The Adamantane-Derived Bananins Are Potent Inhibitors of the Helicase Activities and Replication of SARS Coronavirus

Article (PDF Available)inCell Chemical Biology 12(3):303-11 · April 2005with48 Reads
DOI: 10.1016/j.chembiol.2005.01.006 · Source: PubMed
Abstract
Bananins are a class of antiviral compounds with a unique structural signature incorporating a trioxa-adamantane moiety covalently bound to a pyridoxal derivative. Six members of this class of compounds: bananin, iodobananin, vanillinbananin, ansabananin, eubananin, and adeninobananin were synthesized and tested as inhibitors of the SARS Coronavirus (SCV) helicase. Bananin, iodobananin, vanillinbananin, and eubananin were effective inhibitors of the ATPase activity of the SCV helicase with IC50 values in the range 0.5-3 microM. A similar trend, though at slightly higher inhibitor concentrations, was observed for inhibition of the helicase activities, using a FRET-based fluorescent assay. In a cell culture system of SCV, bananin exhibited an EC50 of less than 10 microM and a CC50 of over 300 microM. Kinetics of inhibition are consistent with bananin inhibiting an intracellular process or processes involved in SCV replication.
Chemistry & Biology, Vol. 12, 303–311, March, 2005, ©2005 Elsevier Ltd All rights reserved. DOI 10.1016/j.chembiol.2005.01.006
The Adamantane-Derived Bananins Are Potent
Inhibitors of the Helicase Activities
and Replication of SARS Coronavirus
Julian A. Tanner,
1,6
Bo-Jian Zheng,
2,6
Jie Zhou,
2
ment of Parkinson’s disease [4]. Other drugs include
rimantadine (against influenza A) [5], tromantadine
Rory M. Watt,
1,3
Jie-Qing Jiang,
1
Kin-Ling Wong,
2
(against herpes simplex virus), [6] and memantine
Yong-Ping Lin,
2
Lin-Yu Lu,
1
Ming-Liang He,
4
(N-methyl-D-aspartate [NMDA] receptor antagonist) [7].
Hsiang-Fu Kung,
4
Andreas J. Kesel,
5,
*
In order to add potential cytoprotective functionality [8],
and Jian-Dong Huang
1,
*
oligo-oxa-adamantanes have recently been conjugated
1
Department of Biochemistry
to vitamin B6 (pyridoxal) to create a new class of ada-
2
Department of Microbiology
mantanes—the bananins (Figure 1)[9]. We have synthe-
3
Department of Chemistry and
sized six bananin derivatives—bananin (BAN), iodoba-
Open Laboratory of Chemical Biology
nanin (IBN), adeninobananin (ADN), vanillinbananin (VBN),
University of Hong Kong, Pokfulam
eubananin (EUB), and ansabananin (ABN). The synthe-
Hong Kong, China
sis of bananin was described [9], the synthesis of IBN
4
Center for Emerging Infectious Diseases
and ADN will be reported elsewhere (A.J.K., submitted),
Faculty of Medicine
and the final three are described in this report.
The Chinese University of Hong Kong
Severe acute respiratory syndrome (SARS) is caused
Hong Kong, China
by infection with the SARS coronavirus (SCV) [10–12].
5
München, Germany
SCV was rapidly sequenced following its identification
[13, 14], leading to the recognition of a number of pos-
sible drug targets. Although treatment with ribavirin and
corticosteroids has been shown to have a slight posi-
Summary
tive effect [15], side-effects [16] and lack of activity of
ribavirin in cell culture [17] highlight the need for more
Bananins are a class of antiviral compounds with a
effective treatments. Most recent anti-SCV drug devel-
unique structural signature incorporating a trioxa-
opment has targeted the viral main protease, also
adamantane moiety covalently bound to a pyridoxal
called the 3CL protease, and following an initial crystal
derivative. Six members of this class of compounds:
structure [18], a structure together with inhibitors was
bananin, iodobananin, vanillinbananin, ansabananin,
solved [19]. Other classes of boronic-acid-based prote-
eubananin, and adeninobananin were synthesized and
ase inhibitors have also been identified [20], and large-
tested as inhibitors of the SARS Coronavirus (SCV)
scale screens have identified SCV inhibitors effective
helicase. Bananin, iodobananin, vanillinbananin, and
against the protease [21]. We and collaborators have
eubananin were effective inhibitors of the ATPase ac-
also recently identified inhibitors of the SCV helicase,
tivity of the SCV helicase with IC
50
values in the range
the protease and spike-mediated viral entry by a chem-
0.5–3 M. A similar trend, though at slightly higher
ical genetics approach [22]. In this paper we focus
inhibitor concentrations, was observed for inhibition
specifically on the SCV NTPase/helicase. Drugs target-
of the helicase activities, using a FRET-based fluores-
ing viral helicases have had marked success in animal
cent assay. In a cell culture system of SCV, bananin
models of herpes simplex virus [23, 24], and there has
exhibited an EC
50
of less than 10 M and a CC
50
of
been progress in targeting the hepatatis C virus heli-
over 300 M. Kinetics of inhibition are consistent with
case [25]. We have previously cloned, purified, and per-
bananin inhibiting an intracellular process or pro-
formed an initial biochemical characterization of the
cesses involved in SCV replication.
SCV helicase [26]; our results showed that the helicase
exhibited strict 5# to 3# polarity, consistent with con-
Introduction
temporary reports from another group [27]. It has also
been shown recently that the SCV helicase possesses
Adamantanes, formally designated tricyclo[3.3.1.1]
an RNA 5#-triphosphatase activity that may be involved
decanes, are structurally unusual compounds where
in capping viral RNA [28].
four cyclohexane rings are fused to each other in a par-
The SCV helicase consists of three major domains—
ticularly strain-free, all chair conformation. Oligo-oxa-
a putative N-terminal metal binding domain (MBD), a
adamantanes contain oxygens in place of methylene
hinge domain, and an NTPase/helicase domain. It is
linkages within the structure and play a variety of roles
clear from previous work on another member of the Ni-
in nature; from the infamous neurotoxin from the puffer
dovirales order, equine arterivirus (EAV), that the metal
fish tora fugu, tetrodotoxin (TTX) (Figure 1)[1], to plant
binding domain is essential to viral viability [29, 30]—
natural product steroids such as daigremontianin [2].
this is also likely to be the case for closely related SCV.
Not all adamantane derivatives are extremely toxic, and
In this paper, we investigate the effects of the bananin
many synthetic derivatives such as amantadine are
series of compounds on both the ATPase and helicase
used clinically (Figure 1)[3]. Amantadine is used as an
activities of the SCV helicase, and also test bananin
antiviral agent [3], and as a muscle relaxant in the treat-
against SCV in cell culture. We find that bananin and
three of its derivatives are potent inhibitors of both the
ATPase and helicase activities of the SCV helicase, and
*Correspondence: andreas.kesel@t-online.de (A.J.K.); jdhuang@hkucc.
that bananin inhibits SCV replication at a concentration
hku.hk (J.-D.H.)
6
These authors contributed equally to this work.
significantly below that at which it is toxic to the cell.
