Effect of intermittent fasting and refeeding on insulin action in healthy men

Abstract

Insulin resistance is currently a major health problem. This may be because of a marked decrease in daily physical activity during recent decades combined with constant food abundance. This lifestyle collides with our genome, which was most likely selected in the late Paleolithic era (50,000-10,000 BC) by criteria that favored survival in an environment characterized by fluctuations between periods of feast and famine. The theory of thrifty genes states that these fluctuations are required for optimal metabolic function. We mimicked the fluctuations in eight healthy young men [25.0 +/- 0.1 yr (mean +/- SE); body mass index: 25.7 +/- 0.4 kg/m(2)] by subjecting them to intermittent fasting every second day for 20 h for 15 days. Euglycemic hyperinsulinemic (40 mU.min(-1).m(-2)) clamps were performed before and after the intervention period. Subjects maintained body weight (86.4 +/- 2.3 kg; coefficient of variation: 0.8 +/- 0.1%). Plasma free fatty acid and beta-hydroxybutyrate concentrations were 347 +/- 18 and 0.06 +/- 0.02 mM, respectively, after overnight fast but increased (P < 0.05) to 423 +/- 86 and 0.10 +/- 0.04 mM after 20-h fasting, confirming that the subjects were fasting. Insulin-mediated whole body glucose uptake rates increased from 6.3 +/- 0.6 to 7.3 +/- 0.3 mg.kg(-1).min(-1) (P = 0.03), and insulin-induced inhibition of adipose tissue lipolysis was more prominent after than before the intervention (P = 0.05). After the 20-h fasting periods, plasma adiponectin was increased compared with the basal levels before and after the intervention (5,922 +/- 991 vs. 3,860 +/- 784 ng/ml, P = 0.02). This experiment is the first in humans to show that intermittent fasting increases insulin-mediated glucose uptake rates, and the findings are compatible with the thrifty gene concept.

Full text

99:2128-2136, 2005. First published Jul 28, 2005; doi:10.1152/japplphysiol.00683.2005 J Appl Physiol
Ploug, Peter Schjerling and Flemming Dela
Nils Halberg, Morten Henriksen, Nathalie Söderhamn, Bente Stallknecht, Thorkil
You might find this additional information useful...
49 articles, 21 of which you can access free at: This article cites http://jap.physiology.org/cgi/content/full/99/6/2128#BIBL
2 other HighWire hosted articles: This article has been cited by
[PDF] [Full Text] [Abstract] , July 1, 2007; 86 (1): 7-13. Am. J. Clinical Nutrition
K. A Varady and M. K Hellerstein Alternate-day fasting and chronic disease prevention: a review of human and animal trials
[PDF] [Full Text] [Abstract] , March 1, 2009; 296 (3): E549-E558. Am J Physiol Endocrinol Metab
E. P. Plaisance, M. Lukasova, S. Offermanns, Y. Zhang, G. Cao and R. L. Judd
Niacin stimulates adiponectin secretion through the GPR109A receptor
including high-resolution figures, can be found at: Updated information and services http://jap.physiology.org/cgi/content/full/99/6/2128
can be found at: Journal of Applied Physiologyabout Additional material and information http://www.the-aps.org/publications/jappl
This information is current as of September 30, 2009 .
http://www.the-aps.org/.ISSN: 8750-7587, ESSN: 1522-1601. Visit our website at
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the American Physiological Society.
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
publishes original papers that deal with diverse areas of research in applied physiology, especiallyJournal of Applied Physiology
on September 30, 2009 jap.physiology.orgDownloaded from

Effect of intermittent fasting and refeeding on insulin action in healthy men
Nils Halberg,
1
Morten Henriksen,
1
Nathalie So¨derhamn,
1
Bente Stallknecht,
1
Thorkil Ploug,
1
Peter Schjerling,
2
and Flemming Dela
1
1
Copenhagen Muscle Research Centre, Department of Medical Physiology, The Panum Institute, University of Copenhagen,
Denmark; and
2
Copenhagen Muscle Research Center, Department of Molecular Muscle Biology, Rigshospitalet, Denmark
Submitted 9 June 2005; accepted in final form 22 July 2005
Halberg, Nils, Morten Henriksen, Nathalie So¨ derhamn, Bente
Stallknecht, Thorkil Ploug, Peter Schjerling, and Flemming Dela.
Effect of intermittent fasting and refeeding on insulin action in healthy
men. J Appl Physiol 99: 2128 –2136, 2005. First published July 28,
2005; doi:10.1152/japplphysiol.00683.2005.—Insulin resistance is
currently a major health problem. This may be because of a marked
decrease in daily physical activity during recent decades combined
with constant food abundance. This lifestyle collides with our ge-
nome, which was most likely selected in the late Paleolithic era
(50,000 –10,000 BC) by criteria that favored survival in an environ-
ment characterized by fluctuations between periods of feast and
famine. The theory of thrifty genes states that these fluctuations are
required for optimal metabolic function. We mimicked the fluctua-
tions in eight healthy young men [25.0 ⫾0.1 yr (mean ⫾SE); body
mass index: 25.7 ⫾0.4 kg/m
2
] by subjecting them to intermittent
fasting every second day for 20 h for 15 days. Euglycemic hyperin-
sulinemic (40 mU䡠min
⫺1
䡠m
⫺2
) clamps were performed before and
after the intervention period. Subjects maintained body weight
(86.4 ⫾2.3 kg; coefficient of variation: 0.8 ⫾0.1%). Plasma free fatty
acid and ␤-hydroxybutyrate concentrations were 347 ⫾18 and 0.06 ⫾
0.02 mM, respectively, after overnight fast but increased (P⬍0.05)
to 423 ⫾86 and 0.10 ⫾0.04 mM after 20-h fasting, confirming that
the subjects were fasting. Insulin-mediated whole body glucose up-
take rates increased from 6.3 ⫾0.6 to 7.3 ⫾0.3 mg䡠kg
⫺1
䡠min
⫺1
(P⫽0.03), and insulin-induced inhibition of adipose tissue lipolysis
was more prominent after than before the intervention (P⫽0.05).
