Lack of Support for the Association between GAD2 Polymorphisms and Severe Human Obesity

Article (PDF Available)inPLoS Biology 3(9):e315 · October 2005with34 Reads
DOI: 10.1371/journal.pbio.0030315 · Source: PubMed
Abstract
The demonstration of association between common genetic variants and chronic human diseases such as obesity could have profound implications for the prediction, prevention, and treatment of these conditions. Unequivocal proof of such an association, however, requires independent replication of initial positive findings. Recently, three (-243 A>G, +61450 C>A, and +83897 T>A) single nucleotide polymorphisms (SNPs) within glutamate decarboxylase 2 (GAD2) were found to be associated with class III obesity (body mass index > 40 kg/m2). The association was observed among 188 families (612 individuals) segregating the condition, and a case-control study of 575 cases and 646 lean controls. Functional data supporting a pathophysiological role for one of the SNPs (-243 A>G) were also presented. The gene GAD2 encodes the 65-kDa subunit of glutamic acid decarboxylase-GAD65. In the present study, we attempted to replicate this association in larger groups of individuals, and to extend the functional studies of the -243 A>G SNP. Among 2,359 individuals comprising 693 German nuclear families with severe, early-onset obesity, we found no evidence for a relationship between the three GAD2 SNPs and obesity, whether SNPs were studied individually or as haplotypes. In two independent case-control studies (a total of 680 class III obesity cases and 1,186 lean controls), there was no significant relationship between the -243 A>G SNP and obesity (OR = 0.99, 95% CI 0.83-1.18, p = 0.89) in the pooled sample. These negative findings were recapitulated in a meta-analysis, incorporating all published data for the association between the -243G allele and class III obesity, which yielded an OR of 1.11 (95% CI 0.90-1.36, p = 0.28) in a total sample of 1,252 class III obese cases and 1,800 lean controls. Moreover, analysis of common haplotypes encompassing the GAD2 locus revealed no association with severe obesity in families with the condition. We also obtained functional data for the -243 A>G SNP that does not support a pathophysiological role for this variant in obesity. Potential confounding variables in association studies involving common variants and complex diseases (low power to detect modest genetic effects, overinterpretation of marginal data, population stratification, and biological plausibility) are also discussed in the context of GAD2 and severe obesity.

Figures

Lack of Support for the Association
between GAD2 Polymorphisms
and Severe Human Obesity
Michael M. Swarbrick
1[
, Bjo
¨
rn Waldenmaier
2[
, Len A. Pennacchio
3
, Denise L. Lind
4
, Martha M. Cavazos
1
, Frank Geller
5
,
Raphael Merriman
6
, Anna Ustaszewska
3
, Mary Malloy
4
, Andre
´
Scherag
5
, Wen-Chi Hsueh
1
, Winfried Rief
7
,
Franck Mauvais-Jarvis
8
, Clive R. Pullinger
4
, John P. Kane
4
, Robert Dent
9
, Ruth McPherson
10
, Pui-Yan Kwok
4
,
Anke Hinney
2
, Johannes Hebebrand
2
, Christian Vaisse
1*
1 Diabetes Center, University of California, San Fra ncisco, California, United States of America, 2 Department of Child and Adolescent Psychiatry, University of Duisburg-
Essen, Essen, Germany, 3 Department of Energy Joint Genome Institute, Walnut Creek, California, United States of America, 4 Cardiovascular Research Institute, University of
California, San Francisco, California, United States of America, 5 Institute of Medical Biometry and Epidemiology, Phillips-University of Marburg, Marburg, Germany,
6 Department of Medicine, University of California, San Francisco, California, United States of America, 7 Department of Psychology, University of Marburg, Marburg,
Germany, 8 Division of Diabetes, Endocrinology and Metabolism, Baylor College of Medicine, Houston, Texas, United States of America, 9 Ottawa Health Research Institute,
Ottawa, Ontario, Canada, 10 University of Ottawa Heart Institute, Ottawa, Ontario, Canada
The demonstration of association between common genetic variants and chronic human diseases such as obesity could
have profound implications for the prediction, prevention, and treatment of these conditions. Unequivocal proof of
such an association, however, requires independent replication of initial positive findings. Recently, three (243 A.G,
þ61450 C.A, and þ83897 T.A) single nucleotide polymorphisms (SNPs) within glutamate decarboxylase 2 (GAD2)
were found to be associated with class III obesity (body mass index . 40 kg/m
2
). The association was observed among
188 families (612 individuals) segregating the condition, and a case-control study of 575 cases and 646 lean controls.
Functional data supporting a pathophysiological role for one of the SNPs (243 A.G) were also presented. The gene
GAD2 encodes the 65-kDa subunit of glutamic acid decarboxylase—GAD65. In the present study, we attempted to
replicate this association in larger groups of individuals, and to extend the functional studies of the 243 A.G SNP.
Among 2,359 individuals comprising 693 German nuclear families with severe, early-onset obesity, we found no
evidence for a relationship between the three GAD2 SNPs and obesity, whether SNPs were studied individually or as
haplotypes. In two independent case-control studies (a total of 680 class III obesity cases and 1,186 lean controls),
there was no significant relationship between the 243 A.G SNP and obesity (OR ¼ 0.99, 95% CI 0.83–1.18, p ¼ 0.89) in
the pooled sample. These negative findings were recapitulated in a meta-analysis, incorporating all published data for
the association between the 243G allele and class III obesity, which yielded an OR of 1.11 (95% CI 0.90–1.36, p ¼ 0.28)
in a total sample of 1,252 class III obese cases and 1,800 lean controls. Moreover, analysis of common haplotypes
encompassing the GAD2 locus revealed no association with severe obesity in families with the condition. We also
obtained functional data for the 243 A.G SNP that does not support a pathophysiological role for this variant in
obesity. Potential confounding variables in association studies involving common variants and complex diseases (low
power to detect modest genetic effects, overinterpretation of marginal data, population stratification, and biological
plausibility) are also discussed in the context of GAD2 and severe obesity.
Citation: Swarbrick MM, Waldenmaier B, Pennacchio LA, Lind DL, Cavazos MM, et al. (2005) Lack of support for the association between GAD2 polymorphisms and severe
human o besity. PLoS Biol 3(9): e315.
Introduction
By dramatically increasing mortality [1] and morbidity [2]
from cardiovascular disease, obesity has emerged as a major
public health issue for the 21st century. Obesity is strongly
associated with type 2 diabetes, hypertension, dyslipidemia,
heart failure, and stroke [3]. This burden of disease is
particularly high in individuals with class III obesity (body
mass index [BMI] . 40 kg/m
2
), as they are more likely to
develop at least one of these co-morbidities [4].
The importance of genetic factors in determining suscep-
tibility to obesity has been well established elsewhere, by
studies of twins [5], and adoptees [6]. At present, there is
support for a model in which the propensity to become obese
is determined largely by genetic factors, with environmental
factors determining the expression of the condition [7]. These
genetic influences are likely to be particularly powerful in
individuals with severe or early-onset forms of obesity [8].
While several rare monogenic forms of non-syndromic
Received December 1, 2004; Accepted July 11, 2005; Published August 30, 2005
DOI: 10.1371/journal.pbio.0030315
Copyright: Ó 2005 Swarbrick et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provide d the original work is
properly cited.
Abbreviations: BMI, body mass index; bp, base pair; CI, confidence interval; EMSA,
electrophoretic mobility shift assay; GABA, c-aminobutyric acid; OR, odds ratio;
PDT, pedigree disequilibrium test; SNP, single nucleotide polymorphism; WT, wild-
type
Academic Editor: Lon Cardon, University of Oxford, United Kingdom
*To whom correspondence should be addressed. E-mail: vaisse@diabetes.ucsf.edu
[These authors contributed equally to this work.
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151662
Open access, freely available online
P
L
o
S
BIOLOGY
obesity have been described to date [9–13], efforts aimed at
identifying common susceptibility alleles for the condition
have been much less successful [14].
The Chromosome 10p12 region has previously demonstra-
ted significant linkage with severe human obesity [15]. In the
initial stu dy [15] involving individuals ascertained by a
proband with class III obesity (BMI . 40 kg/m
2
) and at least
one sibling with BMI . 27 kg/m
2
, strong evidence for linkage
(maximum logarithm of odds score 4.85) was obtained at the
marker D10S197. The linkage peak encompassed a region of
approximately 15 centimorgans. Confirmation of this linkage,
albeit at lower levels of significance, was obtained in German
Caucasians [16] and a combined sample of Caucasian
Americans and African Americans [17]. The marker
D10S197 is loc ated wit hin int ron 7 of the glutam ate
decarboxylase 2 (GAD2) gene, which encodes the 65-kDa
subunit of glutamic acid decarboxylase—GAD65.
Recently, Boutin et al. [18] obtained evidence to implicate
GAD2 as a candidate gene for human obesity. In a case-control
study for class III obesity, the authors identified both a
haplotype (consisting of the most frequent alleles of single
nucleotide polymorphisms [SNPs] þ61450 C.A and þ83897
T.A), and a SNP (243 A.G) within GAD2 that differed in
frequency between cases and controls. In family-based tests of
association involving 612 individuals from 188 nuclear
families, the þ61450 C.Aandþ83897 T.ASNPswere
associated with class III obesity. The ‘‘ protective’’ wild-type
(WT) haplotype (þ61450 C andþ83897 T) identified in the case-
control study was found to be in excess in unaffected offspring.