Chemistry & Biology
304
Figure 1. Chemical Stuctures of the Six Syn-
thetic Bananin Derivatives (Bananin, Iodoba-
nanin, Adeninobananin, Vanillinbananin, Eu-
bananin, and Ansabananin), the Anti-Influenza
and Anti-Parkinson’s Drug Amantadine, and
the Fugu Fish Toxin Tetrodotoxin
Further cell culture studies suggest that bananin inhib- our knowledge, an array of completely new adaman-
tane derivatives, which may be easily diversified by re-its intracellular activities mechanistically involved with
key viral processes, as opposed to the viral entry step. acting various aromatic aldehydes with phloroglucinol.
These results are consistent with this class of drugs
targeting the SCV helicase within the cell. Inhibition of SCV Enzymatic Activity
We have previously developed a colorimetric assay to
measure the NTPase activity of the SCV helicase in 96-Results
well plates, in a high throughput format [26, 32, 33]. In
this discontinuous colorimetric assay using malachiteSynthesis of Bananin and Its Derivatives
The bananins were synthesized by the reaction of green and ammonium molybdate, released phosphate
is quantified after a 5 min reaction period, observed atphloroglucinol (most likely in its triketo tautomeric form)
with aromatic aldehydes, catalyzed by hydrochloric a wavelength of 630 nm. Oligo-dT
24
was included in the
assay at a saturating concentration of 200 nM, to mimicacid or sodium hydroxide in aqueous solution [9]. Gen-
erally, acidic catalysis was used due to the degradation the nucleic acid-stimulated NTPase activity of the SCV
helicase. Potential inhibitors of the ATPase reactionof pyridoxal under highly basic conditions. Alkaline ca-
talysis was used for reaction with aromatic aldehydes would be expected to reduce the amount of phosphate
released during the reaction, reflected in a decrease insuch as vanillin. Bananin synthesis is driven by the cre-
ation of the highly symmetric trioxa-adamantane-triol the measured absorbance at 630 nm.
We first checked whether the bananin compounds(TAT) cage system. The prototypical compound of the
TAT series, the vitamin B
6
-derived bananin (BAN) or were able to inhibit the dT
24
-stimulated ATPase activity
of the SCV helicase. Controls were carried out to en-1-[3-hydroxy-5-(hydroxymethyl)-2-methyl-4-pyridinyl]-
2,8,9-trioxaadamantane-3,5,7-triol, can be iodinated sure that the bananin compounds themselves did not
affect the phosphate measurement assay. Reactionswith subsequent oxidation to iodobananin (6#-iodoba-
nanin 5#-carboxylic acid, IBN). The iodine in IBN can be were carried out in the presence of various concentra-
tions of the six bananin derivatives and the results werereplaced by various substituents as exemplified by the
synthesis of adeninobananin (6#-adeninobananin 5#- plotted and fitted to a simple model (Figure 2A). We
also checked that under our reaction conditions, wecarboxylic acid hydrochloride, ADN) using an activated
adenine nucleobase derivative. Interestingly, BAN is were making measurements within the linear region
(Figure S1).susceptible to Michael addition with the natural pro-
duct eugenol, isolated from the essential oil of cloves Our results showed that the parent compound ba-
nanin inhibited the ATPase activity of the SCV helicase(Syzygium aromaticum). This NaOH-catalyzed addition
leads to eugenolbananin (eubananin, EUB), which can with an
ATPase
IC
50
value of 2.3 M (IC
50
values shown
in Figure 4C). Iodobananin and vanillinbananin exhib-be transformed by cyclic hemiketal condensation into
the ansa-compound ansabananin (ABN), inspired by ited the strongest inhibition, with
ATPase
IC
50
values of
0.54 and 0.68 M, respectively. Inhibition by vanillinba-ansamycins such as rifamycin and geldanamycin [31].
In the aromatic aldehyde series, vanillin was reacted nanin indicates that the presence of a six-membered
nitrogen heterocycle is not absolutely essential for in-with phloroglucinol to yield vanillinbananin (VBN) or
1-(4-hydroxy-3-methoxyphenyl)-2,8,9-trioxaadaman- hibitory activity. Eubananin showed similar inhibitory
activity to bananin itself with an
ATPase
IC
50
of 2.8 M.tane-3,5,7-triol. It is expected that numerous naturally
occurring aldehydes can be introduced to form the cor- Interestingly, ansabananin was a weak inhibitor, with an
ATPase
IC
50
of 51 M, while adeninobananin did not showresponding TATs with phloroglucinol in 3.33 M aqueous
NaOH. The bananin group of compounds represents, to any inhibitory activity at all. These results suggest that
Bananins As Inhibitors of the SARS Coronavirus
305
are the double reciprocal Lineweaver Burke plots for
the data in Figures 3A and 3C. In both cases, as the
V
max
was significantly decreased in the presence of the
inhibitor, but the K
M
changed little, this indicated that
bananin was acting as a noncompetitive inhibitor of the
ATPase activity of the SCV helicase with respect to
both ATP and nucleic acid. This suggests that bananin
inhibits by binding at a site distinct from the ATP and
nucleic acid binding sites.
Building on this foundation, we next tested the anti-
helicase activities of these compounds. We used a
newly developed fluorimetric assay based on the very
strong fluorescence resonance energy transfer (FRET)
from the fluorophore Cy3 to the quencher Black Hole
Quencher 2 (BHQ2). A similar approach has been out-
lined very recently in assaying the hepatitis C virus
(HCV) helicase, a 3# to 5# helicase [34]. However, as we
have recently shown that the SCV helicase holds strict
5# to 3# directionality [26], we designed a system with
a5#-oligo(dT) overhang. The principle behind this new
assay is outlined in Figure 4A. There is a Cy3 fluoro-
phore at the 3# end of one of the oligomers of the du-
plex, in close proximity to a BHQ2 quencher at the 5#
end of the other oligomer. When the two oligomers are
in very close proximity (i.e., when the two oligomers
are annealed), then the Cy3 fluorescence is strongly
quenched by the FRET effect. After the duplex has
been unwound by the SCV helicase, then the Cy3 fluo-
rescence is no longer quenched, and a dramatic
increase in the fluorescence may be observed. To en-
sure that the primers do not reanneal, a second capture
primer is included in the reaction. This is identical to the
BHQ2 primer but does not contain the BHQ2 quenching
group, therefore the annealing process has little effect
on the fluorescence of Cy3. We optimized reaction con-
ditions to ensure that all measurements were carried
out in the linear region (Figure S2). As a one minute
time-point was in the linear region, we then probed the
Figure 2. Inhibition of SCV Helicase ATPase Activity by the Six Dif-
effect of the presence of various concentrations of the
ferent Bananin Derivatives and Inhibition of the Nonstimulated
bananin inhibitors and compared them to control reac-
ATPase Activity by Bananin
tions where no inhibitor was added (Figure 4B). Addi-
(A) Inhibition of dT
24
-stimulated ATPase activity. A colorimetric as-
tional controls were carried out to verify that the ba-
say was used to measure phosphate release due to ATP to ADP
nanin compounds did not fluoresce themselves at the
hydrolysis after a 5 min period. Points shown are the average of
wavelength at which we were reading. Data from these
triplicate experiments and the error bars represent the standard
distribution. Data were fitted with the logistic equation to calculate
experiments were fitted to the logistic equation to ob-
each IC
50
. (B) Inhibition of nonstimulated ATPase activity. The same
tain the
helicase
IC
50
values (Figure 4C). Although the
assay was used to measure inhibition of the reaction in the ab-
overall
helicase
IC
50
values appeared slightly weaker (i.e,.
sence of dT
24
by bananin.
larger) than the
ATPase
IC
50
values, it was observed that
the inhibitors followed the same general trends as
those observed for the ATPase data. Bananin, iodoba-
bulky side groups on the six-membered ring of this
nanin, vanillinbananin, and eubananin were effective in-
class of compounds reduce their inhibitory activity
hibitors of helicase activity, while ansabanin and aden-
against the SCV helicase.
inobananin barely inhibit the reaction.