After the 20-h fasting periods, plasma adiponectin was increased
compared with the basal levels before and after the intervention
(5,922 ⫾991 vs. 3,860 ⫾784 ng/ml, P⫽0.02). This experiment is
the first in humans to show that intermittent fasting increases insulin-
mediated glucose uptake rates, and the findings are compatible with
the thrifty gene concept.
euglycemic clamp; adiponectin
OUR GENOME WAS PROBABLY SELECTED during the Late-Paleolithic
era (50,000 –10,000 BC), during a time humans existed as
hunter-gatherers (6). At that time there were no guarantees in
finding food, resulting in intermixed periods of feast and
famine. In addition, physical activity had to be a part of our
ancestors’ daily living as forage and the hunt for food must
have been done through physical activity (15). Cycling be-
tween feast and famine, and thus oscillations in energy stores,
as well as between exercise and rest, was characteristic in the
Late-Paleolithic era and might have driven the selection of
genes involved in the regulation of metabolism (30).
Thus our genotype selected centuries ago to favor an envi-
ronment with oscillations in energy stores still exists with few
if any changes. The modern sedentary lifestyle common in the
westernized countries is characterized by constant high food
availability and low physical activity, and it has led to an
imbalance between our genotype and the environment in which
we live today. This may predispose our potential “thrifty”
genes to misexpress metabolic proteins, manifesting in chronic
diseases (e.g., Type 2 diabetes) in the industrialized part of the
world.
It is well known that physical training increases insulin
action (10). The molecular events leading to an exercise-
mediated increase in insulin action are not fully characterized.
In addition, energy usage during each exercise bout in the
training regimen with subsequent eating creates oscillations in
energy stores. These oscillations are probably not as massive as
the oscillations seen between periods of feast and famine for
the Late-Paleolithic people, but some similarities might exist,
and we speculated whether exercise-induced oscillations in
energy stores could be mimicked by intermittent fasting. This
study was undertaken to test the hypothesis that 14 days of
intermittent fasting and refeeding improves insulin-stimulated
glucose disposal.
MATERIALS AND METHODS
Subjects
Eight healthy young Caucasian men (age 25.0 ⫾0.1 yr, body mass
index 25.7 ⫾0.4 kg/m
2
) gave their written consent according the
declaration of Helsinki to participate in the study. The study was
approved by the local Danish ethical committee (KF 01-109/04).
Two days before both clamp experiments (see Experimental Pro-
cedure), the subjects were instructed to eat at least 250 g of carbo-
hydrate each day and to avoid strenuous exercise.
Throughout the intervention, the subjects were instructed to uphold
their normal exercise habits, to maintain their usual macronutrient
mixing of their meals, and to eat sufficient quantities of food on the
nonfasting days to ensure that their body weight was stable. The
subject characteristics are given in Table 1.
Experimental Procedure
The subjects were examined on two occasions: before and after 14
days of fasting every second day for 20 h, giving seven fasting
periods. Each fasting period started at 2200 and ended at 1800 the
following day (for protocol see Fig. 1). During the fasting periods the
subjects were allowed to drink water and were instructed to maintain
habitual activities.
On the day of clamp experiments, the subjects arrived at the
laboratory at 0800, after an overnight fast. The subjects were weighed
and had their height measured and were placed in a bed position.
A microdialysis catheter was inserted in the subcutaneous fat on the
abdomen (see below), and a small subcutaneous depot of
133
Xe was
placed in close proximity (⬃5 cm) to the microdialysis catheter. One
Address for reprint requests and other correspondence: N. Halberg, Dept. of
Medical Physiology, The Panum Institute, Blegdamsvej 3, DK-2200 Copen-
hagen N, Denmark (e-mail: nilsh@mfi.ku.dk).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
J Appl Physiol 99: 2128–2136, 2005.
First published July 28, 2005; doi:10.1152/japplphysiol.00683.2005.
8750-7587/05 $8.00 Copyright ©2005 the American Physiological Society http://www. jap.org2128
on September 30, 2009 jap.physiology.orgDownloaded from

catheter (18-gauge, Becton Dickinson, Helsingborg, Sweden) was
inserted in the medial cubital vein for infusion of glucose and insulin,
and one catheter (18-gauge, Becton Dickinson) was inserted in a
superficial hand vein in the retrograde direction. The hand was then
placed in a heating pad for sampling of arterialized blood. After basal
blood samples were obtained, concentrations of CO
2
and O
2
were
measured in expiratory air by a ventilated hood and a muscle biopsy
was taken from the thigh (vastus lateralis). Then the clamp was
started. During the last 15 min of the 120-min clamp, CO
2
and O
2
in
expiratory air were determined. At time t⫽120 min during the clamp,
a second muscle biopsy was taken from the thigh.
During the intervention period the subjects recorded their heart rate
(Ultima, Cardiosport, Denmark) 24 h a day and measured their body
weight in the morning before breakfast (on nonfasting days).
During the intervention period the subjects came to the laboratory
at 1700 three times (days 6,10, and 14) for weight measurement,
venous blood sampling, and measurement of expiratory gases. In
addition, on day 10 a muscle biopsy (see below) was taken.
Finally, the subject’s body composition was measured by dual-
energy X-ray absorption scanning before and after the intervention
period.
Microdialysis. Microdialysis was performed as described previ-
ously (44). At 08.30 a single microdialysis catheter (CMA 60, CMA,
Microdialysis AB) was placed in the abdominal subcutaneous adipose
tissue. At sites of perforation the skin was anesthetized. The catheter
was connected to a high-precision syringe pump (CMA 100 syringe
pump, CMA/Microdialysis AB). For determination of interstitial glyc-
erol concentrations, the catheter was perfused with a fluid containing
an isotonic ringer acetate buffer with 2 mM glucose,
14
C-glycerol (5
kBq/ml, PerkinElmer) at a speed of 1 ␮l/min. The relative recovery
was determined by the internal reference calibration technique (37).
The relative recovery was calculated as (dpm
p
⫺dpm
d
)/dpm
p
, where
dpm
p
and dpm
d
are the
14
C activity in the perfusate and dialysate,
respectively.
Euglycemic hyperinsulinemic clamp. For each subject, a 50-ml
insulin infusate had been prepared from insulin (100 IU/ml Atrapid,
Novo Nordisk, Copenhagen, Denmark), 2.5 ml of the subject’s own
plasma, and saline. Each clamp started with a 2-ml insulin infusate
bolus followed by a constant infusion (40 mU䡠min
⫺1
䡠m
⫺2
) for 120
min. Plasma glucose concentrations were maintained at a preexperi-
mental level by frequent analysis of arterialized blood samples (ABL-
system 700, Radiometer) with subsequent adjustments of the glucose
infusion rate.
