ArticlePDF Available

Molecular phylogeny of the extinct cave lion Panthera leo spelaea

Authors:

Abstract and Figures

To reconstruct the phylogenetic position of the extinct cave lion (Panthera leo spelaea), we sequenced 1 kb of the mitochondrial cytochrome b gene from two Pleistocene cave lion DNA samples (47 and 32 ky B.P.). Phylogenetic analysis shows that the ancient sequences form a clade that is most closely related to the extant lions from Africa and Asia; at the same time, cave lions appear to be highly distinct from their living relatives. Our data show that these cave lion sequences represent lineages that were isolated from lions in Africa and Asia since their dispersal over Europe about 600 ky B.P., as they are not found among our sample of extant populations. The cave lion lineages presented here went extinct without mitochondrial descendants on other continents. The high sequence divergence in the cytochrome b gene between cave and modern lions is notable.
Content may be subject to copyright.
Short Communication
Molecular phylogeny of the extinct cave lion Panthera leo spelaea
Joachim Burger,
a,*
Wilfried Rosendahl,
b,1
Odile Loreille,
a
Helmut Hemmer,
c,2
Torsten Eriksson,
d,3
Anders G
otherstr
om,
e,4
Jennifer Hiller,
f,g,5
Matthew J. Collins,
f,6
Timothy Wess,
g
and Kurt W. Alt
a
a
Molecular Archaeology Mainz, Institute of Anthropology, Johannes Gutenberg-University, Saarstrasse 21, D-55099 Mainz, Germany
b
Institute of Applied Geosciences, Darmstadt University of Technology, Schnittspahnstrasse 9, D-64287 Darmstadt, Germany
c
Institute of Zoology, Johannes Gutenberg-University, Saarstrasse 21, D-55099 Mainz, Germany
d
Bergius Foundation, Royal Swedish Academy of Sciences, Box 50017, SE-10405 Stockholm, Sweden
e
Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, Norbyv
agen 18D, SE-752 36 Uppsala, Sweden
f
School of Civil Engineering and Geoscience, University of Newcastle upon Tyne, Newcastle upon Tyne, UK
g
Biophysics Group, Department of Optometry and Vision Sciences, University of Cardiff, Cardiff, Wales, UK
Received 28 February 2003; revised 25 June 2003
Abstract
To reconstruct the phylogenetic position of the extinct cave lion (Panthera leo spelaea), we sequenced 1 kb of the mitochondrial
cytochrome bgene from two Pleistocene cave lion DNA samples (47 and 32 ky B.P.). Phylogenetic analysis shows that the ancient
sequences form a clade that is most closely related to the extant lions from Africa and Asia; at the same time, cave lions appear to be
highly distinct from their living relatives. Our data show that these cave lion sequences represent lineages that were isolated from
lions in Africa and Asia since their dispersal over Europe about 600 ky B.P., as they are not found among our sample of extant
populations. The cave lion lineages presented here went extinct without mitochondrial descendants on other continents. The high
sequence divergence in the cytochrome bgene between cave and modern lions is notable.
2003 Elsevier Inc. All rights reserved.
1. Introduction
The cave lion [Panthera leo spelaea (Goldfuss, 1810)]
was one of the most important carnivorous competitors
of early man in Europe, from the early Middle Pleisto-
cene onwards. It was an object of Palaeolithic art, such
as the magnificent colour paintings in the Chauvet Cave
(Ard
eche, France) (Lorblanchet, 1995) or the impressive
ivory sculptures from the Vogelherd cave (Swabian Alb,
Germany) (Fig. 1). The first comprehensive morpho-
logical studies of cave lion remains, in the 19th and the
beginning of the 20th century, showed a relationship to
modern lions. Subsequent reinterpretations either linked
cave lions to modern tigers or declared them a separate
species. Osteological revisions have, however, always
indicated a relationship to modern lions (Hemmer,
1974), although lately a new case has been made for a
relationship to tigers based on brain endocasts (Groiss,
1996). Comparative morphological analysis of Pleisto-
cene and Holocene lions on the level of geographic
populations resulted in the description of two basic
evolutionary lines: the spelaea group of the Holarctic
Pleistocene and the leo group of Africa and southern
Asia (Hemmer, 1974). Most authors favour the taxo-
nomic combination of these groups within the species
Panthera leo (Hemmer, 1974; Kurt
en, 1968; Turner and
Ant
on, 1997), but some prefer a taxonomic separation
at the species level, into Panthera spelaea and Panthera
leo (Baryshnikov and Boeskorov, 2001). Here, we report
the mtDNA analysis of two Upper Pleistocene cave
lions, one (Si) 47,180 + 1190/)1040 year B.P. and one
*
Corresponding author. Fax: +49-6131-392-5132.
E-mail addresses: jburger@mail.uni-mainz.de (J. Burger), wilfros@
geo.tu-darmstadt.de (W. Rosendahl), Torsten.Eriksson@bergainska.se
(T. Eriksson), agotherstrom@isciii.es (A. G
otherstr
om), j.c.hiller@
stir.ac.uk (J. Hiller), m.collins@ncl.ac.uk (M.J. Collins).
1
Fax: +49-6151-166539.
2
Fax: +49-6136-42424.
3
Fax: +46-08-612-9005.
4
Fax: +46-18-471-63-10.
5
Fax: +44-0-1786-464-994.
6
Fax: +44-0-191-222-5431.
1055-7903/$ - see front matter 2003 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2003.07.020
Molecular Phylogenetics and Evolution 30 (2004) 841–849
MOLECULAR
PHYLOGENETICS
AND
EVOLUTION
www.elsevier.com/locate/ympev
(Ku) 31,890 300 year B.P. old. Our results are con-
sistent with the taxonomy of pantherine cats presented
in Table 1.
2. Materials and methods
2.1. Fossil bone samples
One specimen (Si), an almost complete skeleton of a
cave lion embedded in a greyish silty clay, was exca-
vated in 1985 (Rosendahl and Darga, 2004) at Siegsdorf
in southeastern Bavaria, Germany. For preservation the
bone surfaces were treated with a silica gel resin. Sam-
ples were taken for radiocarbon dating and DNA
analysis from the interior compact bone of the right
femur. The high collagen yield (19.4 wt% bone) suggests
that the bones were not significantly altered diageneti-
cally and that the 14 C-AMS date of 47,180 + 1190/)1040
(KIA 14406) year B.P. is valid. The second, untreated
sample (Ku) was recovered from layer 4 (a light-brown
cave loam) of the Tischhofer cave, 2 km northwest of
Kufstein, Tirol, Austria, 598 m a.s.l, in 1906 (Schlosser,
1910). A pelvis fragment of a juvenile cave lion was
selected for dating and DNA analysis. The collagen
yield was again high (12 wt% bone), suggesting that the
14C-AMS date of 31,890 300 (KIA 16510) year B.P. is
also valid. Modern pantherine samples (P. leo persica
and P. pardus) were from the Frankfurt/Main Zoo,
Germany.
