Article

Effect of Clathrin Assembly Lymphoid Myeloid Leukemia Protein Depletion on Clathrin Coat Formation

Department of Cell Biology, Center of Anatomy, Hannover Medical School, Carl-Neuberg Str. 1, D-30625 Hannover, Germany.
Traffic (Impact Factor: 4.35). 01/2006; 6(12):1225-34. DOI: 10.1111/j.1600-0854.2005.00355.x
Source: PubMed
ABSTRACT
The endocytic accessory clathrin assembly lymphoid myeloid leukemia protein (CALM) is the ubiquitously expressed homolog of the neuron-specific protein AP180 that has been implicated in the retrieval of synaptic vesicle. Here, we show that CALM associates with the alpha-appendage domain of the AP2 adaptor via the three peptide motifs 420DPF, 375DIF and 489FESVF and to a lesser extent with the amino-terminal domain of the clathrin heavy chain. Reducing clathrin levels by RNA interference did not significantly affect CALM localization, but depletion of AP2 weakens its association with the plasma membrane. In cells, where CALM levels were reduced by RNA interference, AP2 and clathrin remained organized in somewhat enlarged bright fluorescent puncta. Electron microscopy showed that the depletion of CALM drastically affected the clathrin lattice structure. Round-coated buds, which are the predominant features in control cells, were replaced by irregularly shaped buds and long clathrin-coated tubules. Moreover, we noted an increase in the number of very small cages that formed on flat lattices. Furthermore, we noticed a redistribution of endosomal markers and AP1 in cells that were CALM depleted. Taken together, our findings indicate a critical role for CALM in the regulation and orderly progression of coated bud formation at the plasma membrane.

Full-text

Available from: Ernst Joachim Ungewickell, Dec 04, 2014
Effect of Clathrin Assembly Lymphoid Myeloid
Leukemia Protein Depletion on Clathrin Coat Formation
Anika Meyerholz
a
, Lars Hinrichsen
a
, Stephanie
Groos, Peter-Christopher Esk
b
, Gudrun Brandes
and Ernst J. Ungewickell*
Department of Cell Biology, Center of Anatomy, Hannover
Medical School, Carl-Neuberg Str. 1, D-30625 Hannover,
Germany
*Corresponding author: Ernst J. Ungewickell,
ungewickell.ernst@mh-hannover.de
The endocytic accessory clathrin assembly lymphoid
myeloid leukemia protein (CALM) is the ubiquitously
expressed homolog of the neuron-specific protein
AP180 that has been implicated in the retrieval of synap-
tic vesicle. Here, we show that CALM associates with the
a-appendage domain of the AP2 adaptor via the three
peptide motifs
420
DPF,
375
DIF and
489
FESVF and to a
lesser extent with the amino-terminal domain of the
clathrin heavy chain. Reducing clathrin levels by RNA
interference did not significantly affect CALM localiza-
tion, but depletion of AP2 weakens its association with
the plasma membrane. In cells, where CALM levels were
reduced by RNA interference, AP2 and clathrin remained
organized in somewhat enlarged bright fluorescent
puncta. Electron microscopy showed that the depletion
of CALM drastically affected the clathrin lattice structure.
Round-coated buds, which are the predominant features
in control cells, were replaced by irregularly shaped buds
and long clathrin-coated tubules. Moreover, we noted an
increase in the number of very small cages that formed
on flat lattices. Furthermore, we noticed a redistribution
of endosomal markers and AP1 in cells that were CALM
depleted. Taken together, our findings indicate a critical
role for CALM in the regulation and orderly progression
of coated bud formation at the plasma membrane.
Key words: AP1, AP180, AP2, electron microscopy, endo-
cytosis, RNAi
Received 9 August 2005, revised and accepted 14
September 2005, published on-line 6 October 2005
The clathrin coat machinery facilitates cargo recruitment
and formation of transport vesicles from the plasma mem-
brane, the TGN (trans-Golgi network) and endosomal
membranes (1). Clathrin-coated vesicles at the cell surface
are major entry ports into eucaryotic cells for nutrients and
growth factors. Clathrin associates through the AP2 adap-
tor and endocytic accessory proteins with the membrane
and cargo receptors therein. AP2 is a heterotetrameric
complex composed of a-, b2-, m2- and s2-subunits.