Blood flow. Subcutaneous blood flow was determined by the
standard local
133
Xe washout method (5, 26) in the abdominal
subcutaneous adipose tissue in close proximity to the microdialysis
catheter. The tissue-blood partition coefficient was set to 10 (5).
Muscle biopsies. Muscle biopsies were obtained from the middle
portion of the vastus lateralis before and in the end of each clamp
experiment. After administration of local anesthesia, an incision of 10
mm was made and the biopsy was taken (Bergstro¨ m needle method
modified to apply suction). In addition, smaller biopsies were obtained
from the mid portion of vastus lateralis after the fourth fasting period
(i.e., day 10). The biopsy was then obtained with a Tru-core I biopsy
needle and instrument (Medical Device Technology, Gainesville, FL).
Muscle biopsies were quickly cleaned from visible blood and
frozen in liquid nitrogen (within 15 s) and stored at ⫺80°C until
further analysis.
Before analysis, the biopsies were freeze dried and carefully
dissected free from connective tissue, blood, and fat. A sample of the
muscle powder was used to determine glycogen content by the
hexokinase method (25). Another part of the muscle powder was used
to determine intramuscular triglyceride (IMTG) content by the chem-
ical extraction method (18, 33). Briefly, the samples were homoge-
nized in methanol and chloroform and the supernatant containing the
lipids was removed and mixed with water. The lipids contained in the
chloroform phase were then removed and hydrolysis was accom-
plished by adding tetraethylammoniumhydroxide (20%) and ethanol
(1:28). After 30 min at 60°C, the reaction was stopped with HCl. The
released acyl-glycerol was finally determined on a CMA 600 analyzer
(CMA/microdialysis) and the triacylglycerol content was calculated.
GLUT4 expression. Expression of GLUT4 protein was measured
by Western blot in a muscle biopsy obtained during the fasting
condition before each clamp. Muscle biopsies were quickly cleaned
from visible blood and/or fat, frozen in liquid nitrogen, and stored at
⫺80°C. The muscle tissue was subsequently homogenized with a
Polytron PT 3100 (Kinematica, Littau-Luzern, Switzerland) at maxi-
mum speed for ⬃10sin10volof⬃55°C buffer (4% SDS, 10 mM
pyrophosphate, 2 mM sodium orthovanadate, 10 mM EDTA, 25 mM
Tris䡠HCl, pH 6.8). Samples were sonicated for ⬃5 s to break DNA
strands, and total protein concentrations were determined by the
bicinchoninic acid method using BSA as standard. For Western blot,
10 ␮g of protein were separated by SDS-PAGE on 10% gels (Crite-
rion system, Bio-Rad, Hercules, CA) and electrophoretically trans-
ferred to polyvinylidene difluoride membranes for 45 min at 100 V by
using a tank buffer system (Bio-Rad). Transfer buffer contained 25
mM Tris, 192 mM glycine, and 20% methanol. Membranes were
Fig. 1. Experimental protocol. Eight men were subjected to fasting (marked with bars) every second day for a total of 7 fasting periods. Before and after this
intervention euglycemic clamps and microdialysis were performed. Blood samples and expiratory gas measurements were performed after the fasting on the days
marked with black bars (days 6,10, and 14). Additionally, after the fasting on day 10 a muscle biopsy was taken for measurement of glycogen and IMTG.
Table 1. Subject characteristics
Before the
Intervention
After the
Intervention
Age, yr 25⫾1
Body weight, kg 87.1⫾2.3 86.2⫾2.4
BMI, kg/m
2
25.7⫾0.4 25.5⫾0.3
%Body fat 20.1⫾0.8 20.4⫾1.1
Fasting plasma glucose, mmol/l 5.0⫾0.1 5.1⫾0.1
Fasting insulin, pmol/l 34⫾538⫾7
Data are means ⫾SE. BMI, body mass index. No significant differences
were seen.
2129METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

blocked in 1% defatted milk powder plus 5% BSA in TS buffer [10
mM Tris (pH 7.4), 150 mM NaCl], incubated for 90 and 60 min with
primary and horseradish peroxidase-labeled secondary antibodies,
respectively, and diluted in blocking solution. Antigen-antibody com-
plexes were visualized and quantitated by a LAS 3000 imaging
system (Fuji Film). Monoclonal antibody F-27 was used for detec-
tion of GLUT4 (35). Signals were normalized against amount of
desmin by reprobing the polyvinylidene difluoride membrane with a
monoclonal antibody against desmin (DakoCytomation, Glostrup,
Denmark).
Real-time RT-PCR. Total RNA was isolated from muscle biopsies
by phenol extraction (TriReagent, Molecular Research Center) as
previously described (7). Intact RNA was confirmed by denaturing
agarose gel electrophoresis. Five hundred nanograms total RNA were
converted into cDNA in 20 ␮l by using the OmniScript reverse
transcriptase (Qiagen) according to the manufacturer’s protocol. For
each target mRNA, 0.25 ␮l cDNA was amplified in a 25-␮l SYBR
Green PCR reaction containing 1⫻Quantitect SYBR Green Master
Mix (Qiagen) and 100 nM of each primer (Table 2). The amplification
was monitored in real time using the MX3000P real-time PCR
machine (Stratagene). The threshold cycle values were related to a
standard curve made with the cloned PCR products. The quantities
were normalized to mRNA for the large ribosomal protein P0
(RPLP0). RPLP0 was chosen as internal control, assuming RPLP0
mRNA to be constitutively expressed (14). To validate this assump-
tion, another unrelated “constitutive” RNA, GAPDH mRNA, was
measured and normalized for RPLP0. No changes in the ratio were
observed.
Blood sampling and analysis. Arterialized blood for measurement
of hormones, metabolites, and cytokines was sampled from the
catheter in the hand vein at basal and at termination of the clamp.
Blood was collected in iced tubes and immediately centrifuged at 4°C.
Blood for determination of free fatty acids (FFA), glycerol, and
␤-hydroxybutyrate was stabilized with 10 IU heparin/ml blood. Blood
for determination of insulin, interleukin 6 (IL-6), tumor necrosis
factor-␣(TNF-␣), leptin, and adiponectin was stabilized with 500
kalikrein inhibitory units aprotinin (Trasylol) and 10% EDTA. All
plasma samples were stored at ⫺20°C, except those for FFA, IL-6,
TNF-␣, leptin, and adiponectin, which were stored at ⫺80°C.