Fig. 1. Cave lion ivory sculpture from Vogelherd cave, Swabian Alb,
Germany (Aurignacian 32 kya).
Table 1
Taxonomy of the pantherine cats (after Hemmer, 1974, 1978, in press, and this study)
Genus Subgenus Species Subspecies
Neofelis Neofelis nebulosa (clouded leopard)
[AJ304497]
Uncia Uncia uncia (snow leopard)
Panthera Tigris Panthera tigris (tiger) [AF053021,
AF053039, AF053048, AF053051]
Panthera Panthera pardus (leopard) [this study]
Panthera onca (jaguar)
Panthera leo (lion) spelaea group (Pleistocene)
Panthera leo fossilis (Early Middle Pleistocene European cave
lion)
Panthera leo vereshchagini (East Siberian and Beringian cave lion)
Panthera leo atrox (North American cave lion)
Panthera leo spelaea (Upper Pleistocene European cave lion) [this
study]
leo group (African and South-Asian lions)
persica subgroup
Panthera leo persica (South Asian lion) [this study]
close to persica subgroup
Panthera leo leo (Atlas lion)
senegalensis subgroup:
Panthera leo senegalensis (West African lion)
Panthera leo azandica (North East Congo lion)
Panthera leo nubica (East African lion) [AF384809, AF384817]
Panthera leo bleyenberghi (Southwest African lion) [AF384811-
AF384815]
Panthera leo krugeri (Southeast African lion) [AF384816,
AF384818]
Panthera leo melanochaita (Cape lion)
Provided as (common name) [sequence origin]. Subspecies nomenclature is given for lions.
842 J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849
2.2. Diagenetic measurements
Fourier-transform infrared spectra were generated
using KBr pellets. The spectra were used to generate a
splitting factor (SF) as described in Termine and Posner
(1966) and Weiner and Bar-Yosef (1990) as well as a
carbonate:phosphate peak ratio (C/P) as shown in
Wright and Schwarcz (1996). These measurements relate
to the degree of mineral alteration in the bone sample.
Powders were also subjected to elemental analysis,
providing a percent value of whole bone nitrogen (% N)
in each sample. This has been determined to relate to the
remaining protein present in archaeological and fossil
samples (Hedges et al., 1995). Finally, powders were
subjected to small-angle X-ray scattering (SAXS) anal-
ysis on a Bruker AXS Nanostar (Karlsruhe) at the
University of Stirling. This provided a detailed mea-
surement of the bone crystallite size and shape in each
sample.
2.3. Ancient DNA work
The DNA work was conducted in two laboratories,
located in separate buildings: one ancient DNA labo-
ratory devoted to pre-PCR procedures and free of other
molecular work, and a second laboratory for the post-
PCR analysis. The extractions were performed in a de-
voted ancient DNA laboratory where no felid DNA had
previously been introduced. All rooms are regularly
washed with bleach and UV-irradiated overnight. Every
item entering these rooms is washed with bleach and
subsequently UV-irradiated. Filtered water for cleaning
is additionally UV-treated for at least 10 h. Two inde-
pendent samples were taken from each specimen for the
Mainz laboratory. A third sample from each lion was
processed in Uppsala to where it was sent directly from
the museums.
2.4. Extraction of ancient DNA samples
0.4–1 g powdered bone samples were incubated in
3–6 mL of extraction buffer (0.5 M EDTA, pH 8.5; 0.5%
N-lauryl sarcosine; 19 mg/mL proteinase K) on a rotary
shaker for 20 h at 37 C. DNA was extracted with phe-
nol/chloroform/isoamyl alcohol (25:24:1); the super-
natant was concentrated by Centricon 30 (Amicon)
dialysis and finally washed several times with UV-trea-
ted HPLC-grade water.
2.5. PCR, cloning, and DNA-sequencing
Twelve PCR products in lengths of 87–209 bp were
designed to cover 1051 bp of the cytochrome bgene of
pantherines (Fig. 2). One additional primer pair ampli-
fies a 474 bp amplicon and is used to test for the presence
of contaminating undegraded DNA in the PCR. When
possible, primers (Table 2) were designed so that they
did not amplify either the human sequence or a known
tiger nuclear insertion. The resulting PCR amplicons
had a minimum of 2 bp and maximum of 59 bp overlap
(without primers). Initially, primers were tested in a
third laboratory so that no molecular work on modern
pantherines was performed in the laboratories prior to
ancient DNA analysis. After aDNA extraction, a series
of PCR amplifications were performed until sequences
from at least two DNA extracts and four independent
PCR runs were available for each amplicon. Further, to
detect possible heterogenous sequences and nuclear
insertions, each PCR product was cloned at least once
and 5–21 clones (average 9) were sequenced. In total, the
Fig. 2. Sequencing strategy. The lengths of the amplicons are shown including primers.The numbers refer to the position on the lion cytochrome b
gene sequence.
J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849 843
sequences were reproduced 14–37 times (average 19) so
that 258 and 191 sequences, respectively, were produced
to establish the 1051 bp sequence of both specimens.
The following sequences were acquired from Gen-
Bank: Felis catus (domestic cat): AB004238; Neofelis
nebulosa (clouded leopard): AJ304497; Panthera leo
(lion): AF384815, AF384811, AF384812, AF384813,
AF384814, AF384818, AF384816, AF384817, and
AF384809; Panthera tigris (tiger): AF053051,
AF053039, AF053048, and AF053021.
The following sequences were produced:
P. leo persica (Asiatic lion) 1 (Zoo Frankfurt a. M.,
Germany); P. leo persica 2 (Zoo Frankfurt a. M., Ger-
many); and P. pardus (leopard) (Zoo Frankfurt a. M.,
Germany).
Amplifications were carried out in a 50 lL reaction
volume containing 50 mM KCl, 10 mM Tris–HCl
(GeneAmp 10Buffer II, PE Applied Biosystems); 2–
2.5 mM MgCl2, 200 lM each dNTPs, 1 lg T4 G32
protein, 0.2 lM of each primer, and 3.5 U of AmpliTaq
Gold (PE Applied Biosystems). The PCR thermal cy-
cling conditions were 94 C for 5 min followed by 38–45
cycles at 94 C for 30 s, at 54–60C for 30 s, and at 72C
for 30 s. One extraction blank and two PCR negative
controls were carried out for each PCR experiment.
The PCR product was purified using the QIAquick
kit from Qiagen. For direct sequencing reactions of both
strands the PRISM kit from Applied Biosystems was
used. Additionally, the PCR products were cloned using
a pUC18 (T-vector, in-house production) transformed
to an Escherichia coli strain (RRI). DNA from selected
clone medium was isolated using the CONCERT Rapid
Plasmid Purification Kit (Gibco, Germany) following
the manufacturerÕs protocol. Five to 21 (average 9)
clones were sequenced using the universal reverse and
forward primers. Sequencing reactions were run on an
Applied Biosystems 310 automatic sequencer.