a- and b2-subunits consist of independently folded appen-
dage domains that are connected through long flexible
segments with globular core domains (2,3). AP2 can inter-
act through the a-appendage domain with a number of
proteins that contribute to cargo selection, coat formation,
budding, pinching and removal of the coat (2,3). Among
these is the neuron-specific AP180 protein and its ubiqui-
tously expressed homolog clathrin assembly lymphoid
myeloid leukemia protein (CALM). The latter was originally
discovered as a component of the CALM/AF10 fusion
gene resulting from the chromosomal translocation
t(10,11)(p13;q14), which was found in patients with
acute lymphoblastic leukemia and acute myeloid leukemia
(4). Both AP180 and CALM share an N-terminal globular
phosphatidylinositol-4,5-bisphosphate (PtdIns-4,5-P
2
)-
binding module, referred to as the AP180 N-terminal
homology (ANTH)-domain (5). This module is homologous
to the somewhat smaller epsin N-terminal homology
domain that was also shown to bind PtdIns-4,5-P
2
. The
segment C-terminal to the ANTH-domain of AP180 con-
tains numerous short DLL-binding motifs, which were
proposed to interact with clathrin (6). In addition, it fea-
tures numerous interaction motifs of the DXF type that are
implicated in the interaction with the a-appendage domain
of AP2 (7–9). The significantly shorter C-terminal segment
of CALM features only one DLL motif, two DXF-type
motifs, an FXDXF-like and two NPF motifs with affinity
for a protein module known as Eps15 homology domain
(10). So far, our knowledge about the function of CALM in
endocytosis is limited. For the neuron-specific protein
AP180, inactivation of its ortholog in Caenorhabditis ele-
gans causes accumulation of large vesicles in synapses
(11). Similarly, injection of a peptide that inhibits the
assembly function of AP180 into squid giant presynaptic
terminals blocked synaptic transmission, reduced the pool
of synaptic vesicles and also led to enlarged vesicles (6).
To date, it is unclear whether the aberrant vesicle size is a
direct result of AP180 deficiency or could also be caused
by more complex indirect interference with the retrieval of
synaptic vesicle membrane after neurotransmitter release,
as DAP160/intersectin mutants appear to give rise to simi-
lar phenotypes (12). The strongest homology between
AP180 and CALM is found within their ANTH domains
that mediate binding to PtdIns-4,5-P
2
. Using an in vitro
system, it was shown that PtdIns-4,5-P
2
-containing lipid
monolayers readily bound AP180, which in turn could
recruit clathrin to the monolayer where it polymerized
into lattices (13). In the presence of AP2, these lattices
invaginated to form coated buds. These results suggest
a
AM and LH contributed equally to this work.
b
Current address: University California-San Francisco, Hooper
Fndn-Rm HSW1542, PO Box 0552/513 Parnassus Ave, San
Francisco, CA 94143-0552, USA.
Traffic 2005; 6: 1225–1234
Copyright
#
Blackwell Munksgaard 2005
Blackwell Munksgaard
doi: 10.1111/j.1600-0854.2005.00355.x
1225
Page 1
that AP180 and CALM might function at early stages of
coat formation. Consistent with such a role is the almost
perfect co-localization of CALM with AP2 and plasma
membrane-associated clathrin (14).
Depletion of select proteins by RNA interference (RNAi)
has proven a very powerful tool for exploring their function
in cells (15). Very recently, this technique was applied to
suppress the expression of CALM in HeLa cells (16).
Surprisingly, it was found that the depletion of CALM
had little effect on the receptor-mediated uptake of trans-
ferrin, but under certain conditions the uptake of EGF was
impaired (16). This finding suggested a role for CALM in
the uptake of certain signaling receptors. Here, we show
that the function of CALM extends beyond that of a spe-
cific adaptor. In detail, we demonstrate that depletion of
CALM by RNAi induces the formation of large irregularly
shaped coated structures at the plasma membrane. In
addition, we note effects on the intracellular distribution
of AP1, the mannose-6-phosphate receptor, the endoso-
mal marker EEA1 and internalized transferrin.