As the GAD2 variant allele 243 G was in the 59 region of
the gene (the other two SNPs were located in intronic
regions), displayed the strongest association with class III
obesity in the case-control study, and was in linkage
disequilibrium with the þ61450 C.A and þ83897 T.A SNPs,
functional studies were performed to test its effects on
transcription and nuclear protein binding. In a luciferase
reporter gene containing the GAD2 promoter, the 243 G
allele increased the transcriptional activity 6-fold relative to
an equivalent reporter gene containing the WT (243 A)
allele in bTC3 murine insulinoma cells. Also, relative to the
WT (A) allele, oligonucleotide probes containing the variant
(G) allele had a higher affinity for an unidentified nuclear
protein from bTC3 cells. Overall, their results suggested that
the GAD2 243 G allele might not only constitute a genetic
marker for class III human obesity, but may also exert a
significant physiological effect.
In recent years, many unreplicated associations have been
reported between common gene tic polymorphisms and
measures of adiposity [19,20]. Indeed, one of the significant
challenges in genetic association studies is the presence of
statistical trends towards susceptibility (with the suspected
allele being neither sufficient nor necessary for disease
expression), rather than clear cause-and-effect relationships.
This factor reduces the power of individual studies; con-
sequently, it has become critical to develop larger multi-
center studies to confirm positive associations in other
populations, and to perform meta-analyses to more accu-
rately estimate the magnitude of the genetic effect [21]. In the
present study, we attempted to replicate the recent findings
of Boutin et al. [18] by performing family-based tests of
association and case- control studies in three Caucasian
populations.
Results
Family-Based Tests of Association
In the previous report [18], an excess of WT alleles was
observed in unaffected offspring for the þ61450 C.A and
þ83897 T.A SNPs (p ¼ 0.03 for each), and the haplotype
consisting of the WT alleles at these SNPs was found to be in
excess in unaffected offspring (p ¼ 0.05). However, excess
transmission of the G allele of the 243 A.G SNP to affected
offspring was not observed (p ¼ 0.06).
To further assess these initial findings in a much larger
cohort, we performed family-based tests of association in
2,359 German Caucasian individuals from 693 nuclear
families. Nuclear families were composed of obese children
(mean BMI percentile ¼ 98.6 6 2.3, range 90th–100th
percentile), their obese siblings, and both of their parents.
The clinical characteristics of the nuclear families segregating
obesity are shown in Table 1. This group of individuals
included the 89 families that had previousl y displayed
suggestive linkage for obesity (maximum likelihood binomial
logarithm of odds score of 2.24) at D10S197 [22].
Using the pedigree disequilibrium test (PDT) [23], we found
no evidence for excess transmission of any GAD2 alleles to
obese children in the 89 families displaying prior linkage of
obesity to Chromosome 10p (Table 2). This finding alone
suggested that the original linkage signal in this region might
be due to different SNPs than the ones under study. We next
included samples that were not previously tested for linkage,
bringing the total group to 693 nuclear families. As in the
linked families, we found no association between any of the
GAD2 SNPs and obesity (Table 2). Similarly, studies of
haplotype transmission in the entire group using the trans-
miss ion d isequilibri um te st (TDT) did not provide any
evidence for a ‘‘ protective’’ haplotype consisting of the
þ61450 C and þ83897 T alleles, or any other two- or three-
allele GAD2 haplotypes (Table 3).
Case-Control Studies
Previously [18], the 243 A . G, þ61450 C.A, and þ83897
T.A SNPs were associated with class III obesity in one case-
control group (349 obese cases and 376 nonobese controls),
whereas the association between the 243 A.G SNP and
obesity was significant in the pooled sample of 575 obese
cases and 646 controls (odds ratio [OR] of 1.3, 95%
confidence interval [CI] 1.053–1.585, p ¼ 0.014). We attempted
to replicate these associations by performing case-control
studies of class III obesity in two groups of North American
Caucasians, one from the United States and the other from
Canada. The clinical characteristics of the participants used
in the case-control studies are shown in Table 1.
US case-control study. Each of the three GAD2 poly-
morphisms (243 A.G, þ61450 C.A, and þ83897 T.A) was
found to be in Hardy-Weinberg equilibrium in 302 class III
obese (BMI . 40 kg/m
2
) cases and 427 lean controls (Table 4).
None of the three variant alleles were associated with class III
obesity (243 G allele and class III obesity [OR ¼ 1.11, 95% CI
0.84–1.46, p ¼ 0.45]; the þ61450 A allele [OR ¼ 1.25, 95% CI
0.99–1.57, p ¼ 0.058]; the þ83897 A allele [OR ¼ 1.14, 95% CI
0.87–1.50, p ¼ 0.33]). Moreover, within the obese and lean
groups, there was no association between GAD2 genotype and
BMI for any of the three SNPs studied (unpublished data).
Canadian case-control study. The Canadian participants
were also genotyped for the GAD2 243 A.G, þ61450 C.A,
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151663
GAD2 Polymorphisms and Obesity
and þ83897 T.A SNPs. Genotypes of both cases and controls
conformed to Hardy-Weinberg equilibrium, and the allele
frequencies were similar to those observed in US Caucasians
(Table 5).
As for US participants, the frequency of the 243 G allele
did not differ between a group of 378 class III obese Canadian
participants (frequency ¼ 0.160) and a group of 759 lean
controls (frequency ¼ 0.175). The 243 G allele was not
associated with class III obesity in this case-control study (OR
¼ 0.90, 95% CI 0.71–1.14, p ¼ 0.39). Pooling the results from
the US and Canadian studies (680 class III obese cases and
1,186 lean controls) did not provide significant evidence for
an association between the 243 G allele and class III obesity
(OR ¼ 0.99, 95% CI 0.83–1.18, p ¼ 0.89).
Meta-analysis for the 243 A.G variant. It has been
proposed elsewhere [24] that the interpretation of results
from association studies may be aided by meta-analysis of all
similar studies. We compiled all available genotyping data
(ours and that of the previous GAD2 study [18]) pertaining to
the relationship between the 243 A.G polymorphism and
class III obesity, and performed a meta-analysis (Figure 1).
Inclusion of the data from the original study and our two
case-control studies (a total of 1,252 cases and 1,800 controls)
yielded an OR of 1.11 (95% CI 0.90–1.36) for the association
between the 243 G allele and class III obesity.
Further Investigation of GAD2 as a Candidate Gene for
Severe Obesity
In order to evaluate the potential relationship between
other common SNPs in GAD2 and severe obesity, we
conducted a comprehensive investigation of haplotype
structure in this region using the data from the International
HapMap Project (http://www.hapmap.org/cgi-perl/gbrowse/
gbrowse/hapmap) and Haploview (http://www.broad.mit.edu/
mpg/haploview/index.php) [25]. As described earlier b y
Boutin et al., GAD2 (and 2 kilobases of its promoter) lies
within a 90-kil obase block of linkage disequilibrium on
Chromosome 10p12 (Figure S1). Two of the three SNPs used
in this study, 243 A.G (rs2236418) an d þ83897 T.A
(rs928197), were used in the construction of HapMap. To
incorporate the data from the third SNP, þ61450 C.A
(rs992990), into this framework, we genotyped the same
CEPH (Centre D’e´tude du Polymorphisme Humain) samples
(Utah residents with ancestry from northern and western
Europe) that were used in the creation of the map. When the
genotype results from the þ61450 C.A SNP were integrated
with those from HapMap, the overall structure of the
haplotype block did not change. To capture at least 95% of
the haplotype diversity within this haplotype block, we then
determined that genotyping of three more SNPs was
required: rs3781117 (intron 4), rs3781118 (intron 4), and
rs1330581 (intron 7) (Figure S2).
The German families and case-control participants from
the US and Canada were genotyped for the SNPs rs3781117,
rs3781118, and rs1330581. None of these three SNPs were
transmitted to affected children more freque ntly than
expected by chance (Table S1). Inclusion of these GAD2 SNPs
with the original three did not yield significant results for
association between any GAD2 haplotype and obesity (Table
Table 1. Clinical Characteristics of Participants Used for Family-Based Association and Case-Control Studies
Group Sub-Group n Participants Sex (M/F) Age (y) 6 SD BMI (kg/m
2
) 6 SD
German nuclear families Parents 1,386 693/693 43 6 6 30.4 6 6.1
Children 973 433/540 14 6 4 31.0 6 6.0
US case-control Class III obese 302 90/212 50 6 12 48.5 6 10.1
Lean controls 427 141/286 52 6 5 22.9 6 1.4
Canadian case-control Class III obese 378 139/239 46 6 10 47.6 6 7.8
Lean controls 759 304/455 45 6 15 20.2 6 1.9
DOI: 10.1371/journal.pbio.0030315.t001
Table 2. PDT Results for GAD2 SNPs in 693 German Families Segregating Severe, Early-Onset Obesity
SNP n Trios Allele Transmitted Untransmitted v
2
(df) p-Values
In the 89 Families Linked to Chromosome 10p
243 A. G 187 A 311 312 0.01 (1) 0.93
G63 62
þ61450 C.A 187 C 282 273 0.49 (1) 0.48
A92 101
þ83897 T .A 188 T 308 311 0.06 (1) 0.81
A68 65
In All 693 Nuclear Families with Obesity 243 A.G 956 A 1,590 1,578 0.20 (1) 0.65
G 322 334
þ61450 C.A 956 C 1,404 1,379 0.92 (1) 0.34
A 508 533
þ83897 T .A 957 T 1,590 1,575 0.67 (1) 0.41
A 324 339
DOI: 10.1371/journal.pbio.0030315.t002
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151664
GAD2 Polymorphisms and Obesity
6). Moreover, rs3781117, rs3781118, and rs1330581 were not
independently associated with class III obesity in either the
US or Canadian case-control study groups (Table S2).