We also checked whether bananin would inhibit the
We also performed a final control to check whether
unstimulated basal ATPase activity in the absence of
bananin acted as a general helicase inhibitor or not. We
dT
24
of the SCV helicase (Figure 2B). It is clear that
cloned and purified the E. coli DnaB helicase, which is
bananin is not an effective inhibitor of the unstimulated
a well characterized helicase with 5# to 3# polarity of
ATPase activity, although slight inhibition was observed
unwinding [35]. The purity of DnaB may be observed
at 100 µM.
by SDS-PAGE in Figure S3A. We found that 250 µM
We then tested the mechanism of inhibition of the
bananin did not inhibit DnaB in our FRET-based assay
ATPase activity by bananin, and checked competition
(Figure S3B). These results suggest that bananin does
with respect to both ATP (Figures 3A and 3B) and with
respect to dT
24
(Figures 3C and 3D). Figures 3B and 3D not act as a general helicase inhibitor.
Chemistry & Biology
306
Figure 3. Bananin Is a Noncompetitive Inhibitor with Respect to Both ATP and to Nucleic Acid
Points are an average of triplicate experiments. (A) ATPase activity was measured under varying ATP concentrations in the presence and
absence of 2.3 µM bananin. (B) Lineweaver Burke plot of inhibition data from (A). Solid circles represent absence of inhibitor while open
circles represent presence of 2.3 µM bananin. Dotted lines represent 95% confidence of fit of straight lines. (C) ATPase activity was measured
under varying dT
24
concentrations in the presence and absence of 2.3 µM bananin. (D) Lineweaver Burke plot of inhibition data from (C).
Solid circles again represent absence of inhibitor while open circles represent presence of 2.3 µM bananin. Dotted lines represent 95%
confidence of fit of straight lines.
Inhibition of SARS Coronavirus Replication after infection was serially diluted and fresh FRhK-4
cells were infected with the serial dilutions. CytopathicThe potency of these inhibitors against the SCV heli-
case enzymatic activities prompted us to investigate effects were observed three days after infection with
the serial dilutions, thereby allowing measurement oftheir ability to inhibit SCV replication in a cell culture
system. We chose to test bananin itself, it being the the viral titre. In this study, drugs were added either one
hour before or one hour after the infection with a 0.03most representative of the class and the parent com-
pound. SCV has previously been established in fetal multiplicity of infection (MOI) of the virus. In FRhK cells,
the generation time of the SCV replication has beenrhesus kidney-4 cells (FRhK-4) in our laboratories [36].
SCV infection typically presents clear cytopathic ef- shown to be 17–19 hr (our unpublished data). There-
fore, the readings at 24 hr are effectively after a singlefects (CPEs): the cells appear inflamed with “ridged”
cell membranes when infected with the virus. Visual in- generation. It can be seen from this data that at a con-
centration of 10 M bananin, the viral titre was reducedspection of cell cultures infected with SCV in the pres-
ence of 50 M bananin, revealed that CPEs were dis- by almost 50% after 24 hr (Figure 5), and the drug was
most effective when added one hour after infectiontinctly reduced relative to those of a control infection
(results not shown). However, levels of CPEs were diffi- compared to one hour before. When drug was added
before, it was not removed on addition of the virus andcult to quantify accurately, and so an alternative pro-
cedure was pursued. was present for the rest of the experiment. After 48 hr,
the difference between addition of drug before and af-To quantify the antiviral activity of bananin, we mea-
sured the viral titre under different inhibitor concentra- ter infection became more pronounced, and the viral
titre had dropped below 35% of the control in the ab-tions (Figure 5). The infectivity of the virus in the cul-
tures in the presence and absence of bananin was sence of inhibitor (Figure 5). At a concentration of 50
M, these effects were more pronounced; when themeasured by a standard TCID
50
protocol using serial
dilution of the cell culture supernatant [36], and com- drug was added one hour after infection, the viral titre
was below 10% of an untreated control infection afterpared to virus controls where no drug was added.
Briefly, cell culture supernatant at various time points 24 hr. At 100 M bananin, the viral titre was almost zero
Bananins As Inhibitors of the SARS Coronavirus
307
Figure 5. The Antiviral Activities of Bananin Measured by 50% Tis-
sue Culture Infective Dose (TCID
50
)
Bananin was added to cultures at the concentration indicated
either one hour before (white bars) or one hour after (hatched bars)
infection with the virus. The TCID
50
was measured either 24 hr or
48 hr after infection by a standard serial dilution protocol and com-
pared to a control where the culture had been infected in the ab-
sence of inhibitor.
in the cultures containing bananin, even at a concentra-
tion of 100 M(Figure 6). However, after 12 hr, it was
Figure 4. Principle of the FRET-Based Helicase Assay, Inhibition of
clearly observed that the drug was having an inhibitory
SCV Helicase Helicase Activity by the Six Different Bananin Deriva-
tives, and Summary of Enzymatic Inhibition Data
effect, even at a concentration of 10 M, and this effect
increased with time up to 48 hr. This data also indicated
(A) Schematic showing the principles behind the FRET-based fluo-
rimetric assay of helicase activity.
that adding the drug after viral infection was consider-
(B) Inhibition of the helicase activity of the SCV helicase in the pres-
ably more effective than when it was added before (Fig-
ence of various concentrations of the six bananin derivatives.
ure 5).
Points shown are the average of triplicate experiments. Data were
We measured the toxicity of bananin using a stan-
fitted with the logistic equation to calculate each IC
50
. Error bars
dard MTT assay. Fitting the logistic equation to the data
represent the standard deviation of triplicate measurements.
(C) Table showing the IC
50
values for inhibition of both ATPase and
helicase activities of the SCV helicase.
after 24 hr and 48 hr. These results suggest first that
bananin is an effective inhibitor with an EC
50
of below
10 µM (when measured 48 hr post-infection and when
drug was added one hour after virus infection). Second,
due to the increased efficacy of the drug when added
post infection, these results suggest that bananin does
not inhibit the entry step, but inhibits a later step of the
infection cycle after the virus has penetrated the cell.