Results
Protein–protein interactions of CALM
Immunofluorescence staining of HeLa cells showed that
CALM co-localizes almost perfectly with the AP2 adaptor
and clathrin on the plasma membrane (Figure 1A,B), as
previously described by Tebar et al. (14). Electron micro-
scopy of immunogold-labeled sections of HeLa cells
demonstrated that CALM is present in coats that underlie
both shallow as well as deeply invaginated coated pits or
vesicles (Figure 1C–F). This suggests that CALM is impor-
tant at all stages of the internalization process. CALM was
previously identified as a clathrin-associated protein
because clathrin co-immunoprecipitated with overex-
pressed CALM from COS cell lysates and clathrin could
also be pulled down with GST-CALM from cell lysates
(14). Evidence for a direct interaction between CALM
and the AP2 adaptor complex was very recently obtained
when the GST-a-appendage domain was used as bait to
retrieve CALM from rat brain cytosol (17). Consistent with
a direct association of CALM with AP2 is the occurrence
of short sequence motifs in CALM that are identical or
related to motifs known to mediate binding to the
a-appendage subdomain of AP2 (Figure 2A). The most
conspicuous one, the
420
DPF motif, is absent from a
major human CALM splice variant that lacks the residues
420–469 (Swiss-Prot entry Q13492-3), and it is also miss-
ing in rat CALM (Swiss-Prot entry O55012) that was used
by Traub and co-workers (17). The missing DPF sequence
might be compensated by the motifs
375
DIF and
489
FESVF, which are related to the DPF- and FXDXF-bind-
ing motifs, respectively. Using GST-binding assays, we
confirmed an association of CALM with the a-appendage
domain using cytosolic extracts from HeLa cells that were
transfected with a YFP-CALM construct (Figure 2). To
identify the critical motifs for the interaction, we con-
structed YFP-CALM mutants with individually altered
420
DPF,
375
DIF and
489
FESVF motifs and in addition a
YFP-CALM triple mutant. Mutagenesis of the DPF or the
DIF motif reduced AP2 binding by 40% (Figures 2B,C). A
reduction of 70% was seen when the FESVF motif was
mutated. When all three motifs were altered, only minor
binding to the a-appendage was observed (less than 5%
compared with the YFP-CALM, Figure 2B–D). It is concei-
vable that the residual binding to the a-appendage is
mediated through Eps15, which is known to associate
with both AP2 and CALM (via the two NPF motifs) (18).
The a-appendage is constructed from a platform- and a
b-sandwich subdomain (19). Most endocytic accessory
proteins with DPF/W and FXDXF motifs engage the
a-appendage through the platform domain, whereas pro-
teins such as synaptojanin 1, stonin 2, AAK1, GAK and
NECAP1 bind to the sandwich domain via WXX(F/W)X(D/
E) motifs (8,9,17). Because the three motifs in CALM are
variants of the DXF/W and FXDXF motifs, an interaction
with the platform domain seemed likely. This was con-
firmed by testing the binding of CALM to the platform
domain mutant W840A and the sandwich domain mutant
Q782A. These mutations were previously shown to spe-
cifically abolish the interactions with accessory proteins
(17,20). As expected, YFP-CALM binding to the platform
C
D
E
F
100
nm
AB
5
μm
AP2 CALM
Figure 1: Co-localization of CALM with AP2 and clathrin.
Immunofluorescence images shown in (A) and (B) demonstrate
the almost perfect co-localization of CALM with AP2 on the
plasma membrane. Immunogold labelling demonstrates that
CALM is a component of clathrin coats at all stages of the inter-
nalization process (C–F).
Meyerholz et al.
1226 Traffic 2005; 6: 1225–1234
Page 2
domain mutant was abolished, whereas
Q782A
a-appen-
dage associated normally with CALM (Figure 2E).
The motif
392
DLLDLQ is conserved in CALM and AP180,
and closely resembles the clathrin box motif that mediates
interactions with the globular N-terminal domain (TD) of the
clathrin heavy chain (21). To determine whether CALM can
associate with clathrin TD, we mixed YFP-CALM-contain-
ing HeLa lysate with immobilized GST-TD. When com-
pared with its association with the a-appendage, CALM
appeared to bind the TD of clathrin only with moderate
affinity (Figure 2F). As expected, bacterially expressed
His-tagged CALM associated also with preassembled cla-
thrin cages (Figure 2G).