Ethnic differences in GAD2 allele frequency. The presence
of an underlying population substructure, resulting from
ethnic admixture, is a common bias in association studies
[26]. We were therefore interested in determining whether
different ethnic groups could display significant differences
in GAD2 allele frequency.
In samples obtained from the Human Variation Collection
(Coriell Institute for Medical Research, Camden, New Jersey,
United States), the frequencies of GAD2 alleles in Caucasians
were comparable with those observed for the Caucasian
groups tested in previous studies (Table S3). However, we
observed marked and highly significant differences in allele
frequency for the 243 A.G SNP between Caucasians and
populations of West African origin represented by samples
collected in the US or in France. North African populations
presented an intermediate allelic distribution.
Reporter Gene Assay for GAD2 243 G Promoter Variant
In addition to the aforementioned genetic results, Boutin et
al. [18] also found that luciferase reporter genes containing the
243 G allele in the GAD2 promoter (from1710 to4, relative
to the transcriptional start site) displayed a 6-fold higher
activity compared to reporter genes containing the 243A
allele in bTC3 murine insulinoma cells (Figure 3 in [18]). We
were interested in investigating the nature of this allele-
specific difference in GAD2 promoter activity, with the goal of
identifying the specific cis-acting elements responsible. To
accomplish this, we also tested the effect of the 243 A.G SNP
on transcription of a luciferase reporter gene in bTC3 cells.
We found that introduction of the 243 G allele into the
1710/4 reporter gene did not elicit detectable effects on
luciferase transcription relative to the WT reporter gene
(Figure S3). Similarly, we could not detect any allele-specific
effects of the 243 A.G polymorphism in two smaller
reporter genes containing the GAD2 promoter (from 501
to 4 and from 1,234 to 4). However, the transcriptional
activity of our WT 1710/4 reporter gene was appreciably
higher than that of pGL3Basic in bTC3 cells, suggesting that
the GAD2 promoter does exhibit some basal transcriptional
activity in this cell line.
Table 4. Genotype Results for US Case-Control Study
SNP n (Frequency) Allele Frequency v
2
(df) p-Values
AA AG GG A G
243 A. G Cases 203 (0.67) 87 (0.29) 12 (0.04) 0.816 0.184 0.56 (1) 0.45
Controls 293 (0.69) 124 (0.29) 10 (0.02) 0.831 0.169
CC CA AA C A
þ61450 C.A Cases 148 (0.49) 120 (0.40) 34 (0.11) 0.689 0.311 3.59 (1) 0.058
Controls 228 (0.53) 171 (0.40) 28 (0.07) 0.734 0.266
TT TA AA T A
þ83897 T .A Cases 198 (0.66) 92 (0.30) 12 (0.04) 0.808 0.192 0.95 (1) 0.33
Controls 291 (0.68) 125 (0.29) 11 (0.03) 0.828 0.172
The GAD2 SNPs 243A.G, þ61450C.A, and þ83897T.A are also referred to as rs2236418, rs992990, and rs928197 in the text.
DOI: 10.1371/journal.pbio.0030315.t004
Table 3. Analysis of Haplotype Transmission in German Obesity Trios Using the TDT
243 A.G þ61450 C.A þ83897 T.A Transmitted/Untransmitted (% Transmitted) v
2
p-Values
A C - 225/213 (51.4%) 0.33 0.57
A A - 112/113 (49.8%) 0.00 0.95
G C - 16/14 (53.3%) 0.13 0.72
G A - 135/148 (47.7%) 0.60 0.44
- C T 228/212 (51.8%) 0.58 0.45
- C A 0/3 (0%) 3.00 0.08
- A T 106/105 (50.2%) 0.00 0.95
- A A 156/170 (47.9%) 0.60 0.44
A C T 227/212 (51.7%) 0.51 0.47
A C A 0/2 (0%) 2.00 0.16
A A T 100/94 (51.5%) 0.19 0.67
A A A 19/25 (43.2%) 0.82 0.37
G C T 15/13 (53.6%) 0.14 0.71
G C A 0/1 (0%) 1.00 0.32
G A T 5/6 (45.5%) 0.09 0.76
G A A 133/146 (47.7%) 0.61 0.44
All possible two- and three-allele haplotypes for the GAD2 SNPs 243A.G, þ61450C.A, and þ83897T.A are shown. Results for the ‘‘ protective’’ haplotype, consisting of the þ61450C and þ83897T alleles, are shown in bold.
DOI: 10.1371/journal.pbio.0030315.t003
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151665
GAD2 Polymorphisms and Obesity
Electrophoretic Mobility Shift Assay
In the previous study [18], oligonucleotide probes contain-
ing either of the 243 A.G alleles were tested for their
affinity for nuclear extract prepared from bTC3 murine
insulinoma cells. The probe containing the 243 G allele was
found to have a 6-fold higher affinity for an unidentified
nuclear protein (Figure 4 in [18]). However, the DNA–protein
complex was also present to some extent in the negative
control lanes (lacking nuclear extract), and the oligonucleo-
tide probes differed with respect to their specific activity.
We obtained the sequences of oligonucleotide probes used
by the authors, and utilized the electrophoretic mobility shift
assay (EMSA) to confirm this allele-specific difference in
binding affinity. We were also interested in determining
whether this effect was specific for neuronal or b cells relative
to other cell lines. Our experiments indicated that the 243 A
allele had a greater affinity for an unidentified protein from
bTC3 nuclear extracts relative to the 243 G allele (Figures S4
and S5). Our results were not consistent with those previously
described by Boutin et al. [18].
Figure 1. Meta-Analysis for the Association between the GAD2 243 A.G Polymorphism and Class III Obesity
French groups 1 and 2 refer to the genotype results from two sets of Caucasian class III obese cases and controls studied by Boutin et al. [18]. US and
Canadian groups were from the present study. The meta-analysis for the association between the 243 G allele and class III obesity yielded a summary
OR of 1.11 (95% CI 0.90–1.36), obtained in a total sample of 1,252 class III obese cases and 1,800 controls using a Mantel-Haenszel method and a fixed
effects model.
DOI: 10.1371/journal.pbio.0030315.g001
Table 5. Genotype Results for Canadian Case-Control Study
SNP Genotype, n (Frequency) Allele Frequency v
2
(df) p-Values
AA AG GG A G
243 A. G Cases 266 (0.70) 103 (0.27) 9 (0.03) 0.840 0.160 0.76 (1) 0.39
Controls 523 (0.69) 207 (0.27) 29 (0.04) 0.825 0.175
CC CA AA C A
þ61450 C.A Cases 199 (0.53) 144 (0.38) 32 (0.09) 0.723 0.277 0.97 (1) 0.32
Controls 381 (0.50) 299 (0.40) 75 (0.10) 0.703 0.297
TT TA AA T A
þ83897 T .A Cases 248 (0.67) 106 (0.29) 15 (0.04) 0.816 0.184 0.11 (1) 0.74
Controls 484 (0.66) 224 (0.30) 28 (0.04) 0.810 0.190
The GAD2 SNPs 243A.G, þ61450C.A, and þ83897T.A are also referred to as rs2236418, rs992990, and rs928197 in the text.
DOI: 10.1371/journal.pbio.0030315.t005
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151666
GAD2 Polymorphisms and Obesity
Discussion
In the present study, we atte mpted to replicate the
important recent findings of Boutin et al. [18], which
implicated three SNPs in GAD2 (the 243 A.G allele and a
haplotype of the þ61450 C.A and þ83897 T.A SNPs) in the
predisposition to class III human obesity. To replicate their
findings, we first performed family-based tests of association
for all three SNPs in 693 nuclear families segregating severe
obesity (2,359 participants, nearly four times as many
participants as in the original report). This group of
individuals included 89 families found to have linkage of
severe obesity to Chromosome 10p12 [16,22]. No evidence for
excess transmission of any GAD2 alleles or haplotypes from
parents to affected offspring was obtained. Next, we
conducted an adequately powered case-control study to test
the association between class III obesity and the GAD2 243
A.G variant in Caucasians. Consistent with the family-based
association results, we did not observe any association
between the 243 G variant and class III obesity in 680 cases
and 1,186 lean controls. These findings were also obtained in
a meta-analysis for the association between the 243 A.G
SNP and class III obesity. Lastly, we obtained results from the
reporter gene and DNA binding experiments for the 243
A.G variant that were inconsistent with the original report.