Plasma concentrations of insulin, IL-6, TNF-␣, leptin, and adi-
ponectin were measured by sandwich ELISA and performed accord-
ing to the manufacturer’s instructions (insulin: DakoCytomatics; adi-
pokines: R&D Systems, Minneapolis, MN).
Plasma FFA analysis was performed by an enzyme color assay
(ACS-ACOD, WAKO) and performed according to manufacturer’s
instructions. ␤-Hydroxybutyrate was determined by a modification of
the method of Olsen (31). The concentration of glycerol in plasma was
determined by a spectrophotometric method (automatic analyzer Hi-
tachi 912, Roche, Glostrup, Denmark).
Indirect calorimetry. Expiratory gases were measured on the Oxy-
con Pro Online Ventilated hood system (Jaeger). The measured values
were averaged over 10 min of steady state.
Statistics. All data are presented as means ⫾SE, except muscle
mRNA and protein as well as plasma hormones (excluding insulin),
which were log transformed before statistical analysis and are pre-
sented as geometric means ⫾back-transformed SE.
Two-way ANOVA for repeated measurements was used for detec-
tion of differences between the glucose infusion rates before and after
the intermittent fasting. When a significant main effect was observed,
the Student-Newman-Keuls test was used post hoc. In comparison of
a single parameter before, during, and after the experiment, a one-way
ANOVA for repeated measures was used. Comparison of a single
parameter before and after the fasting intervention was performed
with Student’s paired t-test. The SigmaStat version 2.03 software
package was used for all statistical analysis. P⬍0.05 was considered
statistically significant in two-tailed testing.
RESULTS
Weight, Body Composition, and Indexes of Physical Activity
The body weight was maintained stable throughout the
experiment (86.4 ⫾2.3 kg, 0.8 ⫾0.1% coefficient of varia-
tion) and percent body fat was also unchanged before com-
pared with after the fasting intervention (Table 1).
The level of habitual daily physical activity did not decrease
during fasting days. Thus the average heart rate during daytime
was not different during fasting (79 ⫾3 min
⫺1
) compared with
nonfasting days (80 ⫾3 min
⫺1
).
Whole Body Glucose Metabolism
Plasma glucose concentration during both clamps was kept
constant (Fig. 2), with a coefficient of variance of 4.4% ⫾
1.3% mmol/l during the last hour of the clamps.
The glucose infusion rate was significantly increased during
the last 30 min (from 6.3 ⫾0.6 to 7.3 ⫾0.3 mg䡠min
⫺1
䡠kg
⫺1
)
after the fasting intervention compared with before, respec-
tively (P⫽0.03) (Fig. 2).
Glycerol Metabolism in Adipose Tissue
There was no effect of intermittent fasting in either the
adipose tissue blood flow (2.4 ⫾0.5 vs. 2.9 ⫾0.7 ml䡠100
g
⫺1
䡠min
⫺1
at basal and 2.6 ⫾0.5 vs. 3.1 ⫾0.5 ml䡠100
g
⫺1
䡠min
⫺1
at the insulin-stimulated state) or the absolute
interstitial glycerol concentrations (Fig. 3A) during the clamps.
However, the interstitial glycerol concentrations decreased
exponentially with the insulin infusion (R
2
⫽0.96 before and
R
2
⫽0.99 after the fasting intervention), and the negative
slopes of the curves were larger after the fasting intervention
compared with before (P⫽0.05) (Fig. 3B). This indicates that
insulin had an enhanced inhibitory effect on lipolysis after
intermittent fasting compared with before.
Substrates and Metabolites
Fasting (8 h) plasma glucose concentrations were similar
before (5.0 ⫾0.1 mM) and after (5.1 ⫾0.1 mM) the inter-
mittent fasting period. After 20-h fasting, i.e., days 4,6, and 10,
plasma glucose concentrations were lower (4.6 ⫾0.1, 4.6 ⫾
0.1, and 4.7 ⫾0.1 mM, respectively) compared with the
shorter fasting periods (8 h) (P⬍0.05).
Table 2. Primers for real-time RT-PCR
mRNA Sense Primer Antisense Primer
PGC-1␣TCAGACCTGACACAACACGGACA TCAAGAGCAGCAAAAGCATCACA
GAPDH CCTCCTGCACCACCAACTGCTT GAGGGGCCATCCACAGTCTTCT
RPLP0 GGAAACTCTGCATTCTCGCTTCCT CCAGGACTCGTTTGTACCCGTTGM
2130 METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

Fasting (8 h) plasma ␤-hydroxybutyrate, FFA, and glycerol
concentrations were similar before and after the intermittent
fasting period, and all decreased (P⬍0.05) with insulin
infusion (Fig. 4). After 20-h fasting, i.e., days 4,6, and 10,
plasma FFA and glycerol concentrations were increased com-
pared with the shorter fasting periods (P⬍0.05) whereas the
increase in ␤-hydroxybutyrate did not attain statistical signif-
icance (P⫽0.07) (Fig. 4).
Hormones
Fasting (8 h) plasma insulin concentrations were similar
before (33 ⫾5 pM) and after (38 ⫾7 pM) the intermittent
fasting period, and concentrations increased (P⬍0.05) with
insulin infusion (to 439 ⫾63 and 404 ⫾18 pM, respectively).
After 20-h fasting, i.e., days 4,6, and 10, plasma insulin
concentrations were unchanged (24 ⫾4, 24 ⫾5, and 16 ⫾4
pmol/l) compared with the shorter fasting period (Fig. 4).
Plasma adiponectin concentrations did not change with in-
sulin infusion and were similar on the 2 clamp days (Fig. 5).
However, after 20-h fasting (days 6,10, and 14) a 37%
increase was seen compared with the shorter fasting days (P⫽
0.02).
Plasma leptin concentrations were similar on the 2 clamp
days and did not change with insulin infusion (Fig. 5). How-
ever, after the 20-h fasting days (days 6,10, and 14) plasma
leptin concentrations decreased compared with the shorter
fasting days (P⫽0.02) (Fig. 5).
No significant differences were observed in either TNF-␣or
IL-6 concentrations during this study (Fig. 5).