Taken together, CALM associates directly with clathrin and
AP2, but it appears to bind the clathrin TD with lower
affinity than the a-appendage domain of the AP2 adaptor.
Analysis of CALM-depleted HeLa cells using light
microscopy
We have previously shown that depleting clathrin in HeLa
cells using RNAi had no significant effect on the membrane
association of CALM (22). When the a-subunit of the AP2
adaptor was depleted, we noted a reduction of CALM at
the plasma membrane [(22) and Figure 3]. This result sup-
ports a close functional relationship between CALM and
AP2 and suggests that CALM might be recruited to the
plasma membrane prior to clathrin. We next asked whether
the presence of CALM might be essential for the correct
targeting of clathrin and AP2 to the plasma membrane. To
address this question, we knocked down CALM in HeLa
cells. By immunofluorescence, we noted frequently that
the AP2 spots were enlarged compared with those in con-
trol cells (Figure 4). The distribution of clathrin in CALM-
depleted cells was also altered. Puncta at the plasma mem-
brane appeared larger, and the typical perinuclear concen-
tration of clathrin was much less conspicuous (Figure 4).
Clathrin-coated structures at the plasma membrane
stained positive for Eps15 (Figure 4) and also for epsin
(data not shown) suggesting that their association with
the coat was not dependent on CALM.
Collectively, our data suggest that clathrin and AP2 are not
dependent on CALM for their association with the plasma
membrane but that CALM appears to influence the size of
coated structures.
2001
AP180
CALM
ANTH
ANTH
400
FGDAF
FGDLF
FESVF
FGDAF
DIF
DPF
DPF
DLL
DLL
DIF
DLL
DLL
DLL
DLL
DPF
DPF
APA
NPF NPF
639
420
375
489
FESVF
97
97
97
97
67
Cages: 0 25
μg
AESVA/APA/DIF
GST
AESVA
AIA
DIF
wt
sm
97
GST
GST-α
GST-α GST-α
GST
GST-α
GST-α
GST-αGST GST-TD
GST
YFP-CALM
GST-α
(Q782A)
GST-α
(W840A)
GST
GST
GST-α
smss sppp
sm s spp
sm s spp
sspp
sspp
sspp
sp
sspp
sm s spp
sp
907
600 800 1000
A
B
C
D
E
F
G
Figure 2: Interaction of CALM with AP2 and clathrin. (A)
Domain organization of AP180 and CALM; known and putative
binding motifs for AP2 and clathrin are indicated. B–D) GST-binding
experiments with YFP-CALM and mutated YFP-CALM. Extracts
from HeLa cells expressing the indicated CALM construct were
incubated with either GST-a-appendage or GST attached to GSH
beads. Binding of the YFP-CALM triple mutant is shown in (D). E)
Association of YFP-CALM with a-appendage subdomain mutants.
F) Interaction of CALM with the N-terminal domain (TD) of clathrin.
G: Association of recombinant His-tagged CALM with clathrin
cages. Aliquots of start material (sm) supernatants (s) and pelleted
beads (p) were analyzed using Western blotting. All loadings are
directly comparable except for the binding of YFP-CALM to the
clathrin TD (GST-TD) shown in (F), where the pellet fraction was
twofold concentrated over the supernatant.
CALM and Clathrin Coat Formation
Traffic 2005; 6: 1225–1234 1227
Page 3
Ultrastructural analysis of clathrin-coated pits in
CALM-depleted cells
For analyzing the effect of the CALM-knockdown in more
detail we turned to electron microscopy. In sections of con-
trol HeLa cells, regular coated buds and vesicular profiles
were seen in abundance, whereas CALM-depleted cells fre-
quently exhibited large wide-necked invaginations (Figure 5).
For an overview of clathrin-coated structures at the plasma
membrane in control and knockdown cells we prepared
‘unroofed cells’ (23,24). The cells were fixed, critical point
dried and subsequently immediately shadowed at low angle
with platinum and carbon. Round-coated vesicular profiles
and flat-coated patches surrounded by cytoskeletal fila-
ments were the predominant features in control cells
(Figure 6A,B). Upon CALM depletion, round coats became
replaced by larger dome-like coats of irregular shape
(Figure 6C–L). They often appeared to consist of multiple
buds that started to form independently but failed to sepa-
rate (see for example arrows Figure 6C,D). We also
frequently noted long coated tubules that still appeared to
be in contact with the plasma membrane (Figure 6E,I–K).