Overall, we found that (i) a haplotype consisting of the WT
alleles at SNPs þ61450 C.A and þ83897 T.A does not
appear to protect against severe, early-onset obesity, (ii) the
243 A.G SNP is not associated with class III obesity in
adults, (iii) other haplotypes in the region of GAD2 are not
associated with severe obesity, and (iv) the 243 A.G SNP
does not elicit detectable effects on transcription of a
luciferase reporter gene in bTC3 murine insulinoma cells.
Irreproducibility of positive findings has been a common
criticism leveled at association studies investi gating the
common ge netic basis of complex diseases [ 19,24]. The
reasons cited are numerous, and include a lack of statistical
power to detect small to moderate effects, lack of control
over the Type I error rate, overinterpretation of marginal
data, population stratification, and poor biological plausi-
bility [27,28]. Regarding the conflicting results obtained by
Boutin et al. [18] and the current study, it is likely that the
lack of replication could be ascribed to any of these causes,
which are discussed below. The inconsistencies between
association studies may also reflect the complex interactions
between multiple population-specific genetic and environ-
mental factors.
The lack of statistical power to detect alleles of minor
effect is likely to have contributed to the differences between
the study by Boutin et al. [18] and the current investigation.
Based on the findings of the initial report, we conducted an
adequately powered, ethnically matched, case-control study.
Although our results overlapped with the size of the initial
effect, they did not show a significant association between the
243 G allele and class III obesity (Figure 1). We estimate that
we had 60% power to detect a significant difference (a of
0.05) in allele frequency between our pooled groups of cases
and controls, assuming that the 243 G allele (frequency of
0.18) was the disease allele, a genotype relative risk of 1.25,
and a prevalence of class III obesity in the general population
of 5% [29]. The family-based association tests had a similar
amount of power (;60%), given the same assumptions.
Under these conditions, the original study [18] may have
been underpowered. Moreover, it must be pointed out that
the marginally significant association (p ¼ 0.04) they observed
between the 243 G allele and class III obesity was observed in
only one of their two groups of participants, and did not
reach nominal significance in their family-based analysis (p ¼
0.06). Although the lack of statistical significance does not
exclude the possibility of an association (as we cannot rule
out smaller effects), the data do not support a relationship
between this SNP and class III obesity.
The interpretation of results from genetic association
studies is frequently complicated by other statistical issues,
such as a failure to control for multiple hypothesis testing,
overinterpretation of marginal data as positive trends, and
the well-documented tendency for initial positive findings to
overestimate the strength of the as socia tio n [21 ]. T h is
‘‘ jackpot’’ phenomenon [24] can be readily observed in our
meta-analysis (Figure 1).
Population stratification may also account for some of the
inconsistencies observed between association studies, though
its importance may have been overestimated [19,26]. Pop-
ulation stratification is usually controlled for by careful
matching of cases and controls by ethnicity, using family-
based tests of association (such as the TDT) or studying
multiple case-control populations [30]. Conside ring the
marked differences in allele frequency that we observed
between ethnic groups for the GAD2 SNPs (the 243 A.G
and þ61450 C.A SNPs in particular), as well as the known
differences in the prevalence of class III obesity between
Cauc asian Americans and African Americans [31] , it is
plausible that a small difference in ancestry between cases
Table 6. TDT Results for Six SNPs Spanning the GAD2 Haplotype Block
rs2236418 rs3781118 rs3781117 rs1330581 rs992990 rs928197 Transmitted/
Untransmitted
(%Transmitted)
v
2
(df) p-Values
A G T G A T 105/101 (51.0%) 0.08 (1) 0.78
A T C A C T 142/144 (49.7%) 0.01 (1) 0.90
A T T A C T 722/705 (50.6%) 0.20 (1) 0.65
G T T G A A 184/190 (49.2%) 0.10 (1) 0.76
Global likelihood ratio test 1.56 (4) 0.82
Results were obtained using the program UNPHASED [49]. Rare haplotypes (frequency , 0.05) were excluded from the analysis. The SNPs rs2236418, rs992990, and rs928197 refer to the GAD2 SNPs 243 A.G, þ61450 C.A, and þ83897 T.A,
respectively.
DOI: 10.1371/journal.pbio.0030315.t006
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151667
GAD2 Polymorphisms and Obesity
and controls could lead to spurious claims of association.
Naturally, future studies of the GAD2 gene should carefully
take this into consideration.
There is no obvious explanation for the differences in
results obtained for the EMSA and reporter gene assays.
Regarding the EMSA, a major problem with these experi-
ments is that most random DNA sequences will be bound by a
nuclear extract from any cell line (Figures S4 and S5 and
Figure 4 in [18]). It is likely that the introduction of single
base-pair differences into this DNA sequence will interfere
with the binding pattern observed. Moreover, while an allele-
specific difference in the binding of bTC3 cell nuclear extract
definitely occurs for the 243 A.G polymorphism, this
observation is of limited physiological significance, because:
(i) it appears to be restricted to this cell type (and there is no
apparent difference in allele-specific binding for nuclear
extract derived from a neuronal cell line); and (ii) the binding
of this nuclear protein does not appear to affect transcription
of a luciferase reporter gene in bTC3 cells. Finally, even if the
243 A.G SNP did affect transcription of the reporter gene
in this context, there is no prior biological evidence to
suggest that perturbation of GAD2 expression in b cells could
exert detectable effects on long-term energy homeostasis.
This latest point raises the issue of biological plausibility.
GAD2 encodes the 65-kDa isoform of the enzyme glutamate
decarboxylase, which catalyzes the production of c-amino-
butyric acid (GABA), a major inhibitory neurotransmitter,
from glutamic acid. The biological evidence implicating
GAD2 as a candidate gene (and by extension, hypothalamic
GABA levels as causative) in severe obesity is as follows: GAD2
mRNA is co-expressed with neuropeptide Y in neurons of the
hypothalamic arcuate nucleus that act in the nearby para-
ventricular nucleus and other hypothalamic areas to stim-
ulate food intake [32]. Concomitantly, these arcuate
neuropeptide Y neurons inhibit the parallel and opposing
effects of neighboring pro-opiomelanocortin/cocaine- and
amphetamine-regulated transcript neurons via GABA-ergic
collateral inputs [33]. In rats, administration of muscimol, a
GABA
A
receptor agonist, into either the third ventricle or the
hypothalamic paraventricular nucleus stimulates feeding in a
dose-dependent manner [34]. Similarly, inhibition of GABA
synthesis in the ventromedial hypothalamus, by injection of
antisense GAD-65 and GAD-67 oligonucleotides, has been
shown to suppress food intake [35].
However, enthusiasm for GAD2 as a candidate gene for
severe obesity is dampened somewhat by the observation that
GAD2-deficient mice appear normal with respect to behavior,
locomotio n, reproductio n, and glucose homeostasis, but
suffer from epileptic seizures [36]. Also, levels of GAD2
mRNA in the arcuate nucleus of the rat do not change in
response to 48 hr of food deprivation, as do levels of prepro–
neuropeptide Y mRNA [37]. Furthermore, the notion that
hypothalamic GABA levels are proportional to food intake
may be an oversimplification; although microinjection of
GABA into the paraventricular nucleus and ventromedial
hypothalamus stimulates feeding [38], injection of GABA,
muscimol [39], or an adenovirus expressing GAD2 [40], into
the lateral hypothalamus of rats has been observed to have
the opposite effect.
While these experimental results do not exclude GAD2 as a
candidate gene for human obesity, it remains possible that
the linkage signal could be due to variation in a neighboring
gene. Certainly GAD2 is the leading candidate in this region,
due to some of the biological evidence presented above and
the location of D10S197 within one of its introns. However, in
light of the large number of genes involved in energy
homeostasis (recently reviewed in [41] and [42]), the multiple
tissue-specific roles of each gene, and the readily available
information regarding the homology and expression pattern
of uncharacterized genes, it now seems possible to make a
tenuous case for almost any single gene in the regulation of
body weight. For example, a preliminary glance at the
Chromosome 10p12 region yielded several interesting genes:
TPRT (trans-prenyltransferase), the enzyme that elongates
the prenyl side-chain of coenzyme Q, one of the key elements
of the respiratory chain within mitochondria; GPR158, which
encodes a metabotropic glutamate, GABA
B
–like G-protein-
coupled receptor; and PTF1A, which encodes pancreas-
specific transcription factor 1a. Although only a little is
known about each of these genes, it is possible to speculate on
the potential role of each in obesity. GAD2 is no exception. At
present, however, there is insufficient genetic or biological
evidence to implicate genetic variation in GAD2 in the
predisposition to severe obesity in humans.
Materials and Methods
Participants. The ascertainment strategy for these participants has
been described previously [43]. BMI was calculated as weight in kg/
(height in m)
2
. For the PDT and TDT analyses, we genotyped 973
(extremely) obese children and adolescents (693 probands and 280 of
their siblings: mean age 14.0 6 3.7 y, mean BMI 31.0 6 6.0 kg/m
2
) and
both of their parents (mean age 42.7 6 5.9 y, mean BMI 30.4 6 6.1 kg/
m
2
). Written informed consent was given by all participants and, in
the case of minors, their parents. The Ethics Committee of the
University of Marburg approved the study.