As a further assay, we used quantitative real time
PCR to measure the relative quantities of viral RNA
(specified by primers targeted to the SCV S-gene) com-
pared to cellular RNA (specified by primers targeted to
the gene β-actin). β-actin is expressed stably at basal
level in FRhK-4 cells as determined by Q-RT-PCR and
Figure 6. Kinetics of the Antiviral Activity of Bananin Measured by
is therefore a good control for possible bias in the ex-
Quantitative Real Time PCR
periment. Again, the drug was added to various con-
Bananin was added to cultures at the concentration indicated
centrations either one hour before, or one hour after
(square: 10 M, up triangle: 50 M, down triangle: 100 M) either
1 hr before (D-V represents drug then virus, filled symbols) or 1 hr
infection, and compared to a control where no drug
after (V-D represents virus then drug, open symbols) infection with
was added (Figure 6). Bananin was maintained at the
the virus. Cellular and viral RNA levels were measured by quantita-
same concentration throughout the experiment. The ki-
tive real time PCR over a 48 hr period, using primers complemen-
netics of infection were examined by making Q-RT-PCR
tary to the β-actin and SCV Spike protein genes, respectively, and
measurements 1 hr, 6 hr, 12 hr, 24 hr, and 48 hr post-
are displayed using a logarithmic scale. A control in the absence
infection. Up to 6 hr post infection, there was little dif-
of inhibitor was also carried out (crosses). Error bars represent the
standard deviation of triplicate measurements.
ference in SCV S-gene levels between the control and
Chemistry & Biology
308
nonspecific aggregator. The ATPase inhibition results
were consistent with those from the helicase assays:
bananin, vanillinbananin, eubananin, and iodobananin
were the best inhibitors of DNA-unwinding, while ansa-
banin and adeninobananin were poor inhibitors. Gen-
erally, the helicase inhibition activities measured for
each compound, as determined by IC
50
values, were
less than the corresponding ATPase inhibition activi-
ties, but the trends remained consistent. This appears
to be a characteristic common to many helicase inhibi-
tors [24, 25].
Bananin, which acted as an effective inhibitor in both
enzymatic assays and is the prototypical member of
this class of compounds, was tested in a cell culture
system of the virus. Bananin exhibited antiviral effects
at concentrations significantly below those causing cell
toxicity (EC
50
<10M, CC
50
= 390 M). Experiments
measuring the viral titer in two different situations, one
where the drug was added one hour before viral infec-
Figure 7. Toxicity of Bananin to FRhK-4 Cells As Measured Using
the MTT Assay
tion, and one where the drug was added one hour after
Cell viability was measured after 48 hr in the presence of the indi-
viral infection, suggested that bananin did not inhibit
cated concentrations of bananin by the MTT assay. Toxin repre-
viral entry but inhibited some key intracellular pro-
sents amanitin at 30 g/ml. Error bars represent the standard devi-
cesses involved in viral replication or pathogenesis.
ation of five measurements.
These experiments were further confirmed by kinetic
experiments measuring the relative quantity of viral
RNA compared to cellular RNA over 48 hr. The drug had
indicated that 48 hr post infection, bananin exhibited a
little effect on RNA levels during the early stages of the
cytotoxic concentration causing 50% cell mortality
life cycle (approximately 0–6 hr post infection), indicat-
(CC
50
) of 390 M(Figure 7). As the EC
50
for bananin
ing that the amount of the virus which has entered the
added post infection at 48 hr was less than 10 M(Fig-
cells was similar in the presence or absence of the
ure 5B), this result implies a specificity index (CC
50
/
drug. But the viral RNA levels were very different during
EC
50
) of over 39.
the later stages (from approximately 12–48 hr), sug-
gesting that viral transcription/replication was inhibited
Discussion
by bananin. It is interesting to note the marked reduc-
tion in efficacy when bananin is added prior to viral in-
Here we describe the synthesis and inhibitory effects
fection, despite its continued presence post infection.
against enzymatic activities of the SARS coronavirus
First, this would suggest that the compound does not
helicase for several structurally unusual trioxa-ada-
inhibit a viral entry process. Second, it suggests that
mantane derivatives, trivially referred to as bananins.
bananin may be affecting other cellular pathways that
We also show that bananin exhibits significant anti-SCV
in the absence of viral infection may resist the protec-
activity in cell culture, through the inhibition of a pro-
tive effects of the drug. The SCV helicase is one pos-
cess occurring after viral entry into the cell. We have
sible target within the cell, although at this stage we
developed an extremely convenient and quick method
cannot exclude the possibility that bananin may be in-
for testing both ATPase activities colorimetrically, and
hibiting via other pathway(s).
helicase activities fluorimetrically through a type of
FRET assay. This combination of assays may be adapted
easily for high-throughput screening of compound li-
Significance
braries against both NTPase and DNA-unwinding enzy-
matic activities, and avoids the use of radioactive
32
P,
Adamantane derivatives have been used clinically for
which is commonly used in many traditional helicase
many years as antiviral treatments and as muscle re-
assays.
laxants. Here, we have demonstrated that a class of
ATPase assays revealed that iodobananin and vanil-
pyridoxal-conjugated trioxaadamantanes, the bana-
linbananin were the most effective SCV helicase inhibi-
nins, inhibit both the ATPase and helicase activities
tors, with
ATPase
IC
50
values of 0.54 M and 0.68 M,
of the SARS coronavirus helicase. Testing a number
respectively. Bananin (
ATPase
IC
50
= 2.3 M) and euba-
of bananin derivatives, we have shown that it is im-
nanin (
ATPase
IC
50
= 2.8 M) were also reasonable inhibi-
portant to reduce steric hindrance around the pyri-
tors, but ansabananin and adeninobananin, which con-
doxal ring for effective inhibition of the SCV helicase.
tain bulky appendages on the pyridoxal system, showed
Furthermore, bananin was shown to be an effective
little if any inhibition. Bananin acted as a noncompeti-
antiviral drug in a cell culture of the virus. The mode
tive inhibitor with respect to both ATP and nucleic acid,
of viral inhibition supports the hypothesis that the
suggesting this class of inhibitors binds at a site dis-
SCV helicase is a target of these compounds. Given
tinct from the ATP and nucleic acid binding sites. Far
the paucity of drugs shown to be effective in treating
weaker inhibition of the unstimulated ATPase activity
was observed, showing that bananin does not act as a this recently emerged disease, the bananins repre-
Bananins As Inhibitors of the SARS Coronavirus
309
C
14
H
16
O
8
(M = 312.27 g/mol). The structure was established by a
sent a class of compounds with significant therapeu-
COSY combination of
1
H-NMR and
13
C-NMR spectroscopy, sup-
tic potential against SARS.
plemented by UV/VIS spectrophotometry.
Experimental Procedures
Cloning and Purification of the SCV Helicase
The SCV helicase domain (nsp13-pp1ab, accession number NP_
Synthesis of Eugenolbananin (Eubananin, EUB)
828870, originally denoted as nsp10) was cloned and purified as
from Bananin and Eugenol
previously described [26].