Besides these large coated buds we observed unusually
small coats (Figure 6F,L). These ‘mini coats were seen
mostly on flat lattices, but they were not restricted to
them. The difference in coat structure between control-
and CALM-depleted cells was quantified by plotting the
20 μm
AP2 CALM
Figure 3: Effect of the depletion
of AP2 on the intracellular distri-
bution of CALM. Expression of
AP2 was silenced in HeLa cells by
transfection with a-adaptin siRNA
oligo I as described previously (22).
Note that upon AP2 depletion,
CALM dissociates from the mem-
brane (see arrow).
Oligo I
CALM
A
B
CALM AP2
CALM Clathrin
CALM eps15
Actin
CALM RNAi
Oligo II Control
Figure 4: Effect of CALM depletion on clathrin coat proteins.
A) Western blot demonstrating the efficiency of the CALM siRNA
oligos I and II in eliminating the expression of CALM. Both were
used in the course of this work. Actin served as loading control. B)
Characterization of CALM knockdowns using fluorescence micro-
scopy. Knockdown and control cells were mixed and replated
48 h post transfection and processed for immunofluorescence
24 h later. Note the coarse appearance of AP2 and Eps15 puncta
in knockdown cells. Similarly, clathrin-coated structures appear
slightly larger, and moreover, the clathrin is no longer concen-
trated in the perinuclear region of the knockdown cells. Bar:
20 mm.
Control
Knockdown
Figure 5: Analysis of CALM-depleted HeLa cells using thin
section electron microscopy. Control HeLa cells with coated
vesicular profiles of typical size and shape (see arrows). CALM-
depleted cells with normal vesicular profiles (arrow) and unusually
wide-necked pits that were not seen in control cells (arrow
heads). Bars: 250 nm.
Meyerholz et al.
1228 Traffic 2005; 6: 1225–1234
Page 4
dimensions of major and minor axis of coated buds in a
scatter diagram (Figure 7). This analysis showed that
depletion of CALM results in a much more heterogeneous
population of coated buds than observed in control cells.
Strikingly, 65% of the coats in control cells fell into
100–150 nm range (for both axes) but only 22% of the
coats in the knockdown cells.
We conclude that CALM is essential for the orderly
nucleation and budding process of clathrin-coated struc-
tures at the plasma membrane. Because CALM has been
localized to perinuclear membranes in transfected cells
(14), we decided to test whether CALM depletion has
any effect on the TGN and endosomes.
Effect of CALM depletion on endosomes and TGN
Depletion of CALM in HeLa cells decreased the typical
perinuclear concentration of clathrin (see Figure 4).
Likewise, the AP1 adaptor became redistributed to vesi-
cular structures throughout the cell (Figure 8). The predo-
minantly TGN-associated syntaxin 6 showed also a wider
distribution, suggesting that the TGN was affected by the
CALM knockdown as well. In contrast, the trans-Golgi-
marker protein b-1,4-galactosyltransferase (25) remained
B D
F
A C
E
G H I
J K
L
Control CALM RNAi
CALM RNAi
Figure 6: Visualization of clathrin coat structures at the plasma membrane. Control cells (A and B) and CALM-knockdown cells
(C–L) were grown on glass cover slips and ‘unroofed’ using sonication. The exposed plasma membranes were fixed, critical point dried
and rotary shadowed with PT/C from an angle of 27
. In CALM-depleted cells, the clathrin lattices are overall larger and irregularly shaped.
The arrow (C) points to a structure that appeared to be composed of three fused buds. Another frequently seen structures were long
convoluted coated tubes (E, I–K) and mini-coats forming on top of flat lattices (F and L). Bars: 125 nm.
CALM and Clathrin Coat Formation
Traffic 2005; 6: 1225–1234 1229
Page 5
unperturbed in the knockdown cells (Figure 8). Because the
redistribution of AP1 is likely to affect its cargo, we analyzed
the cellular distribution of the mannose-6-phosphate recep-
tor and observed that it also was dispersed throughout the
knockdown cells (not shown). Moreover, the staining of the
early endosomal marker protein EEA1 also shifted from a
perinuclear localization to a more peripheral one (Figure 9).