>Participants were selected from the Cardiovascular Research
Institute Genomic Resource in Arteriosclerosis, a population-based
investigation o f dy slipid emia and atherosclerotic hea rt di seas e
established at the University of California, San Francisco (UCSF) in
California, United States. This population includes patients from the
Lipid Clinic of UCSF [44,45], f rom the UCSF Interventional
Cardiology Service, and from collaborating cardiology clinics
throughout California. The UCSF Committee on Human Research
approved the protocols, and informed written consent was obtained
from all patients. From this study group, we selected class III obese
(BMI 40 kg/m
2
) non-Hispanic Caucasian individuals, as well as a
group of lean individuals (mean BMI ¼ 22.9 kg/m
2
, range 20.0–25.6 kg/
m
2
) with a similar age and sex distribution. Genomic DNA was
extracted from buffy coats using a Puregene DNA Purification Kit
from Gentra Systems (Minneapolis, Minnesota, United States).
Obese Caucasian individuals with a mean BMI of 48 kg/m
2
(range
36–81 kg/m
2
, with 91% of individuals having a BMI . 40 kg/m
2
) were
recruited from the Ottawa Hospital Weight Management Clinic. Age-
and sex-matched lean Caucasian individuals with a BMI below the
10th percentile for age and sex were recruited as controls from the
Ottawa region. The Human Ethics Research Boards of the Ottawa
Hospital and the University of Ottawa Heart Institute approved the
study. Informed written consent was obtained from all participants.
Genotyping. Three GAD2 SNPs were genotyped by PCR-based
restriction fragment length polymorphism analysis or by tetra-
amplification refractory mutation system PCR. To detect rs2236418
(243 A.G), a PCR-amplicon of 636 base pairs (bp) (primers: GAD2–
243-F: 59-GGAGCCAGACCTCAAACAAA-39 and GAD2–243-R: 59-
TTTGGAGACTGGAGCAGGTC-39) was digested by DraI ([NEB
GmbH, Frankfurt am Main, Germany]; 2 h at 37 8C; A-allele: 395 bp
and 241 bp; G-allele: undigested). To detect rs928197 (þ83897 T.A), a
PCR-amplicon of 242 bp (primers: GAD2–83897-F: 59-GTGGCAGG-
CAGCTGATAGTC-39 and GAD2–83897-R: 59-CACCTGTGGGACA-
GACCATA-39), was digested by AluI ([Fermentas GmbH, St. Leon Rot,
Germany]; 2 h at 37 8C; T-allele: 146 bp and 96 bp; A-allele:
undigested). PCR products of all SNPs were electrophoresed in 2.5%
agarose gels stained with ethidium bromide.
SNP rs992990 (þ61450 C.A) was genotyped by tetra-amplification
refractory mutation system PCR [46]. Primers were as follows: GAD-
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151668
GAD2 Polymorphisms and Obesity
61450-FiC 59-ATTCTTACTGACAAAGCTGAGTTTACCC-39 and
GAD-61450-Ro 59-TATTT AGGTGAAGTGCTTAGAACTGTGC-3 9
199-bp amplicon detects the C-allele; GAD-61450-RiA 59-
TCATGTTCTATGGCTAGATGTCTAATCCT-39 and GAD-61450-Fo
59-GGCAGCTTCTCTTCTAAAAAGACAAATA-39 151-bp amplicon
detects the A-allele. The amplicon length of the two outer primers
(GAD-61450-Fo and GAD-61450-Ro) was 294 bp.
Positive controls of variant genotypes were run on each gel. To test
validity of the genotypes, allele determinations were rated independ-
ently by at least two experienced persons. Discrepancies were
resolved unambiguously, either by reaching consensus or by retyping.
Genotyping of the US participants for the GAD2 SNPs rs2236418,
rs992990, and rs928197 was performed using fluorescently labeled
allele-specific primer extension, assayed by fluorescence polarization
template-directed dye incorporation [47]. The primers used to
amplify the region around each SNP were as follows: rs2236418p1
CCTCCCTCTCTCGTGTTTTT, rs2236418p2 GTGTCACGCAGGAA-
CAGAAA, rs928197p1 CCTCTTATCACTTGCAGGATCT,
rs928197p2 GTGGTTCCATACTCCATCATTC, rs992990p1 GGGA-
CAGAGAATTCAGTGACAG, and rs992990p2 GTCATTTGT-
GAGCTTGGTGAC. Single-base extension reactions for each SNP
were performed using the primers rs2236418p4 TTGGAAGCCGGG-
GAGC, rs928197p3 AAACAATAAGGTTCTGACTGTTGAGC, and
rs992990p4 CATGTTCTATGGCTAGATGTCTAATTC.
To test for ethnicity-specific differences in allele frequency, we also
genotyped 99 Caucasian-American and 99 African-American indi-
viduals from the Human Variation Collection (Coriell Institute for
Medical Research, Camden, New Jersey, United States), as well as 60
West Africans and 36 North Africans living in Paris, France.
To capture more than 95% of the haplotype diversity in the GAD2
region, we also genotyped the SNPs rs3781117, rs3781118, and
rs1330581 (Tables 6, S1, and S2) using fluorescence polarization
template-directed dye incorporation. The primers used were as
follows: rs3781117p1, rs37811 17p2, rs3781118 p1, rs3781118 p2,
rs1330581p1, and rs1330581p2 (sequences available from the authors
on request). For each of these SNPs, single-base extension reactions
were performed with the primers rs3781117p3, rs3781118p3, and
rs1330581p3 (as above).
Genotyping of the Canadian participants for the 243 A.G
polymorphism was performed by PCR amplification with the primers
GAD2_243A.G_ALU_F (GGCTCCCTTTCCCTCAAAT) and GA-
D2_243A.G_ALU_R (ATAACGTGTGTGT ATGCGA GCTGGA -
GA) followed by digestion with AluI. When separated by agarose gel
electrophoresis, this produced a unique set of bands corresponding
to each genotype: AA (20, 47, and 92 bp), AG (20, 47, 92, and 139 bp),
and GG (20 and 139bp).
For the SNPs (243 A.G, þ61450 C.A, and þ83897 T.A), 94 DNA
samples from each laboratory (Marburg, Germany; and San Francis-
co, California, United States) were exchanged and genotyped
according to the other laboratory’s method. Three discrepancies
(out of 564 genotypes) were observed, resulting in a between-
laboratory error rate of , 1%.
Family-based tests of association for single markers were carried
out using the PDT, which accounts for the dependency between the
sibs [23]. Haplotype TDTs for two and three markers were performed
using the program GeneHunter, version 2.0 beta [48] (available at
http://helix.nih.gov/apps/bioinfo/geneh unter.html). Here, transmis-
sions were counted only when phase could be determined unambig-
uously. TDT analysis of all six GAD2 SNPs (comprising the haplotype
block) was performed using the program UNPHASED [49] imple-
menting the EM (expectation-maximization) algorithm (available at
http://www.mrc-bsu.cam.ac.uk/personal/frank/). For the US and Cana-
dian participants, comparisons between cases and controls for allele
frequency were performed using a two-tailed v
2
test, and p-values
were calculated using the program GraphPad Prism version 3.0a for
Macintosh (GraphPad Software, San Diego California, United States).
For the meta-analysis, we used the Mantel-Haenszel method to
calculate stratified summary effects using a fixed effect model. Power
calculations were performed using the Genetic Power Calculator [50]
provided at http://statgen.iop.kcl.ac.uk/gpc/.
Reporter gene constructs. The effects of the 243 A.G poly-
morphism on GAD2 transcriptional activity were tested in the
context of a luciferase reporter gene. The oligonucleotides used to
amplify a 2,200-b p fragment of the GA D2 promoter (sense-
CGGGTCTCTGCTTTGTTAGC and antisense-TTTGGAGACTG-
GAGCAGGTC) were incorrectly specified in the original report
[18], as sequence comparisons between them and the GAD2
promoter sequence suggested that they would have yielded a
1,706-bp PCR product. Moreover, neither oligonucleotide contained
restriction sites for BglII or HindIII, as stated.
After communication with the author, P. Boutin, we amplified the
1710/4 region using the primers GAD2PROMF3 (our designation)
CGGGGTACCCGGGTCTCTGCTTTGTTAGC and GAD2PROMR3
CAAGCTTTGGAGACTGGAGCAGG, digested the PCR product with
KpnI and HindIII, and inserted it into the KpnI and HindIII sites in
front of the firefly luciferase coding sequence, contained in the vector
pGL3Basic (Promega, Madison, Wisconsin, United States). This vector
was referred to hereafter as the GAD2 1710/4 construct (numbers
refer to the regions of the GAD2 promoter, relative to the transcrip-
tional start site). The 243 G variant allele was introduced into this
construct by PCR amplification of the above fragment from a
homozygous patient, digestion of this PCR product with NotI and
HindIII, and substitution of this fragment into the NotI-HindIII sites
of the WT construct. PCR was performed using TaKaRa LA Taq
according to the manufacturer’s instructions (TaKaRa Biomedicals,
Otsu, Shiga, Japan). Using restriction enzyme digestion of the WT and
variant GAD2 1710/4 constructs, we also made shorter GAD2
promoter reporter genes, referred to as 501/4 and 1234/4. All
reporter genes were sequenced prior to transfection, and corre-
sponded exactly with the human Chromosome 10 sequence provided
on the UCSC Genome Bioinformatics site (http://genome.ucsc.edu).
