000) Synaptic vesicle transporter expres-
sion regulates vesicle phenotype and quantal size. J Neurosci
20:7297–7306.
Pothos EN, Mosharov E, Liu KP, Setlik W, Haburcak M, Baldini G, Gershon
MD, Tamir H, Sulzer D (2002) Stimulation-dependent regulation of the
pH, volume and quantal size of bovine and rodent secretory vesicles.
J Physiol (Lond) 542:453– 476.
Renger JJ, Egles C, Liu G (2001) A developmental switch in neurotransmit-
ter flux enhances synaptic efficacy by affecting AMPA receptor activation.
Neuron 29:469 484.
Roghani A, Feldman J, Kohan SA, Shirzadi A, Gundersen CB, Brecha N,
Edwards RH (1994) Molecular cloning of a putative vesicular trans-
porter for acetylcholine. Proc Natl Acad Sci USA 91:10620 –10624.
Schuske K, Jorgensen EM (2004) Neuroscience. Vesicular glutamate trans-
porter–shooting blanks. Science 304:1750 –1752.
Song H-J, Ming G-L, Fon E, Bellocchio E, Edwards RH, Poo M-M (1997)
Expression of a putative vesicular acetylcholine transporter facilitates
quantal transmitter packaging. Neuron 18:815–826.
Stewart BA, Atwood HL, Renger JJ, Wang J, Wu CF (1994) Improved sta-
bility of Drosophila larval neuromuscular preparations in haemolymph-
like physiological solutions. J Comp Physiol [A] 175:179 –191.
Takamori S, Rhee JS, Rosenmund C, Jahn R (2000) Identification of a ve-
sicular glutamate transporter that defines a glutamatergic phenotype in
neurons. Nature 407:189–194.
Tautz D, Pfeifle C (1989) A non-radioactive in situ hybridization method
for the localization of specific RNAs in Drosophila embryos reveals trans-
lational control of the segmentation gene hunchback. Chromosoma
98:81–85.
van de Goor J, Ramaswami M, Kelly R (1995) Redistribution of synaptic
vesicles and their proteins in temperature-sensitive shibire(ts1) mutant
Drosophila. Proc Natl Acad Sci USA 92:5739 –5743.
Williams J (1997) How does a vesicle know it is full? Neuron 18:683–686.
Wojcik SM, Rhee JS, Herzog E, Sigler A, Jahn R, Takamori S, Brose N, Rosen-
mund C (2004) An essential role for vesicular glutamate transporter 1
(VGLUT1) in postnatal development and control of quantal size. Proc
Natl Acad Sci USA 101:7158–7163.
Zinsmaier KE, Eberle KK, Buchner E, Walter N, Benzer S (1994) Paralysis
and early death in cysteine string protein mutants of Drosophila. Science
263:977–980.
10474 J. Neurosci., November 17, 2004 24(46):10466 –10474 Daniels et al. DVGLUT Regulates Quantal Size and Synaptic Vesicle Volume
  • ... We found that dVGLUT-and TH promoter-driven fluorescent tags co-localized in the MB-MV1 region, particularly within DA nerve terminal active zones labeled by Bruchpilot, a synaptic active zone marker (using the nc82 antibody; Figures 4A and 4B;Figure S2). We validated these data by determining whether endogenous dVGLUT co-localized to presynaptic DA nerve terminals using an anti-dVGLUT antibody (Daniels et al., 2004) in fly brains expressing TH promoter-driven dVMAT-pHluorin (Figure S3). To identify areas of overlap between dVMAT(+) and dVGLUT(+) antibody labeling unambiguously, we focused our attention on cells and their processes that clearly expressed dVMATpHluorin and were also spatially separate from other dVGLUT labeling. ...
  • ... Drosophila motor neurons are glutamatergic (Jan and Jan, 1976;Johansen et al., 1989) and express a number of presynaptic proteins such as for instance synapsin, synaptotagmin, and bruchpilot (seeCollins and DiAntonio, 2007;Menon et al., 2013). A vGluT is required for transporting the neurotransmitter into the synaptic vesicles and serves as a reliable marker for glutamatergic neurons (Daniels et al., 2004;Mahr and Aberle, 2006). We validated that the aCC motor neurons express vGluT, and the presynaptic proteins bruchpilot (Brp), synapsin, and synaptotagmin (seeFurthermore, we found that synaptotagmin immunolabeling was no longer visible (Figures 4M–R) and synapsin labeling drastically reduced (Figure 5). ...
  • ... The Drosophila genome encodes 48 putative amino acid transporters (Limmer et al., 2014). Many of these transporters have been shown to be expressed in the CNS (Augustin et al., 2007;Besson et al., 2005;Daniels et al., 2004Desalvo et al., 2011;Rival et al., 2004;Soustelle et al., 2002;Stacey et al., 2010). However, one glutamate and two GABA transporter, dmVGlut, dmVGAT and CG16700, are expressed in the HBB-forming glial cells (Desalvo et al., 2014). ...
Article
February 2006 · Neuron · Impact Factor: 15.05
    Quantal size is the postsynaptic response to the release of a single synaptic vesicle and is determined in part by the amount of transmitter within that vesicle. At glutamatergic synapses, the vesicular glutamate transporter (VGLUT) fills vesicles with glutamate. While elevated VGLUT expression increases quantal size, the minimum number of transporters required to fill a vesicle is unknown. In... [Show full abstract]
    Article
    July 2004 · Current Biology · Impact Factor: 9.57
      The localization of glutamate receptors is essential for the formation and plasticity of excitatory synapses. These receptors cluster opposite neurotransmitter release sites of glutamatergic neurons, but these release sites have heterogeneous structural and functional properties. At the Drosophila neuromuscular junction, receptors expressed in a single postsynaptic cell are confronted with an... [Show full abstract]
      Article
      February 2006 · Neuron · Impact Factor: 15.05
        Some 50 years ago, Bernard Katz and colleagues demonstrated that neurotransmitter is released as packets, or quanta, and a wealth of subsequent data have shown that synaptic vesicles (SVs) are the physical correlate of these quanta (Atwood and Karunanithi, 2002). Vesicular neurotransmitter transporters are responsible for packaging neurotransmitter into the lumen of the vesicle and thereby... [Show full abstract]
        Article
        February 2006 · International Review of Neurobiology · Impact Factor: 1.92
          This chapter discusses the role of glutamate receptors not only in mediating synaptic transmission but also in the formation and plasticity of synapses in Drosophila. The chapter discusses the composition of ionotropic glutamate receptors (iGluRs), describes the way the subunit composition iGluRs shapes the properties of synapses, presents mechanisms involved in clustering iGluRs at the... [Show full abstract]
          Discover more