Muscle Triglyceride, Glycogen, GLUT4, and PGC-1
␣
mRNA
No overall changes were observed in concentrations of
IMTG (P⫽0.11), glycogen (P⫽0.26), or mRNA content of
PGC-1␣(P⫽0.18) when measured before and after each
clamp and after fasting on day 10 (Figs. 6 and 7). However,
with insulin stimulation (data from both clamps are included),
we observed a significant decrease (P⫽0.04) in the IMTG
Fig. 3. A: insulin-mediated decrease in interstitial glycerol concentrations in
subcutaneous abdominal adipose tissue before and after a period of intermittent
fasting as measured by microdialysis. Basal values denote microdialysis fluid
collected the last 30 min before the clamp started. During the clamp, microdialysis
fluid was collected in 30-min periods. With insulin stimulation the interstitial
glycerol concentrations followed an exponential drop. B: slope of this exponential
drop. *P⫽0.05 between before and after the intervention. Data are means ⫾SE.
Fig. 2. Glucose infusion rate and glucose concentrations
during the clamps before and after intermittent fasting for 15
days. Left axis (bars) shows the glucose infusion rate (GIR)
necessary to maintain euglycemia during the both clamps.
Right axis (dots) shows the arterialized plasma glucose
concentrations during both experiments. Black bars and dots
represents data from the clamp before the fasting interven-
tion; gray bars and dots are data from after the fasting
intervention. *P⫽0.03 in GIR (taken as an average over the
last 30 min of the clamps) before and after the fasting
intervention. Data are means ⫾SE.
2131METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

concentration. Furthermore, total muscle GLUT4 protein con-
tent did not change with the fasting intervention (P⫽0.66)
(Fig. 7).
Respiratory Exchange Ratios
Respiratory exchange ratios (RER) were similar at basal
(after 8-h fasting) on the 2 clamp days. With insulin stimula-
tion RER increased at both occasions (Fig. 8). No differences
were observed in RER values between the overnight and the
20-h fasted state (Fig. 8).
DISCUSSION
In the present study we have used a very simple intervention
protocol with the aim of mimicking the perturbations in energy
stores that are inherent in a physical active lifestyle with
regular exercise sessions. In a wider perspective we have tried
to unravel the significance of genes that may be responsible for
an evolutionary selection process, i.e., the thrifty genes. In this
context the used intervention seems inevitably small. Never-
theless, by subjecting healthy men to cycles of feast and famine
we did change the metabolic status to the better, implying that
the mismatch between our ancient genotype and the lifestyle of
the westernized individual of today became smaller. To our
knowledge this is the first study in humans in which an
increased insulin action on whole body glucose uptake and
adipose tissue lipolysis has been obtained by means of inter-
mittent fasting. This result is in accordance with previously
reported in rodents (2, 32). In these studies, fasting every
second day increased the insulin sensitivity approximately
sevenfold according to the homeostatic model assessment (2)
and decreased the incidence of diabetes (32).
Prolonged fasting for 72 h with minimal physical activity
has previously been shown to increase IMTG levels in humans
(46). With the present fasting protocol and maintenance of
habitual daily physical activity in the fasting periods, we had
expected to detect a decrease in IMTG content in the skeletal
muscle. The fact that this was not seen and that muscle
glycogen content was unchanged could suggest that skeletal
muscle is not immediately involved in recognition of acute
energy oscillations. There is no doubt, however, that fasting for
20 h while maintaining normal daily physical activity must
cause a temporary negative energy balance larger than nor-
mally experienced in a daily basis. This is also indicated by our
finding of decreased plasma glucose concentrations after 20-h
fasting. We did not have the possibility to estimate the hepatic
glycogen stores, but from animal studies (17) we must infer
that liver glycogen probably also decreased considerably dur-
ing the 20-h fasting periods. It has previously been suggested
that usage of muscle energy depots during fasting would be an
evolutionary disadvantage, because it would lessen the capac-
ity for physical performance and hence the ability to provide
food (i.e., to hunt and gather) during periods of fasting (6, 45).
The present findings support this view.
In contrast to the findings in skeletal muscle, the adipose
tissue responded to the changes in energy balance as intermit-
tent fasting changed the plasma concentrations of the adipo-
cyte-specific hormones leptin and adiponectin. However, be-
cause we did not measure the energy stores in the adipose
Fig. 4. Plasma concentrations of ␤-hydroxy-
butyrate (A), insulin (B), free fatty acids
(FFA) (C), and glycerol (D), before and after
clamps performed before and after 15 days
of intermittent fasting, and after 20 h of
fasting on days 6,10, and 14 of the inter-
mittent fasting intervention. *P⬍0.05 de-
crease during the clamp; †P⬍0.05 increase
during the clamp; ‡P⬍0.05 between the
sample taken after 20 h of fasting compared
with basal samples taken after an overnight
fast (8 h). Data are means ⫾SE.
2132 METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

tissue during the intervention (e.g., by fat cell size), we cannot
determine whether the change in adipokine release is merely a
secondary response to intermittent fasting or whether the adi-
pose tissue is an active recognizer of energy oscillations.
Blood sampling for measurement of adipokines at basal
levels before and after the fasting intervention was performed
at 1000 whereas the three samples on days 6,10, and 14 were
taken at 1700. The amount of circulating adiponectin is con-
stant or slightly decreased during daytime (20). Hence, the
boosts of 37% we observed after each fasting period are not
due to nocturnal variation. Because the plasma adiponectin
concentration is positively correlated to insulin sensitivity in
humans (8, 23, 29) and adiponectin administration in rodents
increases insulin action (9, 38, 48), it seems likely that our
finding of increases in circulating adiponectin after each fasting
period would be able to exert an insulin-sensitizing effect.
Skeletal muscle content of GLUT4 protein after the over-
night fast did not differ before and after the fasting interven-
tion. Future studies will have to determine whether the insulin
signaling, e.g., phosphorylation of the insulin receptor sub-
strate, is influenced by fluctuations in energy stores and thereby
accounts for the increase insulin action as measured by the
clamp method reported herein.
Because 36 h passed between the last fasting period and the
last clamp, it seems most likely that the potential insulin-
sensitizing effects of adiponectin were due to adiponectin-
induced changes in gene expression. This could in turn be
mediated through an AMPK activation that further activates
several transcription factors including myocyte enhancing fac-
tor that increases GLUT4 expression (24, 27). Another possi-
bility is that the adiponectin boosts peroxisome proliferated-
activated receptor-␥(PPAR-␥) expression as seen in 3T3-L1
adipocytes (1). In addition, because PPAR-␥induces adiponec-
tin expression (16), it can be speculated that fasting starts a
positive feedback loop that results in increased levels of both
circulating adiponectin and PPAR-␥. Both are known to in-
crease the insulin sensitivity.