2.6. Phylogeny
The cytochrome bsequence data set consisted of 20
individuals and 1140 manually aligned positions. Max-
imum likelihood (ML) analysis and bootstrap analyses
used the Linux version of PAUP* (Swofford, 2001) with
the general time-reversible model and gamma distribu-
tion of rates (GTR + G) (Rodr
ıguez et al., 1990; Yang,
1996). The model of evolution was selected by using
MrModeltest, a simplified version of Modeltest 3.06
(Nylander, 2001; Posada and Crandall, 1998). Heuristic
searches in PAUP* used TBR branch swapping on 100
random addition sequence trees, estimating all model
parameters. The bootstrap analysis (Felsenstein, 1985)
was set up to perform 100 replicates with simple addi-
tion sequence of taxa and model parameters set as es-
timated for the best tree found in the ML analysis. The
Bayesian inference analyses used MrBayes (Huelsenbeck
and Ronquist, 2001) and the same model as for ML.
Three separate MrBayes analyses starting from random
trees were performed. In each, 1,000,000 generations of
Markov Chain Monte Carlo (MCMC) were run, sam-
pling a tree every 10 generations. Majority-rule con-
sensus trees were obtained by loading sampled trees into
PAUP* after discarding trees sampled during chain
‘‘burnin’’ (1349, 1749, and 1599 trees were discarded,
respectively). The trees from the three Bayesian analyses
were identical and the posterior probabilities for clades
were almost identical. Their means are used in Fig. 3.
2.7. Divergence time estimates
A likelihood ratio test for rate constancy (Felsenstein,
1988) was performed where the likelihood of our ML tree
was compared to the likelihood of the same tree with the
constraint of a strict molecular clock. The probability for
rejecting the null hypothesis of rate constancy was
0:1>p>0:05 (v210.2632; df ¼18). Since the test did
not reject rate constancy, estimates of divergence times
for nodes were calculated using the clock-based Langley–
Fitch method with the Powell algorithm available in
SandersonÕs r8s (‘‘rates’’) program (Sanderson, 2002).
The most distant outgroup, Felis, was pruned from the
Table 2
Primer sequences (50–30)
CB8u TTTTGAGGTGCAACTGTAATC
CB8l GAAGCCTCCTCAGATTCAC
CB9u TTCCATCCATACTATACAATCAA
CB9l GAGGAGGCGGTTTTCAA
CB10u CTCCGATCTATTCCCAACAAACT
CB10l CCGCTACTAGGAATCAGAATA
CB11u GTGGCCAACCTGTAGAAC
CB11l ATGCCTGAGATGGGTATTA
CB12u CAC ACC CCC TTA TCA AAA TTA TT
CB12l TAA CTG ATG AGA AAG CGG TTA T
CB13u AAATTCTCACCGGCCTCTTTCTA
CB13l TTGGCGTGTAGGTACCGGATAA
CB14u2 CAC ATT TGC CGC GAT GTA AAT
CB14l TGG CCC CAC GGT AAG ACA TAT
CB16u CCA AAC AGC GAG GAA TGA TG
CB16l TTG GCC AAT GGT GAT GAA G
CB17u TAC TAC GGC TCC TAC ACT TTC TCA
CB17l ATG GGA TTG CTG ATA GGA GGT TG
CB19u GATTCTTTGCCTTCCACTTCAT
CB19l2 AAGGCCTAGGATATCTTTGATTGTA
CB20u2 CAGATAAAATTCCATTTCATCCATA
CB20l TGGGGAGGGGTGCTTAGA
CB 21u4 ACC CCG ATA ACT ATA CCC C
CB21l GAGGGCAGGGATAATTGCTAAG
CB22u CATACATTGGGGCCGACCT
CB22l2 ACTACTGCTAGGGCTGAGATGATA
844 J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849
tree prior to the analysis in order to obtain a non-zero
length root branch. The program settings were as fol-
lows: gamma distribution of rates; five time guesses; five
restarts. Confidence intervals (95%) for the estimated
divergence times were also computed (Cutler, 2000) in
r8s with the cutoff parameter set to 2.
An analysis of rate divergence times results in relative
age estimates for all branch points (nodes) in the tree.
In order to convert these to absolute times, it is neces-
sary to fix one node as a calibration point; this point is
therefore, in itself, not estimated by the analysis. We set
the first split of the Panthera leo lineage in our ML tree
to the date of the first appearance of P. leo fossilis in the
European fossil record (marked by an asterisk in Fig. 3).
The earliest date obtained for this appearance is 600 kya
(Garcia Garcia, 2001).
3. Results and discussion
3.1. Diagenetic measurements (Table 3)
To test the general biomolecular state of preservation
of the specimens before starting with the extensive an-
cient DNA analysis, bone samples were subjected to
three separate diagenetic screening techniques: elemental
analysis, Fourier-transform infrared spectroscopy, and
SAXS. Very little mineral alteration is evident in either
archaeological sample, as compared to the modern
values for both SF and C/P. All crystallites measured
using SAXS were determined to be plate-like (data not
shown), which is also consistent with modern unaltered
crystallites (Camacho et al., 1999). The crystallite sizes
of the archaeological samples were significantly lower
than those measured in the modern human sample, but
this smaller size of 2.8–3 nm is consistent with the size
seen in modern faunal samples (Wess and Hiller, un-
published data). In addition, very little nitrogen has
been lost from the archaeological samples, indicating a
high level of residual collagen. The lack of mineral al-
teration and high residual protein, indicate exceptional
bone preservation, suggesting that these bones are suit-
able for recovery of ancient DNA (see Table 3).
3.2. Ancient DNA analysis and authenticity
From each specimen we obtained three separate bone
samples, which were handled and analyzed by three
workers independently in two separate labs (two in
Mainz and one in Uppsala).
The mtDNA sequences derived from each bone un-
derwent multiple verifications using independent sam-
ples, extractions, amplifications, cloning, and sequence
determinations. In all cases, for all three samples the
replicated mtDNA sequences were consistent across all
Table 3
Results of diagenetic screening procedures for cave lion samples Si and Ku, compared to three modern reference samples
Sample SF C/P % N SAXS thicknesses (nm)
Cave lion (Si) 2.76 0.469 3.83 2.99
Cave lion (Ku) 2.91 0.399 3.65 2.98
Modern bear reference 2.82 0.338 4.12 2.93
Modern human reference 2.72 0.445 4.17 3.75
Modern lion reference 2.85 0.375 4.1 2.55
Fig. 3. Maximum likelihood phylogeny of the Panthera clade
(GTR + G model; ln likelihood ¼)3038.43290). The cave lion clade is
in red. Branch lengths are drawn proportional to estimated change;
scale bar 0.01 substitutions per site. Node support values are attached
by the nodes: clade probabilities (Bayesian posterior probabilities in
percent) to the left and bootstrap percentages to the right. The node
used to calibrate divergence time estimates is marked with an asterisk.