EMSA. Sequences for EMSA probes were obtained from P. Boutin.
TheoligonucleotidesusedincludedGAD2A243AF (CTCT
TTTAAAGCTCCCCGGCTTCC), GAD2A243AR (GGAAGCCGGG-
GAGCT TTAAAAGAG), GAD2243GF (CTCTTTT
AAGGCTCCCCGGCTTCC), and GAD2243GR (GGAAGCCGGG-
GAGCCTTAAAAGAG). Bases in bold type indicate the differences
introduced to reflect the 243 A.G polymorphism. Five hundred
nanograms of each forward (F) oligonucleotide were end-labeled with
c-
32
P ATP (Perkin-Elmer, Boston, Massachusetts, United States) using
T4 polynucleotide kinase (Promega) at 37 8C for 30 min. Sub-
sequently, 1.5 lg of the corresponding unlabelled r everse (R)
oligonucleotide and 50 ll of annealing buffer (100 mM NaCl in TE
buffer) were added to each labeled (F) oligonucleotide, and the
mixture was incubated for 10 min at 95 8C before being cooled slowly
for 1–2 h. The resulting labeled, double-stranded probe was then
column-purified (Stratagene NucTrap, La Jolla, California, United
States), and the concentration of the probe in the eluate was
approximately 10 ng/ll. Unlabeled double-stranded probes for
competition experiments were also prepared in a similar manner.
All EMSA experiments were performed in a 20-ll reaction volume
containing binding buffer (10 mM HEPES [pH 7.9], 75 mM KCl, 2.5
mM MgCl
2
, 0.1 mM EDTA, 1 mM DTT, 3% Ficoll), polydI/dC (final
concentration 50 mg/l in TE), 1 ll nuclear extract, and approximately
3 ng of labeled probe. Nuclear extracts from bTC3, Neuro2A, T98G,
HepG2, and HEK293 cells were prepared using the method of
Schreiber et al. [51]. Cells from which nuclear extracts were prepared
were maintained as described below. After addition of the probe, the
mixture was incubated for 10 min at room temperature before
loading onto a 5% nondenaturing acrylamide gel containing 0.5 3
TBE (13 Tris-Borate EDTA buffer is 0.09 M Tris-borate, 2 mM EDTA).
Gels were electrophoresed for approximately 2 h, dried, and exposed
to autoradiographic film for 1–2 d.
All cells were maintained in a water-jacketed incubator set to 37 8C
with 5% carbon dioxide. The murine insulinoma bTC3 cells were
grown in DMEM supplemented with 15% horse serum (Hyclone,
Logan, Utah, United States), 2.5% fetal bovine serum (Hyclone), and
penicillin/streptomycin. The neuro2A cells were maintained in MEM
supplemented with 10% horse serum, 5% fetal bovine serum, 2 mM
L-glutamine, 1% non-essential amino acids, and antibiotics. The
T98G glioblastoma cells were grown in MEM containing Earle’s
Balanced Salt Solution (EBSS), 10% fetal bovine serum, 1% non-
essential amino acids, sodium pyruvate, and antibiotics. The HepG2
cells and human embryonic kidney (HEK293) cells were maintained
separately in MEM containing EBSS, 10% fetal bovine serum, 2mM L-
glutamine, 1% non-essential amino acids, and antibiotics.
Supporting Information
Figure S1. Haploview of the GAD2 Region on Chromosome 10
This figure was generated using data from the International HapMap
Project (http://www.hapmap.org/cgi-perl/gbrowse /gbrowse/hapmap)
and using the program Haploview (http://www.broad.mit.edu/mpg/
haploview/index.php). The SNPs studied are indicated on the diagram
by the following numbers: rs2236418 (#2); rs3781118 (#3), rs3781117
(#4), rs1330581 (#12), and rs928197 (#34). On the diagram, the blue
squares indicate missing data and unfilled red squares indicate a high
degree of linkage disequilibrium (linkage disequilibrium coefficient,
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151669
GAD2 Polymorphisms and Obesity
D9 ¼ 1) between pairs of markers. Lesser degrees of linkage
disequilibrium are indicated by the lighter red shading.
Found at DOI: 10.1371/journal.pbio.0030315.sg001 (95 KB PPT).
Figure S2. Haplotype Tag SNPs Required to Capture . 95% of the
Haplotype Diversity within the GAD2 Region
The SNPs genotyped in the initial phase of the study (243 A.G/
rs2236418, þ61450 C.A/rs992990, and þ83897 T.A/rs928197) are
indicated on the upper part of the diagram as markers 2, 24, and 35,
respectively. Haplotypes are depicted as rows, with their population
frequency shown at the right side of each row. The SNPs that are in
complete linkage disequilibrium with each other are shaded the same
color. In order to determine . 95% of the haplotype information
within the GAD2 region, genotypes at each of the SNPs indicated by
the arrowheads (markers 1, 3, 4, 12, and 14, or a marker in perfect
linkage disequilibrium with each) were required. To accomplish this,
markers rs3781118 (#3 on diagram), rs3781117 (#4), and rs1330581
(#12) were genotyped in the second phase of the study.
Found at DOI: 10.1371/journal.pbio.0030315.sg002 (81 KB PPT).
Figure S3. Results from Transient Transfection of GAD2 Reporter
Genes in bTC3 Cells Containing the 243 A.G Polymorphism
Three different sizes of luciferase reporter gene were constructed
from the GAD2 promoter (1710/4, 501/4 and 1234/4) for
transfection into bTC3 murine insulinoma cells. Each WT reporter
construct contains the 243 A allele, and the corresponding mutant
reporter construct is identical to the WT except for the introduction
of the 243 G allele. Twenty-four h before transfection, bTC3 cells
were seeded in 6-well plates at a density of 250,000 cells/well
containing DMEM supplemented with 10% fetal calf serum (Hyclone,
Logan, Utah, United States), 2 mM L-glutamine, and penicillin/
streptomycin . On the day of the experiment, each wel l was
transfected with pGL3Basic or a GAD2 promoter construct (0.4 lg)
as well as 20 ng of the plasmid pRL-RSV (Promega), which encodes
Renilla luciferase, to control for transfection efficiency. Transfections
were performed in triplicate using Effectene reagent (Qiagen,
Valencia, California, United States). Forty-eight h after transfection,
cells were lysed, and firefly and Renilla lucife rase assays were
performed on the lysate using the Dual Luciferase Reporter Assay
System (Promega), according to the manufacturer’s standard proto-
col. Each experiment was repeated three times. We observed no
significant difference in luciferase activity between each pair of WT
and mutant GAD2 promoter constructs.
Found at DOI: 10.1371/journal.pbio.0030315.sg003 (36 KB PPT).
Figure S4. EMSA
Radiolabeled double-stranded oligonucleotide probes for each of the
243 A.G alleles were incubated with various nuclear extracts and
electrophoresed in a 5% nondenaturing polyacrylamide gel. The
arrow on the left side of the figure indicates the DNA-nuclear protein
complex formed with bTC3 nuclear extract. Allele-specific differ-
ences in binding to bTC3 nuclear extract are seen in lanes 2 and 8.
Found at DOI: 10.1371/journal.pbio.0030315.sg004 (2.5 MB PPT).
Figure S5. Competitive EMSA Using Nuclear Extract from bTC3 Cells
The complex formed by the interaction between the radiolabeled
double-stranded probe containing the 243 A allele and bTC3
nuclear extract (indicated by the arrow) was competed away by the
addition of excess amounts of unlabeled 243 A probe (lanes 3–6),
but not by the addition of the same amount of unlabeled 243 G
probe (lanes 7–10).
Found at DOI: 10.1371/journal.pbio.0030315.sg005 (101 KB PPT).
Table S1 PDT Results for rs3781117, rs3781118, and rs1330581
Found at DOI: 10.1371/journal.pbio.0030315.st001 (32 KB DOC).
Table S2 Association Study Results for rs3781117, rs3781118, and
rs1330581 in US and Canadian Groups
None of the variant alleles at any of these three SNPs were associated
with class III obesity in either of the two case-control groups or when
pooled (for rs3781117, C allele: OR ¼ 0.92, 95% CI 0.75–1.13, p ¼ 0.43;
for rs3781118, G allele: OR ¼ 0.94, 95% CI 0.75–1.19, p ¼ 0.62; for
rs1330581, G allele: OR ¼ 1.03, 95% CI 0.89–1.20, p ¼ 0.65).
Can. Cases, Canadian cases.
Found at DOI: 10.1371/journal.pbio.0030315.st002 (64 KB DOC).