A considerable increase in plasma FFA concentrations (5-
fold) may raise the amount of circulating adiponectin slightly
(43), and glucocorticoids positively regulate adiponectin gene
expression (21). FFA and glucocorticoid increase during fast-
ing, but in previous studies no effect of fasting on circulating
adiponectin was seen (19, 49). Apart from differences in
increases of FFA and glucocorticoids, different analysis meth-
ods used [RIA vs. ELISA (present study)] may recognize
different isoforms of adiponectin and thereby account for the
discrepancy.
Leptin exhibits nocturnal differences with a peak during the
night (2400 – 0800), whereas there is no difference between
1000 and 1700; if anything, plasma leptin concentrations are
slightly higher at 1000 (40). In accordance with previous
findings (19, 41, 49), we found a decrease in circulating leptin
after 8 –20 h of fasting. This decrease most likely reflects a
state of energy deficiency and is probably not involved in the
increased insulin action we have found in the present study.
Fig. 5. Plasma concentrations of adiponectin
(A), leptin (B), IL-6 (C), and TNF-␣(D) before
and after clamps performed before and after 15
days of intermittent fasting, and after 20 h of
fasting on days 6,10, and 14 of the intermittent
fasting intervention. ‡P⬍0.05 between the
sample taken after 20 h of fasting compared
with basal samples taken after an overnight fast
(8 h). Data are geometric means (GeoMean) ⫾
back-transformed SE.
2133METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

The mechanism by which physical training increases whole
body insulin sensitivity is not known in detail. It has previously
been shown that in muscle the effect is mediated via local
contraction dependent mechanisms (11–13), and this could
include exercise-induced oscillations in local energy stores.
However, the insulin-sensitizing effects of exercise and inter-
mittent fasting may not exert their effects via the same path-
way. Although the local effect of exercise is well proven (there
is no transfer of training-induced increase in insulin sensitivity
to nontrained muscle), it is less likely that the effect of
intermittent fasting is a local, muscle phenomenon. Thus even
though we were not able to detect changes in muscle glycogen
and triglyceride content after 20-h fasting, the intervention may
still have exerted the effects via oscillations in other energy
stores (e.g., in adipose tissue or liver). The finding of decreased
leptin concentrations corresponding to the intermittent fasting
verifies that adipocyte metabolism was influenced by the in-
tervention.
We did not find an effect of intermittent fasting on muscle
PGC-1␣mRNA levels. In contrast, PGC-1␣mRNA increases
with acute exercise (34, 47) and is suggested to be involved in
the enhancement of insulin-mediated glucose uptake after ex-
ercise training (28, 39). Thus PGC-1␣may represent a step at
which the insulin enhancement actions of exercise training and
intermittent fasting diverge.
Whole body insulin-mediated glucose uptake was estimated
by the euglycemic hyperinsulinemic clamp technique. Even
though this method is a standard for measuring insulin action,
day-to-day coefficient of variation has been reported to vary
between 2.4 and 15% (4, 36, 42). Part of the observed effect of
Fig. 6. Muscle content of triacylglycerol (IMTG) (A) and glycogen (B) at both
basal and insulin-stimulated state before and after intermittent fasting for 15
days, as well as after 20-h fasting on day 10. Average concentrations of IMTG
decreased (P⫽0.04) with insulin stimulation when data from both clamps are
included. Data are means ⫾SE.
Fig. 7. Muscle content of PGC-1␣mRNA normalized to large ribosomal
protein P0 (RPLP0; A) at both basal and insulin-stimulated state before and
after intermittent fasting for 15 days, as well as after 20-h fasting on day 10.
Muscle content of GLUT4 protein normalized to desmin (B) in the basal state
before and after the intermittent fasting intervention. AU, arbitrary units. Data
are geometric means ⫾back-transformed SE.
Fig. 8. Respiratory exchange rate (RER) at the basal and insulin-stimulated
state before and after a period of intermittent fasting, and after 20 h of fasting
on days 6,10, and 14.*P⬍0.05 increase with insulin stimulation. Data are
means ⫾SE.
2134 METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

the intervention may therefore be due to biological and instru-
mental variation.
It is important to note that, in the present study, the subjects
maintained their body weight throughout the intervention pe-
riod, and percent body fat did not change with intermittent
fasting. Thus, in contrast to previous studies using alternate-
day fasting (22), the subjects in the present study kept their
body weight by following the dietary instructions of eating
abundantly every other day. It is well known that insulin
sensitivity can be influenced by long-term profound changes of
macronutrients in the diet. However, because the subjects were
instructed to maintain their usual diet habits (although increas-
ing the amount of food), it is unlikely that eventual minor
changes in the macronutrient mix during 8 nonconsecutive
days (i.e., the nonfasting days) would influence insulin sensi-
tivity.
Furthermore, the increased insulin action after the interven-
tion was not the result of the last fasting period because from
the last fasting period until the beginning of the overnight fast
the subjects were allowed to eat for 30 h during which they
consumed at least 250 g of carbohydrates. Muscle glycogen
was not different between the pre- and postintervention
clamps, testifying that carbohydrate loading was sufficient
before each clamp experiment.
In keeping with previous findings (3), we observed a de-
crease in IMTG with insulin stimulation. At first glance this
seems counterintuitive. However, during insulin stimulation
the FFA supply to the skeletal muscle decreases dramatically,
and because some skeletal muscle FFA oxidation is still
present (RER values of 0.90 ⫾0.04 before and 0.86 ⫾0.02
after the fasting intervention), it seems arguable that FFA is
provided by the IMTG pool, which accordingly will decrease.
In conclusion, the findings that intermittent fasting increases
insulin sensitivity on the whole body level as well as in adipose
tissue support the view that cycles of feast and famine are
important as an initiator of thrifty genes leading to improve-
ments in metabolic function (6). We suggest that a fasting-
induced increase in circulating adiponectin is at least partly
responsible for this finding. The change in adiponectin, to-
gether with changes in plasma leptin with fasting, underlines
the important role of the adipose tissue in recognizing the
oscillation in energy stores. Finally, the data indicate that
intermittent fasting and physical training may increase insulin
action via different mechanisms because muscle energy stores
did not change with the present fasting intervention.
ACKNOWLEDGMENTS
We thank Regitze Krausø, Jeppe Bach, Thomas Beck, Christina Bøg
Sørensen, and Gerda Hau for expert technical assistance.