Geographical origin of lions is noted within square brackets (P. l.
bleyenberghi,krugeri, and nubica correspond to the senegalensis group;
for subspecies nomenclature, see Table 1). (For interpretation of the
references to colour in this figure legend, the reader is referred to the
web version of this paper.)
J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849 845
experiments. Five nucleotide positions (one in Uppsala
and four in Mainz), however, differed in more than one
PCR from the established consensus sequence. All were
C–T transitions and most likely due to decompositional
deamination events (Gilbert et al., 2003; Hansen et al.,
2001; Hofreiter et al., 2001a). In all cases a number of
additional PCRs was performed, and a vast majority of
sequences confirmed the original cytosine residue.
Contaminations, decompositional base modifica-
tions, nuclear insertions (Zischler et al., 1995), and,
mainly, errors in the procedural design endanger the
interpretation of ancient DNA results. Therefore, for
each specimen the authenticity of the sequence has to be
proven by various criteria (e.g., Hofreiter et al., 2001b).
The authenticity of the sequences presented here is as
ensured as possible, for the following reasons:
Several different biomolecular screening methods
showed the samples to be exceedingly well-preserved.
Extraction and PCR blank controls were always
negative.
Sequences were reproduced various times from at
least two independent extractions, and a total of at
least four independent PCR amplifications.
Overlapping PCR amplicons always produced the
same sequence.
In total 3 of the 12 PCR products (125 bp for Si and
163 bp for Ku) including 42 variable positions in Fe-
lidae were replicated in a second lab from a third
bone sample.
The obtained sequences can both be translated into
an identifiable cytochrome bprotein without non-
sense mutations.
Attempts to amplify a 474 bp amplicon using panth-
erine specific primers (CB9) failed, indicating
that no modern DNA was involved in the enzymatic
reaction.
The sequences obtained from two specimens are dif-
ferent from each other, and reproducibly showed this
individual difference.
Both sequences make sense phylogenetically.
3.3. Cave lion phylogeny
The two 1051 bp cave lion sequences differ from each
other at two base positions. Both are third codon posi-
tion silent substitutions. The South African lion refer-
ence sequence (AF384818) differs from the fossil
sequences by 40/38 silent substitutions and eight substi-
tutions that result in an amino acid change. The cave lion
sequences differ from nine undoubtedly sub-Saharan li-
ons by 47–49 bp (45–47 bp), from two Asian lions (P. leo
persica) by 50/48 bp, from a leopard (P. pardus) by 89/
87 bp, and from four different subspecies of tiger (P. ti-
gris) by 114–117 bp (112–115 bp). These results and the
complete distance matrix in Table 4 agree well with the
overview of pantherine taxonomy presented in Table 1.
We constructed a cladogram from the two cave lion
sequences and extant species of the genus Panthera
(tiger, leopard, and lion; Fig. 3). In accordance with
morphological and behavioural studies of the phyloge-
netic relationships between the extant species of the
genus Panthera, our cytochrome btree shows that the
tiger branch (subgenus Tigris) separated first from
the branch of the jaguar (not shown), the leopard, and
the lion (subgenus Panthera) (cf. Hemmer, 1978). An
earlier analysis of 358 bp of the mitochondrial 12S RNA
coding DNA and 289 bp of the cytochrome bgene is
consistent with these relationships (Janczewski et al.,
1995). The leopard and the lion represent the last species
separation within the jaguar, leopard, and lion clade
(Janczweski et al., 1995; Peters and Tonkin-Leyhausen,
1999). According to the palaeontological record, the first
divergence in the subgenus Panthera took place in the
late Middle Villafranchian at the end of the Pliocene,
about 1900 kya, with the dispersal of the stem species
out of Africa. This gave rise to the Holarctic base jaguar
population (Hemmer et al., 2001). Therefore, the split
between the subgeneric Tigris and Panthera clades can-
not have been a later event, but rather an earlier one.
Unfortunately, well-founded palaeontological dating is
not yet possible for this point (Hemmer et al., 2001).
Evolutionary rate constancy was not rejected for our
data, and clock-based estimates of divergence times were
therefore obtained. The age of the split between the
subgeneric Tigris and Panthera clades was estimated to
1428–2295 kya (95% confidence interval), and the leo-
pard–lion split to 1000–1559 kya. The latter split has
not been unequivocally dated with palaeontological
data, but our estimate is consistent with a likely Upper
Villafranchian event at the beginning of the Lower
Pleistocene.
Phylogenetic divergence within lions is marked by
their dispersal over Europe in the early Middle Pleisto-
cene, not before the Cromerian interglacial III or IV
(Garcia Garcia, 2001), i.e., not before 600 kya. From
this time on, the cave lion (spelaea group) developed in
Europe, beginning with the early Middle Pleistocene
Panthera leo fossilis and ending with the Upper Pleis-
tocene P. leo spelaea (Hemmer, 1974). Our estimate for
the more recent divergence within the leo group into the
African and Asian extant lion subgroups, the senegal-
ensis group in Africa (comprising all sub-Saharan Afri-
can lions; Hemmer, 1974, in press) and persica in Asia
(the north African Barbary lion, leo, is closer to the
latter), is 74–203 kya. This split has not been dated be-
fore using palaeontological data.