A mass of 4.41 g bananin [9](M = 327.29 g/mol) (13.4743 mmol)
and 3.00 ml eugenol (3.20 g) (M = 164.20 g/mol) (ρ
4
20
= 1.0664
Cloning and Purification of E. coli DnaB
g/ml) (19.4836 mmol) were suspended in 30 ml of water. Then, 6.00
The DnaB helicase was amplified by PCR from E. coli genomic DNA
g of sodium hydroxide (NaOH) pearls (0.15 mol) were added in
using 5#-GGCGAATTCATGGCAGGAAATAAAACCCTTCAAC-3# and
small portions, then heated until all material had dissolved. Then
5#-TAATATCTCGAGTCATTCGTCGTCGTACTGCGGCCC-3#.ThePCR
15.0 ml of 10 M hydrochloric acid (0.15 mol HCl) was added in small
product was gel purified then EcoRI/XhoI ligated into pET28a to
portions. The mixture was kept at 4°C for 12 hr and a precipitate
form plasmid DnaB-pET28a. The plasmid was maintained in strain
recovered by filtration and dessication. Yield: 5.33 g (81%) reddish-
DH10B and transformed into strain BL21-DE3 for expression. A 5
brown powder 1-[6-[(2RS)-1-(4-hydroxy-3-methoxyphenyl)-2-pro-
ml LB culture containing 50 µg/ml kanamycin was grown overnight,
pyl]-3-hydroxy-5-(hydroxymethyl)-2-methyl-4-pyridinyl]-2,8,
then 1 ml of the overnight culture was added to 500 ml LB contain-
9-trioxaadamantane-3,5,7-triol (eubananin, EUB) C
24
H
29
NO
10
(M =
ing 50 µg/ml kanamycin. The culture was induced with 0.5 mM
491.49 g/mol). The structure was established by a COSY combina-
IPTG at AU = 0.4, then grown further for three hours at 37°C. The
tion of
1
H-NMR and
13
C-NMR spectroscopy.
cells were collected by centrifugation and sonication was used to
split soluble and insoluble fractions. DnaB was observed by SDS-
“One Pot Synthesis” of AZTRION
PAGE to be mainly present in the insoluble fraction, and further
Masses of 18.44 g vanillin (M = 152.14 g/mol) (121.20 mmol) and
purification was from the insoluble fraction. The insoluble fraction
15.29 g phloroglucinol (M = 126.11 g/mol) (121.24 mmol) were sus-
was washed three times with 30 ml 50 mM TRIS-HCl (pH 7.4). The
pended in 73 ml of water. Then, 29.27 g of solid sodium hydroxide
pellet was then dissolved in 15 ml 6 M GuCl / 50 mM TRIS-HCl
pearls (NaOH) (M = 40.00 g/mol) was added in small portions. Im-
(pH 7.4)/20 mM imidazole, and any insoluble material removed by
mediately after the solidification, 100 ml of water was added and
centrifugation. The protein was refolded by injecting 15 ml solution
the suspension was shaken vigorously for 5 min until the develop-
through a fine-bore needle into 135 ml of rapidly vortexing 50 mM
ment of heat ceased and the mixture turned crystalline. Then a
TRIS-HCl (pH 6.8) / 5 mM MgCl
2
/ 20% glycerol / 1% triton / 10 mM
mass of 22.28 g 1,3,5,7-tetraazatricyclo[3.3.1.1
3,7
]decane (methen-
β-mercaptoethanol on ice. Very little precipitate was seen in this
amine, urotropin, hexamethylenetetramine) (M = 140.19 g/mol)
procedure; any precipitate was removed by centrifugation. The
(158.93 mmol), 173 ml of water, and 39.93 g NaOH was added and
protein was then passed ontoa5mlNi-NTA column, washed with
the mixture was refluxed for 20 min before cooling at −18°C for 6
50 ml of 50 mM TRIS-HCl (pH 8.5) / 40 mM imidazole, before being
hr. Yield: 22.16 g (66%) fine reddish-orange needles disodium 6,10-
eluted with 50 mM TRIS-HCl (pH 8.5) / 200 mM imidazole. β-mer-
dihydroxy-6,10-dioxido-1-azatricyclo[3.3.1.1
3,7
]decan-4-one mono-
captoethanol was then added to 10 mM, glycerol added to 20%,
hydrate [1-azaadamantane-4,6,10-trione bis(sodium hydroxide) ad-
and the protein was stored at −20°C.
duct monohydrate, AZTRION] C
9
H
11
NO
5
Na
2
×H
2
O(M = 277.18
ATPase assays were performed using a phosphomolybdate-mal-
g/mol). The structure was established by a COSY combination of
achite green assay described previously [26]. Reaction conditions
1
H-NMR and
13
C-NMR spectroscopy, supplemented by IR spectro-
were 50 mM TRIS-HCl (pH 6.8), 5 mM MgCl
2
, 200 nM dT
24
(for
scopy.
stimulated reactions), 0.1 mg/ml BSA, 3.2 ng SCV helicase (for
stimulated) or 32 ng SCV helicase (for nonstimulated) in a 50 µl
Synthesis of the Ansa Compound Ansabananin (ABN)
reaction volume for 5 min in a 96-well plate. Reaction was stopped
from Eubananin and AZTRION
by addition of EDTA to 50 mM, then AM/MG reagent and trisodium
A mass of 1.17 g eubananin (M = 491.49 g/mol) (2.3805 mmol) was
citrate were added as described to measure phosphate released in
dissolved in 40.0 ml of 0.5 M sodium hydroxide aqueous solution.
the reaction [26]. Titration of ATPase activity with inhibitors in the
A mass of 1.21 g AZTRION (M = 277.18 g/mol) (4.3654 mmol) was
presence of fixed concentrations of polynucleotide and ATP was
added. The black solution was treated dropwise with 3.50 ml of 10
described by a modified logistic equation [37].
M hydrochloric acid. Afterward, 2.00 g of NaOH pearls (M = 40.00
g/mol) (50 mmol NaOH) was added. The black solution was kept at
A([L]) = 1
A
[L]
EC
50
+[L]
4°C in an open crystallization dish for two days. After that time, the
dark crystalline mass was harvested and pressed between filter
papers. The material was recrystallized from 30.0 ml 2.0 M NaOH
aqueous solution. The black solution was kept at 4°C in an open
FRET-Based Helicase Assays
crystallization dish for two days. Yield: 2.43 g (99%) tan crystals
We used a protocol modified from that described [34], using oligo-
disodium (±)-rel-[6R,10S-(R
p
,R
p
)]-6-exo,10-exo-dioxido-6-endo,10-
mers suitable for a 5# to 3# helicase. Two oligomers were synthe-
endo-[1-[5-(hydroxymethyl)-6-[(2RS)-1-(3-methoxyphenyl)-2-
sized and purified by HPLC: DT20Cy3 (5#-TTTTTTTTTTTTTTTTTT
propyl]-2-methyl-4-pyridinyl]-2,8,9-trioxaadamantane-3,5,7-triol-3#,
TTCGAGCACCGCTGCGGCTGCACC(Cy3)-3#), and ReleaseBHQ (5#-
4##-diyldioxy]-1-azaadamantane-4-one sodium hydroxide adduct
(BHQ2)GGTGCAGCCGCAGCGGTGCTCG-3#) (Proligo). The two
pentadecahydrate (ansabananin, ABN) C
33
H
36
N
2
O
13
Na
2
× NaOH ×
oligomers were annealed by mixing a 1:1.2 ratio of DT20Cy3:Re-
15 H
2
O(M = 1024.86 g/mol). The structure was established by a
leaseBHQ at a concentration of 8.2 M (of DT20Cy3) in 10 mM
COSY combination of
1
H-NMR and
13
C-NMR spectroscopy.