Table S3 Genotype results for GAD2 SNPs in US Caucasians, African
Americans, and Africans
Differences in allele frequency between ethnic groups were assessed
by v
2
test. For the 243 A.G and þ61450 C.A SNPs, the differences
between Caucasian Americans (CA) and African Americans were
highly significant (p , 0.001). For the 243 A.G SNP, the differences
between CA, West Africans (WA), and North Africans (NA) were
significant (CA vs. WA, p , 0.001; CA vs. NA, p ¼ 0.014; WA vs. NA, p ,
0.001). The frequency of the þ83897 T.A SNP was also significantly
different between CA and WA (p ¼ 0.013). Other comparisons either
yielded non-significant results, or were not conducted, as samples did
not conform to Hardy-Weinberg e quilibrium (indicated by an
asterisk).
Found at DOI: 10.1371/journal.pbio.0030315.st003 (53 KB DOC).
Accession Number
The GenBank (http://www.ncbi.nlm.nih.gov/Genbank) acces sion
number for GAD2 is AY340073.
Acknowledgments
This research was supported by the National Institutes of Health
(RO1 DK60540) and an American Diabetes Association Career
Development Award to CV. These studies were carried out in part
in the General Clinical Research Center, Moffitt Hospital, University
of California, San Francisco (UCSF), with funds provided by the
National Center for Research Resources (5 M01 RR-00079, US Public
Health Service). This research was also supported by the UCSF
Diabetes and Endocrinology Research Center (P30 DK63720).
Portions of this research were also conducted at the US Department
Of Energy’s Joint Genome Institute under contract DE-
AC0378SF00098 administered by the University of California (UC).
FG, AS, AH and JH are supported by the BMBF (Bundesministerium
fu
¨
r Bildung u nd Forschung) (NGFN1: 01GS0118 and NGFN2:
01GS0482). JPK is supported by the Mildred V. Strouss Charitable
Trust, the Joseph Drown Foundation, and UC Discovery Grants.
The authors would like to thank John Todd (Cambridge Institute
for Medical Research), Neil Risch (Center for Human Genetics,
UCSF), Michael German, and Stuart Smith (UCSF Diabetes Center)
for helpful discussions regarding the manuscript. We would also like
to acknowledge the efforts of Marco Patti, Karen Bagatelos (Depart-
ment of Surgery, UCSF), and James Ostroff (Department of Medicine,
UCSF) in the recruitment of severely obese participants, and Trang
Nguyen (Phillips University, Marburg, Germany) for additional
statistical analysis.
Competing interests. The authors have declared that no competing
interests exist.
Author contributions. MMS, BW, LAP, DLL, AH, JH, and CV
conceived and designed the experiments. MMS, BW, DLL, and AU
performed the experiments. MMS, BW, DLL, MMC, FG, AS, and WCH
analyzed the data. LAP, MMC, RM, MM, WR, FMJ, CRP, JPK, RD, RM,
PYK, AH, and JH contributed reagents/materials/analysis tools. MMS,
LAP, AH, JH, and CV wrote the paper.
&
References
1. Calle EE, Thun MJ, Petrelli JM, Rodriguez C, Heath CW Jr. (1999) Body-
mass index and mortality in a prospective cohort of U.S. adults. N Engl J
Med 341: 1097–1105.
2. Eckel RH, Krauss RM (1998) American Heart Association call to action:
Obesity as a major risk factor for coronary heart disease. AHA Nutrition
Committee. Circulation 97: 2099–2100.
3. Kopelman PG (2000) Obesity as a medical problem. Nature 404: 635–643.
4. Must A, Spadano J, Coakley EH, Field AE, Colditz G, et al. (1999) The
disease burden associated with overweight and obesity. JAMA 282: 1523–
1529.
5. Stunkard AJ, Foch TT, Hrubec Z (1986) A twin study of human obesity.
JAMA 256: 51–54.
6. Maes HH, Neale MC, Eaves LJ (1997) Genetic and environmental factors in
relative body weight and human adiposity. Behav Genet 27: 325–351.
7. Barsh GS, F arooqi IS, O ’Rahilly S (2000 ) Genetics of body- weight
regulation. Nature 404: 644–651.
8. O’Rahilly S, Farooqi IS, Yeo GS, Challis BG (2003) Minireview: Human
obesity-lessons from monogenic disorders. Endocrinology 144: 3757–3764.
9. Montague CT, Farooqi IS, Whitehead JP, Soos MA, Rau H, et al. (1997)
Congenital leptin deficiency is associated with severe early-onset obesity in
humans. Nature 387: 903–908.
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151670
GAD2 Polymorphisms and Obesity
10. Strobel A, Issad T, Camoin L, Ozata M, Strosberg AD (1998) A leptin
missense mutation associated with hypogonadism and morbid obesity. Nat
Genet 18: 213–215.
11. Clement K, Vaisse C, Lahlou N, Cabrol S, Pelloux V, et al. (1998) A mutation
in the human leptin receptor gene causes obesity and pituitary dysfunction.
Nature 392: 398–401.
12. Jackson RS, Creemers JW, Ohagi S, Raffin-Sanson ML, Sanders L, et al.
(1997) Obesity and impaired prohormone processing associated with
mutations in the human prohormone convertase 1 gene. Nat Genet 16:
303–306.
13. Krude H, Biebermann H, Luck W, Horn R, Brabant G, et al. (1998) Severe
early-onset obesity, adrenal insufficiency and red hair pigmentation caused
by POMC mutations in humans. Nat Genet 19: 155–157.
14. Swarbrick MM, Vaisse C (2003) Emerging trends in the search for genetic
variants predisposing to human obesity. Curr Opin Clin Nutr Metab Care
6: 369–375.
15. Hager J, Dina C, Francke S, Dubois S, Houari M, et al. (1998) A genome-
wide scan for human obesity genes reveals a major susceptibility locus on
chromosome 10. Nat Genet 20: 304–308.
16. Hinney A , Ziegler A, Oeffner F, Wedewardt C, Vogel M, et al. (2000)
Independent confirmation of a major locus for obesity on chromosome 10.
J Clin Endocrinol Metab 85: 2962–2965.
17. Price RA, Li WD, Bernstein A, Crystal A, Golding EM, et al. (2001) A locus
affecting obesity in human chromosome region 10p12. Diabetologia 44:
363–366.
18. Boutin P, Dina C, Vasseur F, Dubois S, Corset L, et al. (2003) GAD2 on
chromosome 10p12 is a candidate gene for human obesity. PLoS Biol 1:
e68. DOI: 10.1371/journal.pbio.0000068
19. Redden DT, Allison DB (2003) Nonreplication in genetic association
studies of obesity and diabetes research. J Nutr 133: 3323–3326.
20. Perusse L, Rankinen T, Zuberi A, Chagnon YC, Weisnagel SJ, et al. (2005)
The human obesity gene map: The 2004 update. Obes Res 13: 381–490.
21. Ioannidis JP, Ntzani EE, Trikalinos TA, Contopoulos-Ioannidis DG (2001)
Replication validity of genetic association studies. Nat Genet 29: 306–309.
22. Saar K, Geller F, Ruschendorf F, Reis A, Friedel S, et al. (2003) Genome scan
for childhood and adolescent obesity in German families. Pediatrics 111:
321–327.
23. Martin ER, Monks SA, Warren LL, Kaplan NL (2000) A test for linkage and
association in gene ral pedigrees: The pedigree disequilibrium test. Am J
Hum Genet 67: 146–154.
24. Hirschhorn JN, Lohmueller K, Byrne E, Hirschhorn K (2002) A compre-
hensive review of genetic association studies. Genet Med 4: 45–61.
25. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: Analysis and
visualization of LD and haplotyp e maps. Bioinformatics 21: 263–265.
26. Cardon LR, Palmer LJ (2003) Population stratification and spurious allelic
association. Lancet 361: 598–604.
27. Editorial (1999) Freely associating. Nat Genet 22: 1–2.
28. Cardon LR, Bell JI (2001) Association study designs for complex diseases.
Nat Rev Genet 2: 91–99.
29. Flegal KM, Carroll MD, Ogden CL, Johnson CL (2002) Prevalence and
trends in obesity among US adults, 1999–2000. JAMA 288: 1723–1727.
30. Hirschhorn JN, Altshuler D (2002) Once and again—Issues surrounding
replication in genetic association studies. J Clin Endocrinol Metab 87:
4438–4441.
31. Freedman DS, Khan LK, Serdula MK, Galuska DA, Dietz WH (2002) Trends
and correlates of class 3 obesity in the United States from 1990 through
2000. JAMA 288: 1758–1761.
32. Ovesjo ML, Gamstedt M, Collin M, Meister B (2001) GABAergic nature of
hypothalamic leptin target neurones in the ventromedial arcuate nucleus. J
Neuroendocrinol 13: 505–516.
33. Cowley MA, Smart JL, Rubinstein M, Cerdan MG, Diano S, et al. (2001)
Leptin activates anorexigenic POMC neurons through a neural network in
the arcuate nucleus. Nature 411: 480–484.
34. Pu S, Jain MR, Horvath TL, Diano S, Kalra PS, et al. (1999) Interactions
between neuropeptide Y and gamma-aminobutyric acid in stimulation of
feeding: A morphological and pharmacological analysis. Endocrinology
140: 933–940.
35. Bannai M, Ichikawa M, Nishihara M, Takahashi M (1998) Effect of injection
of antisense oligodeoxynucleotides of GAD isozymes into rat ventromedial
hypothalamus on food intake and locomotor activity. Brain Res 784: 305–
315.