In the context of this study, we have shown that a
considerable mitochondrial genetic distance exists be-
tween these two cave lions and extant lions, one that is
much larger than the range of genetic variation seen in
living populations of lions. These results imply that our
cave lion lineages were genetically isolated from the
846 J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849
Table 4
Distance matrix of sequences used in this study
1 2 3 4 5 6 7 8 9 1011121314151617181920
1Felis
2Neofelis 0.3224
3P. leo (Botswana) 0.30831 0.28851
4P. leo (Namibia) 0.33078 0.28764 0.00104
5P. leo (Namibia) 0.30831 0.28851 0.00000 0.00104
6P. leo (Namibia) 0.30831 0.28851 0.00000 0.00104 0.00000
7P. leo (Namibia) 0.30831 0.28851 0.00000 0.00104 0.00000 0.00000
8P. leo (Natal) 0.32005 0.27911 0.00731 0.00430 0.00731 0.00731 0.00731
9P. leo (Transvaal) 0.32005 0.27911 0.00731 0.00430 0.00731 0.00731 0.00731 0.00000
10 P. leo (Kenya) 0.32005 0.27911 0.00731 0.00430 0.00731 0.00731 0.00731 0.00000 0.00000
11 P. leo (Uganda) 0.31044 0.27911 0.00635 0.00321 0.00635 0.00635 0.00635 0.00451 0.00451 0.00451
12 P. leo persica 0.35607 0.28293 0.01220 0.01164 0.01220 0.01220 0.01220 0.01004 0.01004 0.01004 0.00900
13 P. leo persica 0.35607 0.28293 0.01220 0.01164 0.01220 0.01220 0.01220 0.01004 0.01004 0.01004 0.00900 0.00000
14 P. leo spelaea 0.36026 0.26236 0.05904 0.06103 0.05904 0.05904 0.05904 0.05896 0.05896 0.05896 0.06043 0.06159 0.06159
15 P. leo spelaea 0.35443 0.26206 0.05620 0.05789 0.05620 0.05620 0.05620 0.05618 0.05618 0.05618 0.05760 0.05893 0.05893 0.00193
16 P. pardus 0.26605 0.36516 0.13970 0.13844 0.13970 0.13970 0.13970 0.13945 0.13945 0.13945 0.13701 0.13818 0.13818 0.13696 0.13299
17 P. tigris corbetti 0.29330 0.26427 0.19150 0.19435 0.19150 0.19150 0.19150 0.20602 0.20602 0.20602 0.20063 0.22154 0.22154 0.22123 0.21651 0.20798
18 P. tigris altai 0.28807 0.27977 0.18806 0.19003 0.18806 0.18806 0.18806 0.20228 0.20228 0.20228 0.19704 0.21732 0.21732 0.21726 0.21256 0.20423 0.00088
19 P. tigris sumatrae 0.27307 0.28704 0.18106 0.18410 0.18106 0.18106 0.18106 0.19481 0.19481 0.19481 0.18977 0.20889 0.20889 0.21445 0.20967 0.20164 0.00633 0.00541
20 P. tigris tigris 0.27523 0.26569 0.18258 0.18598 0.18258 0.18258 0.18258 0.18938 0.18938 0.18938 0.18451 0.20268 0.20268 0.20851 0.20376 0.19601 0.00451 0.00358 0.00358
See Table 1 for GenBank accession numbers. Distances are corrected using the same model of evolution as in the maximum likelihood analysis. A general time-reversible model was used, with
rates assumed to follow gamma distribution with a shape parameter ¼0.244; this was estimated for the best maximum likelihood tree found. Numbers 3–7 are Panthera leo bleyenberghi, 8 and 9 are
P. leo krugeri, and 10 and 11 are P. leo nubica.
J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849 847
ancestors of modern Asian and African lions from the
early Middle Pleistocene onwards, and went extinct
without contributing mitochondrial DNA to extant
lineages. The question of whether the cave lion popu-
lation of Europe and the extant lion populations of
Africa and Asia should be recognized as different species
may be a matter of convention. In our tree, the cave lion
clade is a sister to the extant lions, which means that the
cave lions may be excluded from or included within the
species P. leo. However, the maximum possible number
of lion generations since the 600 ky split in comparison
with other pantherine species argues for the single spe-
cies nomenclature (Hemmer, in press).
If it is assumed that the two cave lion sequences are
representative for the European cave lions of that time,
the very good support for both this clade (100% boot-
strap as well as posterior probability) and for the clade
of extant lions indicates that European cave lion popu-
lations may have left no mitochondrial descendants,
whereas the mitochondrial genes of their contempora-
neous African and Asian relatives survive in extant lion
populations. It remains to be seen if the considerable
sequence divergence between the clades (nearly 5%) will
remain if the sample of fossil and extant specimens is
increased. Further studies are needed to show if genetic
changes or characteristics, as well as ecological factors,
may have played a role in the extinction of cave lion
populations in Europe at the end of the Pleistocene. This
study represents another successful use of modern ge-
netic and phylogenetic techniques to investigate long-
standing palaeontological questions, and it is our hope
that such studies continue to shed light on issues of
evolutionary descent and speciation that cannot be as
well elucidated by other means.
Acknowledgments
We thank Robert Darga, Naturkunde- und Mam-
mutmuseum Siegsdorf, and Hugo Oberkofler, Museum
Kufstein for providing cave lion samples. We are in-
debted to Sabine Hilsberg and Bert Geyer from the Zoo
in Frankfurt/Main for providing blood samples, and
Sabine Moeller-Rieker and Ursula Arndt for assistance.
J.H. gratefully acknowledges funding from the Well-
come Trust Programme in Bioarchaeology. We thank
Prof. Nicholas Conard for providing Fig. 1.
References
Baryshnikov, G.F., Boeskorov, G., 2001. The Pleistocene cave lion,
Panthera spelaea (Carnivora, Felidae) from Yakutia, Russia.
Cranium 18, 7–24.
Camacho, N.P., Rinnerthaler, S., Paschalis, E.P., Mendelsohn, R.,
Boskey, A.L., Fratzl, P., 1999. Complementary information on
bone ultrastructure from scanning small angle X-ray scattering and
Fourier-transform infrared microspectroscopy. Bone 25, 287–293.
Cutler, D.J., 2000. Estimating divergence times in the presence of an
overdispersed molecular clock. Mol. Biol. Evol. 17, 1647–1660.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach
using bootstrap. Evolution 39, 783–791.
Felsenstein, J., 1988. Phylogenies from molecular sequences: inference
and reliability. Annu. Rev. Genet. 22, 521–565.
Garcia Garcia, N., 2001. Los Carnivorors de los Yacimientos
Pleistocenos de la Sierra de Atapuerca. Thesis Doctoral.
Gilbert, M.T., Hansen, A.J., Willerslev, E., Rudbeck, L., Barnes, I.,
Lynnerup, N., Cooper, A., 2003. Characterization of genetic
miscoding lesions caused by postmortem damage. Am. J. Hum.
Genet. 72, 48–61.
Groiss, J.Th., 1996. Der H
ohlentiger Panthera tigris spelaea (Gold-
fuss). Neves Jahrb. Geol. Pal
aont. Abh. 7, 399–414.
Hansen, A.J., Willerslev, E., Wiuf, C., Mourier, T., Arctander, P.,
2001. Statistical evidence for miscoding lesions in ancient DNA
templates. Mol. Biol. Evol. 18, 262–265.
Hedges, R.E.M., Millard, A.R., Pike, A.W.G., 1995. Measurements
and relationships of diagenetic alteration of bone from three
archaeological sites. J. Archaeol. Sci. 22, 201–209.
Hemmer, H., 1974. Untersuchungen zur Stammesgeschichte der
Pantherkatzen (Pantherinae), Teil III: Zur Artgeschichte des
L
owen Panthera (Panthera) leo (Linnaeus 1758). Ver
offentlichun-
gen der Zoologischen Staatssammlung M
unchen 17, 167–280.
Hemmer, H., 1978. The evolutionary systematics of living Felidae:
present status and current problems. Carnivore 1, 71–79.
Hemmer, H., in press. Pleistoz
ane Katzen Europaseine
Ubersicht.