TRIS-HCl (pH 8.5), heating to 90°C, then cooling slowly to 40°C
over one hour. The reaction was carried out in a 1 ml volume of 5 nM
DT20Cy3:ReleaseBHQ, 10 nM Release oligomer (5#-GGTGCAGC
Preparation of Vanillinbananin (VBN) from Vanillin
CGCAGCGGTGCTCG-3#), 0.5 mM ATP, 0.1 mg/ml BSA, 2 nM SCV
and Phloroglucinol
helicase, 5 mM MgCl
2
, and 50 mM TRIS-HCl (pH 6.8) at 25°C for 1
Masses of 25.20 g vanillin (M = 152.14 g/mol) (165.64 mmol) and
min. The change in fluorescence (excitation 550 nm, emission 570
20.88 g phloroglucinol (M = 126.11 g/mol) (165.57 mmol) were dis-
nm) after 1 min was used to monitor the extent of unwinding of the
solved in 300 ml of water. Then 40.00 g of solid sodium hydroxide
duplex. The DnaB FRET assay was carried out with 10 µg DnaB
(NaOH) (M = 40.00 g/mol) (1 mol NaOH) was added in small por-
under the same conditions.
tions, and, afterward, the mixture was titrated with 100 ml of 10 M
hydrochloric acid (1 mol HCl). It was subsequently cooled at 4°C
for 6 hr. Yield: 45.17 g (87%) yellow powder 1-(4-hydroxy-3-meth- Cell Culture and Determination of Cytopathic Effects
Fetal rhesus kidney (FRhK-4) cells were plated on a 96-well plateoxyphenyl)-2,8,9-trioxaadamantane-3,5,7-triol or 1-(4-hydroxy-3-
methoxyphenyl)-2,8,9-trioxatricyclo[3.3.1.1
3,7
]decane-3,5,7-triol (2000 cells per well) under minimum essential medium containing
Chemistry & Biology
310
5% (v/v) fetal bovine serum, 1% (w/v) sodium pyruvate, 100 U/ml 2. Wagner, H., Fischer, M., and Lotter, H. (1985). New bufadienol-
ides from Kalanchoe daigremontiana Hamet et Perr. (Crassula-penicillin, 0.1 mg/ml streptomycin and were cultured at 37°C in 5%
CO
2
. To test anti-SCV activities, FRhK-4 cultures were treated with ceae). Z. Naturforsch Teil B 40, 1226–1227.
3. Davies, W.L., Grunert, R.R., Haff, R.F., McGahen, J.W., Neu-a range of different drug concentrations one hour before or after
infection with 0.03 MOI of SCV (strain GZ50). Either 24, 36, or 48 hr mayer, E.M., Paulshock, M., Watts, J.C., Wood, T.R., Hermann,
E.C., and Hoffmann, C.E. (1964). Antiviral activity of 1-Ada-post infection, cytopathic effects (CPE) were observed by phase-
contrast microscopy. The uninfected cells appeared smooth while mantanamine (Amantadine). Science 144, 862–863.
4. Schwab, R.S., England, A.C., Jr., Poskanzer, D.C., and Young,infected cells showed prominent ridge-like structures along the
membranes. Viral reproduction in the infected cells was quantified R.R. (1969). Amantadine in the treatment of Parkinson’s dis-
ease. JAMA 208, 1168–1170.by virus titration, as described below.
5. Wintermeyer, S.M., and Nahata, M.C. (1995). Rimantadine: a
clinical perspective. Ann. Pharmacother. 29, 299–310.
Inhibition of SCV Reproduction
6. Rosenthal, K.S., Sokol, M.S., Ingram, R.L., Subramanian, R.,
FRhK-4 cell cultures were infected with SCV one hour before or
and Fort, R.C. (1982). Tromantadine: inhibitor of early and late
after being treated with various concentrations of drug. Following
events in herpes simplex virus replication. Antimicrob. Agents
incubation for 24 and 48 hr, viable SCV production was measured
Chemother. 22, 1031–1036.
by back titration of the culture media supernatant using a TCID
50
7. Kornhuber, J., Weller, M., Schoppmeyer, K., and Riederer, P.
(50% tissue culture infectious dose) protocol [36]. Briefly, the su-
(1994). Amantadine and memantine are NMDA receptor antag-
pernatant was serially 10-fold diluted with fresh cell culture media
onists with neuroprotective properties. J. Neural Transm.
(MEM) and inoculated into FRhK-4 cells in 96-well plates. The virus
Suppl. 43, 91–104.
titre was determined by observation of cytopathic effects (CPE) in
8. Kesel, A.J., Sonnenbichler, I., Polborn, K., Gurtler, L., Klinkert,
FRhK-4 cells after 3 days of culture [36, 38].
W.E., Modolell, M., Nussler, A.K., and Oberthur, W. (1999). A
new antioxidative vitamin B6 analogue modulates pathophysi-
Q-RT-PCR
ological cell proliferation and damage. Bioorg. Med. Chem. 7,
Cells were washed twice with PBS, and total RNA was extracted
359–367.
using an RNeasy Mini kit (Qiagen, Germany) in accordance with the
9. Kesel, A.J. (2003). A system of protein target sequences for
manufacturer’s instructions. Reverse-transcription was performed
anti-RNA-viral chemotherapy by a vitamin B6-derived zinc-
using random hexamers with the ThermoScript RT system (Invitro-
chelating trioxa-adamantane-triol. Bioorg. Med. Chem. 11,
gene, CA). Intracellular viral RNA was quantified using quantitative
RT-PCR (Q-RT-PCR) [36, 38, 39], using the forward primer 5#-GCT 4599–4613.
TAG GCC CTT TGA GAG AGA CA-3# and the reverse primer 5#-
10. Peiris, J.S., Lai, S.T., Poon, L.L., Guan, Y., Yam, L.Y., Lim, W.,
GCC AAT GCC AGT AGT GGT GTA AA-3# (final concentration 200
Nicholls, J., Yee, W.K., Yan, W.W., Cheung, M.T., et al. (2003).
nM), the fluorescent probe 5#-CCT GAT GGC AAA CCT TGC AC-3#
Coronavirus as a possible cause of severe acute respiratory
and phosphate probe 5#-(LC640)CAC CTG CTC TTA ATT GTT ATT
syndrome. Lancet 361, 1319–1325.
GGC C-3# (final concentration 800 nM). The real-time quantification
11. Ksiazek, T.G., Erdman, D., Goldsmith, C.S., Zaki, S.R., Peret, T.,
was carried out using LC Faststart DNA Master Hyb Probes and
Emery, S., Tong, S., Urbani, C., Comer, J.A., Lim, W., et al.