36. Kash SF, Johnson RS, Tecott LH, Noebels JL, Mayfield RD, et al. (1997)
Epilepsy in mice deficient in the 65-kDa isoform of glutamic acid
decarboxylase. Proc Natl Acad Sci U S A 94: 14060–14065.
37. Schwartz MW, Sipols AJ, Grubin CE, Baskin DG (1993) Differential effect of
fasting on hypothalamic expression of genes encoding neuropeptide Y,
galanin, and glutamic acid decarboxylase. Brain Res Bull 31: 361–367.
38. Leibowitz SF (1986) Brain monoamines and peptides: Role in the control of
eating behavior. Fed Proc 45: 1396–1403.
39. Rattan AK, Mangat HK (1990) Electrical activity and feeding correlates of
intracranial hypothalamic injection of GABA, muscimol and picrotoxin in
the rats. Acta Neurobiol Exp (Wars) 50: 23–36.
40. Noordmans AJ, Song DK, Noordmans CJ, Garrity-Moses M, During MJ, et
al. (2004) Adeno-associated viral glutamate decarboxylase expression in the
lateral nucleus of the rat hypothalamus reduces feeding behavior. Gene
Ther 11: 797–804.
41. Flier JS (2004) Obesity wars: Molecular progress confronts an expanding
epidemic. Cell 116: 337–350.
42. Saper CB, Chou TC, Elmquist JK (2002) The need to feed: Homeostatic and
hedonic control of eating. Neuron 36: 199–211.
43. Hinney A, Bornscheuer A, Depenbusch M, Mierke B, Tolle A, et al. (1997)
Absence of leptin deficie ncy mutation in extremely obese German children
and adolescents. Int J Obes Relat Metab Disord 21: 1190.
44. Pullinger CR, Hennessy LK, Chatterton JE, Liu W, Love JA, et al. (1995)
Familial ligand-defective a polipopro tein B. Identification of a new
mutation that decreases LDL receptor binding affinity. J Clin Invest 95:
1225–1234.
45. Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, et al. (2002) Human
cholesterol 7alpha-hydroxylase (CYP7A1) deficiency has a hypercholester-
olemic phenotype. J Clin Invest 110: 109–117.
46. Ye S, Dhillo n S, Ke X, Collins AR, Day IN (2001) An efficient procedure for
genotyping single nucleotide polymorphisms. Nucleic Acids Res 29: E88.
47. Chen X, Levine L, Kwok PY (1999) Fluorescence polarization in homoge-
neous nucleic acid analysis. Genome Res 9: 492–498.
48. Spielman RS, Ewens WJ (1998) A sibship test for linkage in the presence of
association: The sib transmission/disequilibrium test. Am J Hum Genet 62:
450–458.
49. Dudbridge F (2003) Pedigree disequilibrium tests for multilocus haplo-
types. Genet Epidemiol 25: 115–121.
50. Purcell S, Cherny SS, Sham PC (2003) Genetic Power Calculator: Design of
linkage and association genetic mapping studies of complex traits.
Bioinformatics 19: 149–150.
51. Schreiber E, Matthias P, Muller MM, Schaffner W (1989) Rapid detection of
octamer binding proteins with ‘mini-extracts,’ prepared from a small
number of cells. Nucleic Acids Res 17: 6419.
PLoS Biology | www.plosbiology.org September 2005 | Volume 3 | Issue 9 | e3151671
GAD2 Polymorphisms and Obesity
    • "The highest linkage peak provided evidence for the presence of a susceptibility locus for BN on chromosome 10p [126]. Interestingly, this region already showed up in full and partial genome scans for obesity [54, 88, 127, 128]; attempts to identify the underlying gene variant(s) have however not led to clear-cut results [129, 130]. Nevertheless, a gene on chromosome 10p might well be involved in both obesity and BN. "
    [Show abstract] [Hide abstract] ABSTRACT: Anorexia nervosa (AN) and bulimia nervosa (BN) are complex disorders characterized by disordered eating behavior where the patient's attitude towards weight and shape, as well as their perception of body shape, are disturbed. Formal genetic studies on twins and families suggested a substantial genetic influence for AN and BN. Candidate gene studies have initially focused on the serotonergic and other central neurotransmitter systems and on genes involved in body weight regulation. Hardly any of the positive findings achieved in these studies were unequivocally confirmed or substantiated in meta-analyses. This might be due to too small sample sizes and thus low power and/or the genes underlying eating disorders have not yet been analyzed. However, some studies that also used subphenotypes (e.g., restricting type of AN) led to more specific results; however, confirmation is as yet mostly lacking. Systematic genome-wide linkage scans based on families with at least two individuals with an eating disorder (AN or BN) revealed initial linkage regions on chromosomes 1, 3 and 4 (AN) and 10p (BN). Analyses on candidate genes in the chromosome 1 linkage region led to the (as yet unconfirmed) identification of certain variants associated with AN. Genome-wide association studies are under way and will presumably help to identify genes and pathways involved in these eating disorders. The elucidation of the molecular mechanisms underlying eating disorders might improve therapeutic approaches.
    Full-text · Article · Mar 2010
    • "A genome-wide linkage analysis previously performed in a French cohort of obese subjects revealed a QTL for morbid obesity on chromosome 10p11–p12, with the highest peak near marker D10S197 [6]. The GAD2 gene has been proposed as a positional candidate for this obesity QTL, although it is still debated [13,15]. As GAD2 may play a role in feeding control, we investigated the role of GAD2 gene variants in eating behavior traits and energy and macronutrients intake, as well as their impact on adiposity measurements. "
    [Show abstract] [Hide abstract] ABSTRACT: The glutamate decarboxylase 2 (GAD2) gene encodes for the glutamic acid decarboxylase enzyme (GAD65), which is implicated in the formation of the gamma-aminobutyric acid (GABA), a neurotransmitter involved in the regulation of food intake. The objective of the present study was to test for association between GAD2 single-nucleotide polymorphisms (SNPs) and eating behaviors, dietary intake and obesity in subjects (n=873) from the Quebec Family Study (QFS). Energy and macronutrient intakes were measured using a 3-day dietary record and eating behaviors were assessed using the Three-Factor Eating Questionnaire (TFEQ). Six SNPs capturing about 90% of GAD2 gene variability were genotyped and tested for association with age- and BMI- adjusted phenotypes. No evidence of association was found in men. In women, a SNP (rs992990; c.61450 C>A) was associated with disinhibition (p=0.028), emotional susceptibility to disinhibition (p=0.0005) and susceptibility to hunger (p=0.028). Another SNP (rs7908975; c.8473A>C) was associated with carbohydrate (p=0.021) and lipid (p=0.021) intakes, disinhibition (p=0.011) and two of its subscales (emotional and situational susceptibility) as well as with avoidance of fattening foods (p=0.036). Six-year weight gain was two times higher in women carrying the variants associated with eating behaviors: 4.2kg (vs 2.1kg in non-carriers) in A-allele carriers of c.61450 C>A (p=0.038) and 4.9kg (vs 2.5kg in non-carriers) in C-allele carriers of c. 8473 A>C (p=0.013). The results suggest a role for the GAD2 gene in determining food intake, eating behaviors and weight gain over time in women.
    Full-text · Article · Aug 2009
    • "From twin studies it is estimated that up to 80% of the variance in body mass index (BMI) might be genetically determined1234 . These genetic contributions seem to be especially important in individuals with severe or early-onset forms of obesity [5] . The molecular mechanisms of obesity are still far from being well understood. "
    [Show abstract] [Hide abstract] ABSTRACT: Gastric inhibitory polypeptide (GIP) is postulated to be involved in type 2 diabetes mellitus and obesity. It exerts its function through its receptor, GIPR. We genotyped three GIPR SNPs (rs8111428, rs2302382 and rs1800437) in German families with at least one obese index patient, two case-control studies and two cross-sectional population-based studies. Genotyping was performed by MALDI-TOF, ARMS-PCR and RFLP. The family-study: 761 German families with at least one extremely obese child or adolescent (n = 1,041) and both parents (n = 1,522). Case-control study: (a) German obese children (n = 333) and (b) obese adults (n = 987) in comparison to 588 adult lean controls. The two cross-sectional population-based studies: KORA (n = 8,269) and SHIP (n = 4,310). We detected over-transmission of the A-allele of rs2302382 in the German families (pTDT-Test = 0.0089). In the combined case-control sample, we estimated an odd ratio of 1.54 (95%CI 1.09;2.19, pCA-Test = 0.014) for homozygotes of the rs2302382 A-allele compared to individuals with no A-allele. A similar trend was found in KORA where the rs2302382 A-allele led to an increase of 0.12 BMI units (p = 0.136). In SHIP, however, the A-allele of rs2302382 was estimated to contribute an average decrease of 0.27 BMI units (p-value = 0.031). Our data suggest a potential relevance of GIPR variants for obesity. However, additional studies are warranted in light of the conflicting results obtained in one of the two population-based studies.
    Full-text · Article · Feb 2009
Show more

  • undefined · undefined
  • undefined · undefined
  • undefined · undefined