Cranium.
Hemmer, H., Kahlke, R.-D., Vekua, A.K., 2001. The Jaguar-Panthera
onca gombaszoegensis (Kretzoi, 1938) (Carnivora: Felidae) in the
late Lower Pleistocene of Akhalkalaki (South Georgie; Transcauc-
asia) and its evolutionary and ecological significance. Geobios 34,
475–486.
Hofreiter, M., Jaenicke, V., Serre, D., Haeseler, A.A., P
a
abo, S.,
2001a. DNA sequences from multiple amplifications reveal arti-
facts induced by cytosine deamination in ancient DNA. Nucleic
Acids Res. 29, 4793–4799.
Hofreiter, M., Serre, D., Poinar, H.N., Kuch, M., P
a
abo, S., 2001b.
Ancient DNA. Nat. Rev. Genet. 2, 353–359.
Huelsenbeck, J.P., Ronquist, F., 2001. A program for the Bayesian
inference phylogeny, version 2.01.
Janczewski, D.N., Modi, W.S., Stephens, J.C., OÕBrien, S.J., 1995.
Molecular evolution of mitochondrial 12S RNA and cytochrome b
sequences in the pantherine lineage of Felidae. Mol. Biol. Evol. 12,
690–707.
Kurt
en, B., 1968. Pleistocene Mammals of Europe. Weidenfeld and
Nicolson, London.
Lorblanchet, M., 1995. Les Grottes Orn
ees de la Prehistoire. Errance,
Paris.
Nylander, J.A.A., 2001. MrModeltest, Computer program, version
1.1b. Uppsala University.
Peters, G., Tonkin-Leyhausen, B.A., 1999. Evolution of acoustic
communication signals of mammals: friendly close-range vocaliza-
tions in Felidae (Carnivora). J. Mamm. Evol. 6, 129–159.
Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of
DNA substitution. Bioinformatics 14, 817–818.
Rodr
ıguez, F., Oliver, J.L., Marin, A., Medina, J.R., 1990. The general
stochastic model of nucleotide substitution. J. Theor. Biol. 142,
485–501.
Rosendahl, W., Darga, R., 2004. Homo sapiens neanderthalensis
et Panthera leo spelaeadu nouveau
a propos du site de Siegsdorf
(Chiemgau), Bavi
ere/Allemagne. Rev. Palaeobiol. 3, 2.
Sanderson, M.J., 2002. Analysis of rates (r8s) of evolution (and other
stuff), Computer program, version 1.5. University of California,
Davis.
848 J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849
Schlosser, M., 1910. Die B
aren-oder Tischoferh
ohle im Kaisertal
bei Kufstein. Abh. Math-physik. K
onigl. Bayr. Akad. Wiss. 24,
385–506.
Swofford, D.L., 2001. PAUP*. Phylogenetic analysis using parsimony
and other methods, version 4.0.
Termine, J.D., Posner, A.S., 1966. Infra-red determination of the
percentage of crystallinity in apatitic calcium phosphates. Nature
211, 268–270.
Turner, A., Ant
on, M., 1997. The Big Cats and their Fossil Relatives.
Columbia University Press, New York.
Weiner, S., Bar-Yosef, O., 1990. States of preservation of bones from
prehistoric sites in the Near East: a survey. J. Archaeol. Sci. 17, 196.
Wright, L.E., Schwarcz, H.P., 1996. Infrared and isotopic evidence for
diagenesis of bone apatite at Dos Pilas Guatamala: palaeodietary
implications. J. Archaeol. Sci. 23, 933–944.
Yang, Z., 1996. Among-site variation and its impact on phylogenetic
analyses. TREE 11, 367–371.
Zischler, H., H
oss, M., Handt, O., von Haeseler, A., P
a
abo, S.,
Goudsimt, J., van der Kuyl, A.C., 1995. Detecting dinosaur DNA.
Science 268, 1192–1193.
J. Burger et al. / Molecular Phylogenetics and Evolution 30 (2004) 841–849 849
... 650 ka ;Sala 1990). Recent paleontological works have pointed to eastern Africa as the origin of lion dispersion around 800 ka (Argant 1991;Burger et al. 2004;Argant et al. 2007;Sabol 2011). However, the presence of lions in the latest Early Pleistocene of Iberia (i.e., Vallparadís Section and Cueva Victoria, Spain) suggests that the complex history of European lions may have started earlier (Madurell-Malapeira et al. 2014. ...
... Recent DNA studies reveal that the cave lion putatively dispersed over Europe ca. 600 ka after becoming isolated from Asian and African populations (Burger et al. 2004; Barnett et al. 2009) and diverged from modern lions around 1.89 Ma (Barnett et al. 2016), becoming a clear monophyletic outgroup (Barnett et al. 2016;deManuel et al. 2020). Other more recent studies have supported the existence of three different clades of cave lions that diverged from extant species ca. ...
Article
Full-text available
Late Pleistocene cave lions are one of the most iconic species of Northern Hemisphere Quaternary taphocoenoses. Despite their often-scarce record in cave environments, their ubiquitous distribution across Eurasia and North America assemblages attests to their position as top ice-age predators. Nevertheless, the origins of these former large felids, its distribution during the Middle Pleistocene, and its paleoecology during co- existence with the scimitar-toothed cat Homotherium remain debated. Here we describe for the first time an abundant collection of large-sized and stout felid remains from the recently discovered site of so-called Grotte de la Carrière in Eastern Pyrenees. With an estimated age corresponding to MIS 9. Our results highlight the larger size of Middle Pleistocene lions compared to Late Pleistocene ones and a trend of decreasing in size previously stated by other authors. Grotte de la Carrière steppe lions have similar morphological and biometrical parameters to those of other samples from MIS 11-9, being larger and stouter than younger latest Middle Pleistocene-Late Pleistocene forms and slightly smaller than older MIS 15-12 forms.
... More recent investigations on its skull and tooth morphology argue for a division on species level (Baryshnikov & Boeskorov, 2001;Sotnikova & Nikolskiy, 2006). Studies based on mitochondrial DNA suggest genetic isolation of European Pleistocene populations from modern lions (Panthera leo) (Burger et al., 2004;Barnett et al., 2009;Ersmark et al., 2015). Male individuals miss the mane in Late Pleistocene cave art, which seems to confirm species diagnostic differences in modern and Ice Age lions. ...