LightCycler (Roche Diagnostics, USA). PCR conditions employed
(2003). A novel coronavirus associated with severe acute respi-
were 95°C for 10 min and then 50 cycles at 95°C for 10 s, 60°C for
ratory syndrome. N. Engl. J. Med. 348, 1953–1966.
5 s, 72°C for 5 s and 40°C for 30 s. The increase in PCR products
12. Drosten, C., Gunther, S., Preiser, W., van der Werf, S., Brodt,
was monitored for each amplification cycle by measuring the
H.R., Becker, S., Rabenau, H., Panning, M., Kolesnikova, L.,
increase in fluorescence caused by the binding of SYBR Green I to
Fouchier, R.A., et al. (2003). Identification of a novel coro-
double-stranded DNA. The crossing point values were determined
navirus in patients with severe acute respiratory syndrome. N.
for each sample and specificity of the amplicons was measured by
Engl. J. Med. 348, 1967–1976.
melting curve analysis and visualized by agarose gel electrophore-
13. Rota, P.A., Oberste, M.S., Monroe, S.S., Nix, W.A., Campagnoli,
sis. A ten-fold serial dilution of plasmid ranging from 1.5 pg/ml to
R., Icenogle, J.P., Penaranda, S., Bankamp, B., Maher, K.,
1.5×10
6
pg/ml were used as standard and the gene β-actin was
Chen, M.H., et al. (2003). Characterization of a novel coro-
used as an endogenous control to normalize for intersample varia-
navirus associated with severe acute respiratory syndrome.
tions in the amount of total RNA.
Science 300, 1394–1399.
14. Marra, M.A., Jones, S.J., Astell, C.R., Holt, R.A., Brooks-Wil-
Determination of Drug Cytotoxic Concentration
son, A., Butterfield, Y.S., Khattra, J., Asano, J.K., Barber, S.A.,
Concentration was measured using a standard methylthiazolyldi-
Chan, S.Y., et al. (2003). The Genome sequence of the SARS-
phenyl-tetrazolium bromide (MTT) assay. The CC
50
was determined
associated coronavirus. Science 300, 1399–1404.
by fitting data to the logistic equation, as described above; amani-
15. Lau, A.C., So, L.K., Miu, F.P., Yung, R.W., Poon, E., Cheung,
tin at 30 g/ml was used as a toxic control.
T.M., and Yam, L.Y. (2004). Outcome of coronavirus-associated
severe acute respiratory syndrome using a standard treatment
protocol. Respirology 9, 173–183.
Supplemental Data
16. Booth, C.M., Matukas, L.M., Tomlinson, G.A., Rachlis, A.R.,
Supplemental Data for this article is available online at http://
Rose, D.B., Dwosh, H.A., Walmsley, S.L., Mazzulli, T., Aven-
www.chembiol.com/cgi/content/full/12/3/303/DC1/.
dano, M., Derkach, P., et al. (2003). Clinical features and short-
term outcomes of 144 patients with SARS in the greater To-
ronto area. JAMA 289, 2801–2809.
Acknowledgments
17. Cinatl, J., Morgenstern, B., Bauer, G., Chandra, P., Rabenau,
H., and Doerr, H.W. (2003). Glycyrrhizin, an active component
This work was supported by the Hong Kong Health, Welfare and
of liquorice roots, and replication of SARS-associated coro-
Food Bureau under grants from the Research Fund for the Control
navirus. Lancet 361, 2045–2046.
of Infectious Diseases. R.M.W. was supported by the Area of Excel-
18. Anand, K., Ziebuhr, J., Wadhwani, P., Mesters, J.R., and Hilgen-
lence Scheme of the University Grants Committee.
feld, R. (2003). Coronavirus main proteinase (3CLpro) structure:
basis for design of anti-SARS drugs. Science 300, 1763–1767.
19. Yang, H., Yang, M., Ding, Y., Liu, Y., Lou, Z., Zhou, Z., Sun, L.,
Received: August 8, 2004
Mo, L., Ye, S., Pang, H., et al. (2003). The crystal structures of
Revised: December 16, 2004
severe acute respiratory syndrome virus main protease and its
Accepted: January 12, 2005
complex with an inhibitor. Proc. Natl. Acad. Sci. USA 100,
Published: March 25, 2005
13190–13195.
20. Bacha, U., Barrila, J., Velazquez-Campoy, A., Leavitt, S.A., and
References
Freire, E. (2004). Identification of novel inhibitors of the SARS
coronavirus main protease 3CLpro. Biochemistry 43, 4906–1. Woodward, R.B. (1964). The structure of tetrodotoxin. Pure
Appl. Chem. 9, 49–74. 4912.
Bananins As Inhibitors of the SARS Coronavirus
311
21. Wu, C.Y., Jan, J.T., Ma, S.H., Kuo, C.J., Juan, H.F., Cheng, Y.S., HBV cccDNA by real-time PCR. Biochem. Biophys. Res. Com-
mun. 295, 1102–1107.Hsu, H.H., Huang, H.C., Wu, D., Brik, A., et al. (2004). Small
molecules targeting severe acute respiratory syndrome human
coronavirus. Proc. Natl. Acad. Sci. USA 101, 10012–10017.
22. Kao, R.Y., Tsui, W.H., Lee, T.S., Tanner, J.A., Watt, R.M., Huang,
J.D., Hu, L., Chen, G., Chen, Z., Zhang, L., et al. (2004). Identifi-
cation of novel small-molecule inhibitors of severe acute respi-
ratory syndrome-associated coronavirus by chemical genetics.
Chem. Biol. 11, 1293–1299.
23. Kleymann, G., Fischer, R., Betz, U.A., Hendrix, M., Bender, W.,
Schneider, U., Handke, G., Eckenberg, P., Hewlett, G., Pevzner,
V., et al. (2002). New helicase-primase inhibitors as drug candi-
dates for the treatment of herpes simplex disease. Nat. Med.
8, 392–398.
24. Crute, J.J., Grygon, C.A., Hargrave, K.D., Simoneau, B.,
Faucher, A.M., Bolger, G., Kibler, P., Liuzzi, M., and Cordingley,
M.G. (2002). Herpes simplex virus helicase-primase inhibitors
are active in animal models of human disease. Nat. Med. 8,
386–391.
25. Borowski, P., Schalinski, S., and Schmitz, H. (2002). Nucleotide
triphosphatase/helicase of hepatitis C virus as a target for anti-
viral therapy. Antiviral Res. 55, 397–412.
26. Tanner, J.A., Watt, R.M., Chai, Y.B., Lu, L.Y., Lin, M.C., Peiris,
J.S., Poon, L.L., Kung, H.F., and Huang, J.D. (2003). The severe
acute respiratory syndrome (SARS) coronavirus NTPase/heli-
case belongs to a distinct class of 5# to 3# viral helicases. J.
Biol. Chem. 278, 39578–39582.