GRANTS
This study was funded by Fabrikant Vilhelm Pedersen og hustrus mindel-
egat, Danish Diabetes Association, Fonden af 1870, Direktør Jacob Madsen og
hustru Olga Madsens Fond, Rigshospitalet, Hovedstadens Sygehusfællesskab
(H:S), University of Copenhagen, and The Novo Nordisk Foundation.
REFERENCES
1. Ajuwon KM and Spurlock ME. Adiponectin inhibits LPS-induced
NF-␬B activation and IL-6 production, and increases PPAR␥2 expression
in adipocytes. Am J Physiol Regul Integr Comp Physiol 288: R1220–
R1225, 2005.
2. Anson RM, Guo Z, De CR, Iyun T, Rios M, Hagepanos A, Ingram
DK, Lane MA, and Mattson MP. Intermittent fasting dissociates bene-
ficial effects of dietary restriction on glucose metabolism and neuronal
resistance to injury from calorie intake. Proc Natl Acad Sci USA 100:
6216 – 6220, 2003.
3. Boden G, Lebed B, Schatz M, Homko C, and Lemieux S. Effects of
acute changes of plasma free fatty acids on intramyocellular fat content
and insulin resistance in healthy subjects. Diabetes 50: 1612–1617, 2001.
4. Bokemark L, Froden A, Attvall S, Wikstrand J, and Fagerberg B. The
euglycemic hyperinsulinemic clamp examination: variability and repro-
ducibility. Scand J Clin Lab Invest 60: 27–36, 2000.
5. Bulow J, Jelnes R, Astrup A, Madsen J, and Vilmann P. Tissue/blood
partition coefficients for xenon in various adipose tissue depots in man.
Scand J Clin Lab Invest 47: 1–3, 1987.
6. Chakravarthy MV and Booth FW. Eating, exercise, and “thrifty”
genotypes: connecting the dots toward an evolutionary understanding of
modern chronic diseases. J Appl Physiol 96: 3–10, 2004.
7. Chomczynski P and Sacchi N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Bio-
chem 162: 156 –159, 1987.
8. Cnop M, Havel PJ, Utzschneider KM, Carr DB, Sinha MK, Boyko EJ,
Retzlaff BM, Knopp RH, Brunzell JD, and Kahn SE. Relationship of
adiponectin to body fat distribution, insulin sensitivity and plasma lipopro-
teins: evidence for independent roles of age and sex. Diabetologia 46:
459 – 469, 2003.
9. Combs TP, Pajvani UB, Berg AH, Lin Y, Jelicks LA, Laplante M,
Nawrocki AR, Rajala MW, Parlow AF, Cheeseboro L, Ding YY,
Russell RG, Lindemann D, Hartley A, Baker GR, Obici S, Deshaies Y,
Ludgate M, Rossetti L, and Scherer PE. A transgenic mouse with a
deletion in the collagenous domain of adiponectin displays elevated
circulating adiponectin and improved insulin sensitivity. Endocrinology
145: 367–383, 2004.
10. Dela F. On the influence of physical training on glucose homeostasis. Acta
Physiol Scand Suppl 635: 1– 41, 1996.
11. Dela F, Larsen JJ, Mikines KJ, Ploug T, Petersen LN, and Galbo H.
Insulin-stimulated muscle glucose clearance in patients with NIDDM.
Effects of one-legged physical training. Diabetes 44: 1010–1020, 1995.
12. Dela F, Mikines KJ, Von LM, Secher NH, and Galbo H. Effect of
training on insulin-mediated glucose uptake in human muscle. Am J
Physiol Endocrinol Metab 263: E1134 –E1143, 1992.
13. Dela F, Ploug T, Handberg A, Petersen LN, Larsen JJ, Mikines KJ,
and Galbo H. Physical training increases muscle GLUT4 protein and
mRNA in patients with NIDDM. Diabetes 43: 862– 865, 1994.
14. Dheda K, Huggett JF, Bustin SA, Johnson MA, Rook G, and Zumla
A. Validation of housekeeping genes for normalizing RNA expression in
real-time PCR. Biotechniques 37: 112–119, 2004.
15. Eaton SB, Strassman BI, Nesse RM, Neel JV, Ewald PW, Williams
GC, Weder AB, Eaton SB III, Lindeberg S, Konner MJ, Mysterud I,
and Cordain L. Evolutionary health promotion. Prev Med 34: 109 –118,
2002.
16. Evans RM, Barish GD, and Wang YX. PPARs and the complex journey
to obesity. Nat Med 10: 355–361, 2004.
17. Exton JH, Corbin JG, and Harper SC. Control of gluconeogenesis in
liver. V. Effects of fasting, diabetes, and glucagon in lactate and endog-
enous metabolism in the perfused rat liver. J Biol Chem 247: 4996–5003,
1972.
18. Frayn KN and Maycock PF. Skeletal muscle triacylglycerol in the rat:
methods for sampling and measurement, and studies of biological vari-
ability. J Lipid Res 21: 139 –144, 1980.
19. Gavrila A, Chan JL, Yiannakouris N, Kontogianni M, Miller LC,
Orlova C, and Mantzoros CS. Serum adiponectin levels are inversely
associated with overall and central fat distribution but are not directly
regulated by acute fasting or leptin administration in humans: cross-
sectional and interventional studies. J Clin Endocrinol Metab 88: 4823–
4831, 2003.
20. Gavrila A, Peng CK, Chan JL, Mietus JE, Goldberger AL, and
Mantzoros CS. Diurnal and ultradian dynamics of serum adiponectin in
healthy men: comparison with leptin, circulating soluble leptin receptor,
and cortisol patterns. J Clin Endocrinol Metab 88: 2838–2843, 2003.
21. Halleux CM, Takahashi M, Delporte ML, Detry R, Funahashi T,
Matsuzawa Y, and Brichard SM. Secretion of adiponectin and regula-
tion of apM1 gene expression in human visceral adipose tissue. Biochem
Biophys Res Commun 288: 1102–1107, 2001.
2135METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from

22. Heilbronn LK, Smith SR, Martin CK, Anton SD, and Ravussin E.
Alternate-day fasting in nonobese subjects: effects on body weight, body
composition, and energy metabolism. Am J Clin Nutr 81: 69–73, 2005.
23. Higashiura K, Ura N, Ohata J, Togashi N, Takagi S, Saitoh S,
Murakami H, Takagawa Y, and Shimamoto K. Correlations of adi-
ponectin level with insulin resistance and atherosclerosis in Japanese male
populations. Clin Endocrinol (Oxf) 61: 753–759, 2004.