... The Alpes-Maritimes, France and neighbouring Liguria, Italy witness again a frequent occurrence of lions from the Last Interglacial onwards, sometimes with unclear chronological position of the finds (see Bonifay, 1971;Valensi andPsathi, 2004, Crégut-Bonnoure, 2011).It seems, lions were more frequent in this region during end of the Middle Pleistocene and beginning of the Late Pleistocene than during MIS 3 (Crégut-Bonnoure, 2011) So far, direct radiocarbon dates for the cave lion from the Alpine area have been available from five sites (see Stuart & Lister, 2011). A pelvic fragment from Tischoferhöhle, Tyrol gave an age of 31,890+/-300 BP and a bone from the Siegsdorf skeleton, Bavaria resulted at 47,180+1,190/-1,040 BP (Burger et al., 2004). A tibia from Gamssulzenhöhle, Upper Austria confirms the cave lion around 49,900+/-1,500 BP in the Northern Calcareous (1) Mottl, 1949aMottl, : 108, 1953Thenius, 1960: 42 Bona, 2006 Alps (Barnett et al., 2009). ...
Article
Full-text available
Based on the Late Pleistocene cave lion distribution in the Alps (especially in the Eastern Alpine region and Eastern Swiss Alps), a compilation of records and metrical data from the Eastern Alps is given for the first time. The study yields data on the frequency of lion occurrence and its palaeobiological implications, mainly the possible prey pattern of Alpine lions. The possible size differences between the Eastern Alpine population and lions outside the Alps are also solved on the basis of metrical data compilation, which are analysed by two-dimensional plots and the LSI approach. The later approach allows to include also single specimen for a large comparison of populations as is frequently used in archaezoological context. For the better understanding of palaeobiology and metrical variability of Late Pleistocene Alpine lions, further approaches are needed.
... Panthera leo atrox f Lion Neartic Morgan and Seymour (1997), Barnet et al. (2006Barnet et al. ( , 2009, Kurtén (1965Kurtén ( , 1985, Kurtén and Anderson (1980), Yamaguchi et al. Paleartic Barnett et al. (2006Barnett et al. ( , 2009, Baryshnikov and Boeskorov (2001), Burger et al. (2004), Kurtén (1965Kurtén ( , 1985, Kurtén and Anderson (1980) Geraads (1980) Content courtesy of Springer Nature, terms of use apply. Rights reserved. ...
Article
Full-text available
Extant felids are hyper-carnivorous predators that originated in Asia c. 11 Mya and diversified in 8 distinct lineages, with 41 species surviving to the Recent. These species occupy almost every terrestrial habitat available in the four continental land masses they occupy and exhibit morphological and behavioral specializations to various locomotor styles and hunting modes. Today, distinct felid ensembles inhabit each continent and major biogeographic region. How the differential structuring of these ensembles was generated, and which evolutionary processes shaped these differences across ensembles, are key emerging questions. Using multivariate statistics, we analyzed a large dataset of 31 cranial and 92 postcranial linear variables describing shape and functional proxies of the entire skeleton of extant felids. We statistically demonstrate the existence of nine felid morphotypes at the global scale, whose occurrence is characteristic of different continental or biogeographic ensembles. Phylogenetically explicit analyses show that morphotypes from different felid lineages converged in different continents, but still ensembles remain distinct due to the fact that various morphotypes are missing in several of those ensembles. However, fossil evidence suggests that most of these missing morphotypes were represented by species from those territories that went extinct during the Quaternary. Furthermore, reconstructing the hypothetical felid ensembles before Pleistocene extinctions rendered the continental felid faunas remarkably more similar to each other than they presently are, leaving their remaining, relatively minor differences to outstanding geographic singularities of each continental land mass.
... The copyright holder for this preprint this version posted October 7, 2020. ; https://doi.org/10.1101/2020.10.06.328021 doi: bioRxiv preprint carried out on mithochondrial DNA of Panthera spelaea (Barnett, et al., 2016, Joachim, et al., 2004, Ma and Wang, 2015. ...
Preprint
The ancient preserved molecules offer the opportunity to gain a better knowledge on the biological past. In recent years, bones proteomics has become an attractive method to study the animal biological origin, extinct species and species evolution as an alternative to DNA analysis which is limited by DNA amplification present in ancient samples and its contamination. However, the development of a proteomic workflow remains a challenge. The analysis of fossils must consume a low quantity of material to avoid damaging the samples. Another difficulty is the absence of genomic data for most of the extinct species. In this study, a proteomic methodology was applied to mammalian bones of 130,000 years old from the earlier Upper Pleistocene site of Scladina Cave (Belgium). Starting from 5 milligram samples, our results show a large majority of detected peptides matching collagen I alpha 1 and alpha 2 proteins with a sequence coverage up to 60%. Using sequence homology with modern sequences, a biological classification was successfully achieved and the associated taxonomic ranks to each bone were identified consistently with the information gained from osteomorphological studies and palaeoenvironmental and palaeodietary data. Among the taxa identified are the Felidae family, Bovinae subfamily, Elephantidae family and the Ursus genus. Amino acid substitutions on the collagens were identified providing new information on extinct species sequences and also helping in taxonomy-based clustering. Considering samples with no osteomorphological information, such as two bone retouchers, proteomics successfully identified the bovidae and ursidae families providing new information to the paleontologists on these objects. Combining osteomorphology studies and amino acid variations identified by proteomics, one retoucher was identified to be potentially from the Ursus spelaeus species.
... Recorded under different specific attributions, it was one of the top predators of the Holarctic region since their first immigration wave coming from eastern Africa ca. 700ka (Burger et al., 2004;Argant, 2007;Sabol 2011). This huge lion spread up to Central and Eastern Europe during Middle Pleistocene and dispersed throughout European biotopes (Turner 2009 The field surveys at Grotte de la Carrière unearthed enough morphological and taxonomical informative material to tentatively attribute the studied specimens to P. fossilis (Madurell-Malapeira and Llenas, 2019;Prat-Vericat et al., 2020). ...
... Im Hochgebirge, wie dem Tennengebirge, wirken Höhlenlöwen aufgrund des heutigen Verbreitungsgebietes ihrer rezenten Verwandten besonders exotisch, weshalb ihr Vorkommen meist mit paläoklimatologischen Fragen verknüpft wurde. Schon bei den ersten Aufsammlungen in der Bärenfalle konnten einige Fossilreste des Höhlenlöwen, darunter eine vollständig erhaltene Mandibula und zwei Humerusfragmente, gefunden und beschreiben werden (Tichy 1985 (Burger et al. 2004, Barnett et al. 2009, Ersmark et al. 2015. Nach neuesten Untersuchungen ist der Höhlenlöwe als eigene Art Panthera spelaea (Goldfuss 1810) zu bezeichnen (Barnett et al. 2016, Stanton et al. 2020). ...
Article
Full-text available
The Upper Pleistocene cave fauna of the Bärenfalle in the Tennengebirge (Salzburg, Austria). Results from the research campaign 2015-2017. The fossil material from the excavations in 2015 and 2016 in the Bärenfalle as well from the former excavations that are stored in the Museum Burg Golling and the Haus der Natur Salzburg were metrically and morphologically examined and inventoried. The presumptive taxonomical classification of the cave bears was confirmed. According to radiocarbon dating the finds from the Bärenfalle belong in the Middle Würmian (36.600 BP and older). Furthermore, the coexistence of cave bears and cave lions in a high alpine cave is discussed. A digital 3D-model of the cave and the analyses of the sediments complete the results of the research project „Bärenfalle“.