27. Thiel, V., Ivanov, K.A., Putics, A., Hertzig, T., Schelle, B., Bayer,
S., Weissbrich, B., Snijder, E.J., Rabenau, H., Doerr, H.W., et al.
(2003). Mechanisms and enzymes involved in SARS coro-
navirus genome expression. J. Gen. Virol. 84, 2305–2315.
28. Ivanov, K.A., Thiel, V., Dobbe, J.C., van der Meer, Y., Snijder,
E.J., and Ziebuhr, J. (2004). Multiple enzymatic activities asso-
ciated with severe acute respiratory syndrome coronavirus he-
licase. J. Virol. 78, 5619–5632.
29. van Dinten, L.C., van Tol, H., Gorbalenya, A.E., and Snijder, E.J.
(2000). The predicted metal-binding region of the arterivirus
helicase protein is involved in subgenomic mRNA synthesis,
genome replication, and virion biogenesis. J. Virol. 74, 5213–
5223.
30. van Marle, G., van Dinten, L.C., Spaan, W.J., Luytjes, W., and
Snijder, E.J. (1999). Characterization of an equine arteritis virus
replicase mutant defective in subgenomic mRNA synthesis. J.
Virol. 73, 5274–5281.
31. Uehara, Y. (2003). Natural product origins of Hsp90 inhibitors.
Curr. Cancer Drug Targets 3, 325–330.
32. Wardell, A.D., Errington, W., Ciaramella, G., Merson, J., and
McGarvey, M.J. (1999). Characterization and mutational analy-
sis of the helicase and NTPase activities of hepatitis C virus
full-length NS3 protein. J. Gen. Virol. 80, 701–709.
33. Baykov, A.A., Evtushenko, O.A., and Avaeva, S.M. (1988). A
malachite green procedure for orthophosphate determination
and its use in alkaline phosphatase-based enzyme immuno-
assay. Anal. Biochem. 171, 266–270.
34. Boguszewska-Chachulska, A.M., Krawczyk, M., Stankiewicz,
A., Gozdek, A., Haenni, A.L., and Strokovskaya, L. (2004). Di-
rect fluorometric measurement of hepatitis C virus helicase ac-
tivity. FEBS Lett. 567, 253–258.
35. Biswas, S.B., Chen, P.H., and Biswas, E.E. (1994). Structure
and function of Escherichia coli DnaB protein: role of the
N-terminal domain in helicase activity. Biochemistry 33,
11307–11314.
36. He, M.L., Zheng, B., Peng, Y., Peiris, J.S., Poon, L.L., Yuen,
K.Y., Lin, M.C., Kung, H.F., and Guan, Y. (2003). Inhibition of
SARS-associated coronavirus infection and replication by RNA
interference. JAMA 290, 2665–2666.
37. Porter, D.J. (1998). Inhibition of the hepatitis C virus helicase-
associated ATPase activity by the combination of ADP, NaF,
MgCl2, and poly(rU). Two ADP binding sites on the enzyme-
nucleic acid complex. J. Biol. Chem. 273, 7390–7396.
38. Zheng, B.J. (2004). Prophylactic and therapeutic effects of
small interfering RNA targeting SARS-Coronavirus. Antivir.
Ther. 9, 365–374.
39. He, M.L., Wu, J., Chen, Y., Lin, M.C., Lau, G.K., and Kung, H.F.
(2002). A new and sensitive method for the quantification of
    • "Promising inhibitors are in trials for herpes simplex virus (Kleymann, 2003) and hepatitis C viral infections (Borowski et al., 2002 ). Several SARS-CoV helicase inhibitors – bananin derivatives – have been identified (Tanner et al., 2005). While the structure of nsp13 has not yet been determined, the protein has been modeled based on the E. coli Rep ATPdependent DNA helicase (PDB accession 1UAA). "
    [Show abstract] [Hide abstract] ABSTRACT: The international response to SARS-CoV has produced an outstanding number of protein structures in a very short time. This review summarizes the findings of functional and structural studies including those derived from cryoelectron microscopy, small angle X-ray scattering, NMR spectroscopy, and X-ray crystallography, and incorporates bioinformatics predictions where no structural data is available. Structures that shed light on the function and biological roles of the proteins in viral replication and pathogenesis are highlighted. The high percentage of novel protein folds identified among SARS-CoV proteins is discussed.
    Full-text · Article · Dec 2013
    • "In the M2 model construction of the 2009-H1N1 virus, the M2 protein sequence was taken from Genbank (accession number GQ385303), isolated in July 2009 from an H1N1 virus strain in Japan [10,15] (cf.Figure 5). Most synthetic inhibitors of M2 channel proteins, amantadine scaffolds based on adamantane derivatives were selected from published work by Gayday et al. [9], Du et al. [10], Eleftheratos et al. [18], Papanastasiou et al. [21], Tanner et al. [22], de Clercq [23], Tataridis et al. [24], Stamatiou et al. [25], Balannik et al. [26] and the others were newly created. These ligands have not been investigated for docking with M2 channel proteins either for the inside or outside positions before. "
    [Show abstract] [Hide abstract] ABSTRACT: The M2 channel protein on the influenza A virus membrane has become the main target of the anti-flu drugs amantadine and rimantadine. The structure of the M2 channel proteins of the H3N2 (PDB code 2RLF) and 2009-H1N1 (Genbank accession number GQ385383) viruses may help researchers to solve the drug-resistant problem of these two adamantane-based drugs and develop more powerful new drugs against influenza A virus. In the present study, we searched for new M2 channel inhibitors through a combination of different computational methodologies, including virtual screening with docking and pharmacophore modeling. Virtual screening was performed to calculate the free energies of binding between receptor M2 channel proteins and 200 new designed ligands. After that, pharmacophore analysis was used to identify the important M2 protein-inhibitor interactions and common features of top binding compounds with M2 channel proteins. Finally, the two most potential compounds were determined as novel leads to inhibit M2 channel proteins in both H3N2 and 2009-H1N1 influenza A virus.
    Full-text · Article · Dec 2011
    • "Recently, the adamantane-dervied anti-viral bananins (pyridoxal-conjugated trioxa-adamantanes), were shown to be potent noncompetitive inhibitors of the ATPase activity of SARS-CoV helicase. Iodobananin and vanillinbananin (Fig. 28) have IC 50 values of 0.54 and 0.68 μM, respectively, whereas the parent compound, bananin (Fig. 29), has IC 50 of 2.3 μM [242] . Bulky side groups of some bananins (ansa- bananin [Fig. "
    [Show abstract] [Hide abstract] ABSTRACT: Coronaviruses are important human and animal pathogens of the order Nidovirales. Several new members were discovered following the emergence of SARS-CoV in human populations, including two human coronaviruses and several animal coronaviruses. They cause respiratory and gastrointestinal illnesses and have been found in the brains of patients with multiple sclerosis. The high mortality of SARS, the identification of a natural reservoir, and the well-founded fear of provoking antibody-enhanced disease as a result of vaccination fueled the ongoing efforts in anti-coronavirus drug discovery. This review presents the results of current research.
    Full-text · Article · Apr 2009
Show more

  • undefined · undefined
  • undefined · undefined
  • undefined · undefined