24. Holmes B and Dohm GL. Regulation of GLUT4 gene expression during
exercise. Med Sci Sports Exerc 36: 1202–1206, 2004.
25. Karlsson J, Diamant B, and Saltin B. Muscle metabolites during
submaximal and maximal exercise in man. Scand J Clin Lab Invest 26:
385–394, 1970.
26. Larsen OA, Lassen NA, and Quaade F. Blood flow through human
adipose tissue determined with radioactive xenon. Acta Physiol Scand 66:
337–345, 1966.
27. Leff T. AMP-activated protein kinase regulates gene expression by direct
phosphorylation of nuclear proteins. Biochem Soc Trans 31: 224–227,
2003.
28. McCarty MF. Up-regulation of PPARgamma coactivator-1alpha as a
strategy for preventing and reversing insulin resistance and obesity. Med
Hypotheses 64: 399 – 407, 2005.
29. Murakami H, Ura N, Furuhashi M, Higashiura K, Miura T, and
Shimamoto K. Role of adiponectin in insulin-resistant hypertension and
atherosclerosis. Hypertens Res 26: 705–710, 2003.
30. Neel JV. Diabetes mellitus: a “thrifty” genotype rendered detrimental by
“progress”? Am J Hum Genet 14: 353–362, 1962.
31. Olsen C. An enzymatic fluorimetric micromethod for the determination of
acetoacetate, -hydroxybutyrate, pyruvate and lactate. Clin Chim Acta 33:
293–300, 1971.
32. Pedersen CR, Hagemann I, Bock T, and Buschard K. Intermittent
feeding and fasting reduces diabetes incidence in BB rats. Autoimmunity
30: 243–250, 1999.
33. Peters SJ, Dyck DJ, Bonen A, and Spriet LL. Effects of epinephrine on
lipid metabolism in resting skeletal muscle. Am J Physiol Endocrinol
Metab 275: E300 –E309, 1998.
34. Pilegaard H, Saltin B, and Neufer PD. Exercise induces transient
transcriptional activation of the PGC-1alpha gene in human skeletal
muscle. J Physiol 546: 851– 858, 2003.
35. Ploug T, Stallknecht BM, Pedersen O, Kahn BB, Ohkuwa T, Vinten J,
and Galbo H. Effect of endurance training on glucose transport capacity
and glucose transporter expression in rat skeletal muscle. Am J Physiol
Endocrinol Metab 259: E778 –E786, 1990.
36. Scheen AJ, Paquot N, Castillo MJ, and Lefebvre PJ. How to measure
insulin action in vivo. Diabetes Metab Rev 10: 151–188, 1994.
37. Scheller D and Kolb J. The internal reference technique in microdialysis:
a practical approach to monitoring dialysis efficiency and to calculating
tissue concentration from dialysate samples. J Neurosci Methods 40:
31–38, 1991.
38. Shklyaev S, Aslanidi G, Tennant M, Prima V, Kohlbrenner E, Krou-
tov V, Campbell-Thompson M, Crawford J, Shek EW, Scarpace PJ,
and Zolotukhin S. Sustained peripheral expression of transgene adi-
ponectin offsets the development of diet-induced obesity in rats. Proc Natl
Acad Sci USA 100: 14217–14222, 2003.
39. Short KR, Vittone JL, Bigelow ML, Proctor DN, Rizza RA, Coenen-
Schimke JM, and Nair KS. Impact of aerobic exercise training on
age-related changes in insulin sensitivity and muscle oxidative capacity.
Diabetes 52: 1888 –1896, 2003.
40. Sinha MK, Ohannesian JP, Heiman ML, Kriauciunas A, Stephens
TW, Magosin S, Marco C, and Caro JF. Nocturnal rise of leptin in lean,
obese, and noninsulin-dependent diabetes mellitus subjects. J Clin Invest
97: 1344 –1347, 1996.
41. Sinha MK, Opentanova I, Ohannesian JP, Kolaczynski JW, Heiman
ML, Hale J, Becker GW, Bowsher RR, Stephens TW, and Caro JF.
Evidence of free and bound leptin in human circulation. Studies in lean
and obese subjects and during short-term fasting. J Clin Invest 98:
1277–1282, 1996.
42. Soop M, Nygren J, Brismar K, Thorell A, and Ljungqvist O. The
hyperinsulinaemic-euglycaemic glucose clamp: reproducibility and meta-
bolic effects of prolonged insulin infusion in healthy subjects. Clin Sci
(Lond) 98: 367–374, 2000.
43. Staiger H, Tschritter O, Kausch C, Lammers R, Stumvoll M, and
Haring HU. Human serum adiponectin levels are not under short-term
negative control by free fatty acids in vivo. Horm Metab Res 34: 601– 603,
2002.
44. Stallknecht B, Simonsen L, Bulow J, Vinten J, and Galbo H. Effect of
training on epinephrine-stimulated lipolysis determined by microdialysis
in human adipose tissue. Am J Physiol Endocrinol Metab 269: E1059 –
E1066, 1995.
45. Stannard SR and Johnson NA. Insulin resistance and elevated triglyc-
eride in muscle: more important for survival than “thrifty” genes?
J Physiol 554: 595– 607, 2004.
46. Stannard SR, Thompson MW, Fairbairn K, Huard B, Sachinwalla T,
and Thompson CH. Fasting for 72 h increases intramyocellular lipid
content in nondiabetic, physically fit men. Am J Physiol Endocrinol Metab
283: E1185–E1191, 2002.
47. Vissing K, Andersen JL, and Schjerling P. Are exercise-induced genes
induced by exercise? FASEB J 19: 94 –96, 2005.
48. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori
Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma
Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K,
Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel
P, and Kadowaki T. The fat-derived hormone adiponectin reverses
insulin resistance associated with both lipoatrophy and obesity. Nat Med 7:
941–946, 2001.
49. Zhang Y, Matheny M, Zolotukhin S, Tumer N, and Scarpace PJ.
Regulation of adiponectin and leptin gene expression in white and brown
adipose tissues: influence of beta3-adrenergic agonists, retinoic acid, leptin
and fasting. Biochim Biophys Acta 1584: 115–122, 2002.
2136 METABOLIC EFFECTS OF INTERMITTENT FASTING
J Appl Physiol •VOL 99 •DECEMBER 2005 •www.jap.org
on September 30, 2009 jap.physiology.orgDownloaded from