... The ancestors of cave lions diverged from African lions prior to 600 ka (cf. Argant & Brugal, 2017;Burger et al., 2004), precluding their experiencing the increased dangerousness of carcass competition with archaic and modern humans in Africa. ...
Chapter
Large felid predators have posed significant threats to various primate lineages since Miocene times. In the case of leopards (Panthera pardus), natural selection has fostered the ability to recognize these cats in a number of nonhuman primates. This perceptual ability is maintained in habitats where these predators are no longer present. In a similar domain, the hominin fossil record provides evidence of a long period of exposure to felid predators. Thus, it is reasonable to hypothesize that natural selection engendered some evolved felid-recognition abilities in human ancestors. As explorations of this potential, experimental studies show that children and adults are capable detectors of lion images embedded in arrays of nondangerous antelope. In this chapter, the perceptual aspects of lions are investigated further by reviewing the neurobiological underpinnings of face recognition and shape and texture-processing which include the contextual associations that promote object recognition. Cave lions (Panthera spelaea) were an important component of cave drawings and mobiliary sculptures of Aurignacian hunter–gatherers in the early Upper Paleolithic of Europe. Some features of cave lions, such as facial markings and body contours are portrayed in drawings and figurines with anatomical realism, suggesting a level of visual salience that might be indicative of an evolutionary influence.
Article
Full-text available
All skeletal specimens of the North American dinosaur Tyrannosaurus and a number of trace fossils have been attributed to the single species: T. rex. Although an unusual degree of variation in skeletal robustness among specimens and variability in anterior dentary tooth form have been noted, the possibility of sibling species within the genus Tyrannosaurus has never been tested in depth in both anatomical and stratigraphic terms. New analysis, based on a dataset of over three dozen specimens, finds that Tyrannosaurus specimens exhibit such a remarkable degree of proportional variations, distributed at different stratigraphic levels, that the pattern favors multiple species at least partly separated by time; ontogenetic and sexual causes being less consistent with the data. Variation in dentary incisiform counts correlate with skeletal robusticity and also appear to change over time. Based on the current evidence, three morphotypes are demonstrated, and two additional species of Tyrannosaurus are diagnosed and named. One robust species with two small incisors in each dentary appears to have been present initially, followed by two contemporaneous species (one robust and another gracile) both of which had one small incisor in each dentary, suggesting both anagenesis and cladogenesis occurred. The geological/geographic forces underlying the evolution of multiple Tyrannosaurus species are examined. A discussion of the issues involving the recognition and designation of multiple morphotypes/species within dinosaur genera is included.
Book
Full-text available
This richly illustrated book gives a detailed account of excavations that extended over ten years at Stanton Harcourt, Oxfordshire, following the discovery of a mammoth tusk in 1989. More than 1500 vertebrate fossils and a wealth of other biological material were recorded and recovered, along with 36 stone artefacts attributable to Neanderthals. Today the Upper Thames Valley is a region of green pastures and well-managed farmland, interspersed with pretty villages and intersected by a meandering river. The discovery in 1989 of a mammoth tusk in river gravels at Stanton Harcourt, Oxfordshire, revealed the very different ancient past of this landscape. Here, some 200,000 years ago, mammoths, straight-tusked elephants, lions, and other animals roamed across grasslands with scattered trees, occasionally disturbed by small bands of Neanderthals. The pit where the tusk was discovered, destined to become a waste disposal site, provided a rare opportunity to conduct intensive excavations that extended over a period of 10 years. This work resulted in the recording and recovery of more than 1500 vertebrate fossils and an abundance of other biological material, including insects, molluscs, and plant remains, together with 36 stone artefacts attributable to Neanderthals. The well-preserved plant remains include leaves, nuts, twigs and large oak logs. Vertebrate remains notably include the most comprehensive known assemblage of a distinctive small form of the steppe mammoth, Mammuthus trogontherii, that is characteristic of an interglacial period equated with marine isotope stage 7 (MIS 7). Richly illustrated throughout, Mammoths and Neanderthals in the Thames Valley offers a detailed account of all these finds and will be of interest to Quaternary specialists and students alike.
Article
A perfectly preserved left felid hemimandible has been found in fluvial deposits of the Po River near Cremona (Northern Italy). The fossil, found in allochthonous position within an alluvial bar, corresponding in morphology and size at the hemimandible of modern and fossil lions. The bone, in excellent conditions, is characterized by the presence of all the teeth and shows a slight erosion of the condyle and angular process indicating a very limited transport (rafting). Based on the comparison with a large dataset of morphometric measurements of cave lion and fossil leopard hemimandibles, the studied fossil is classified as a subadult female of the chronosubspecies Panthera spelaea intermedia. The mammalian fossil record from Po River consists predominantly of large herbivores Palaeoloxodon antiquus, Stephanorhinus kirchbergensis, Bison priscus, Megaloceros giganteus, Mammuthus primigenius, Alces alces, Cervus elaphus, some carnivores like Panthera cf. pardus, Crocuta crocuta, Ursus arctos, Canis lupus, Vulpes vulpes and primates such as Homo neanderthalensis and H. sapiens. The species composition indicates a mixing of different faunal assemblages from interglacial and glacial periods of the Late Pleistocene.
Article
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
The systematic status on the Quaternary "cave lion" from Franconian caves is controversially discussed. Studies of brain casts show that this species belongs to the tiger genus.
Article
The site of Siegsdort yielded very well preserved bone remains, especially a nearly complete skeletton of mammoth and an incomplete skeletton of cave lion. Cut marks were identified in 1992 on some bones of the lion, which is now dated by 14C at 47.180+1190/-1040 years BP. This is the first evidence of the presence of Homo sapiens neanderthalensis in the SE of the german Prealps an the oldest dated one for the whole german Prealps.
Book
— We studied sequence variation in 16S rDNA in 204 individuals from 37 populations of the land snail Candidula unifasciata (Poiret 1801) across the core species range in France, Switzerland, and Germany. Phylogeographic, nested clade, and coalescence analyses were used to elucidate the species evolutionary history. The study revealed the presence of two major evolutionary lineages that evolved in separate refuges in southeast France as result of previous fragmentation during the Pleistocene. Applying a recent extension of the nested clade analysis (Templeton 2001), we inferred that range expansions along river valleys in independent corridors to the north led eventually to a secondary contact zone of the major clades around the Geneva Basin. There is evidence supporting the idea that the formation of the secondary contact zone and the colonization of Germany might be postglacial events. The phylogeographic history inferred for C. unifasciata differs from general biogeographic patterns of postglacial colonization previously identified for other taxa, and it might represent a common model for species with restricted dispersal.