Although, neither the rate of transferrin uptake nor its recy-
cling was significantly altered upon CALM depletion (not
shown and 16), we noted that transferrin-containing recy-
cling endosomes were conspicuously absent from the peri-
nuclear area where they usually accumulate (Figure 9).
The effect of CALM depletion on the structural organiza-
tion of the TGN and the endosomal system suggests that
CALM plays an important role in both endocytic and TGN
to endosome clathrin-mediated trafficking.
Discussion
The formation of clathrin-coated vesicles is a highly com-
plex and dynamic process where nucleation, growth of the
coat and budding of a transport vesicle is coordinated with
cargo loading. Nucleation of clathrin lattices appears to be
dependent on high local concentrations of PtdIns-4,5-P
2
in
the plasma membrane (26) which supports the association
with the plasma membrane of the endocytic proteins
CALM/AP180, epsin and AP2 in addition to a number of
regulatory proteins and alternative adaptors (2). The gen-
eration of PtdIns-4,5-P
2
is dependent on the activity of
phosphatidylinositol-4-P 5-kinase, which in turn is acti-
vated by the small G-protein Arf6 (27). The initially weak
association of AP2 with the membrane might be fortified
by its interaction with synaptotagmin (28) and by acces-
sory proteins such as CALM/AP180, epsin, Eps15 and,
last but not least, by clathrin. Live cell imaging also pro-
vided insight into the striking dynamics of clathrin triskelia
during the lifetime of a coated bud. Far from being cemen-
ted into the lattice, individual clathrin triskelia rapidly
exchange between the cytosol and the lattice (29). This
highly dynamic equilibrium may readily explain rearrange-
ments in the lattice structure that accompany or even
power the gradual transition from shallow to deeply inva-
ginated coated membranes. It is very likely that accessory
coat proteins and adaptors influence the dynamics of the
coat and thereby the structure of coated buds. For this
reason, we characterized the cellular function of CALM in
more detail using an siRNA approach. We first explored
the tight link between CALM and AP2, which became
apparent in HeLa cells that were depleted of clathrin or
AP2. The depletion of clathrin had little effect on either
AP2 or CALM, both of which remained tightly organized in
small puncta at the plasma membrane in the absence of
clathrin. In contrast, depletion of AP2 resulted not only in a
severe reduction of plasma membrane-associated clathrin
but it also lead to the release of CALM from the mem-
brane (Figure 3). In the reciprocal experiment, CALM
depletion did not cause the translocation of AP2 from
the membrane to the cytosol. This clearly suggests that
AP2 can stably associate with the membrane without
CALM but not vice versa. The interaction between
CALM and the platform subdomain of a-adaptin involves
the
420
DPF and
375
DIF motifs, both of which seem to
contribute equally to the binding, and a novel
489
FESVF
motif. Because rodent CALM and a major splice variant of
human CALM lack the DPF motif, it is important to note
that the
489
FESVF together with the
375
DIF motif suffice
for an interaction with AP2. CALM also interacts with
clathrin; however, its interaction with the clathrin TD in
pulldown experiments seems weak, especially when
550
Control
550
450
450
350
Minor axis (nm)
Major axis (nm)
350
250
250
150
150
50
50
550
Knockdown
550
450
450
350
Minor axis (nm)
Major axis (nm)
350
250
250
150
150
50
50
Figure 7: Size distribution of plasma membrane–associated
clathrin-coated structures in control and CALM-knockdown
cells. The major and minor dimensions of individual coated struc-
tures were determined in control and knockdown cells and
plotted. A total of 1123 clathrin structures from 28 cells were
counted for the control and 1238 coats from 28 cells for the
knockdown. Note that the coats in control cells fall within a
narrower size range than the coats in the CALM-depleted cells.
Meyerholz et al.
1230 Traffic 2005; 6: 1225–1234
Page 6
compared directly with the a-appendage domain of AP2
(Figure 2F). In this respect, CALM differs from AP180 that
is known to bind avidly to the clathrin TD [(30) and data not
shown]. This difference in affinity for clathrin might be
readily explained by the numerous DLL-type motifs pre-
sent in AP180 that have been implicated in the interaction
with the clathrin TD (30). However, the modest affinity of
CALM for clathrin is probably compensated by its interac-
tion with Eps15 through the NPF-motif, which is missing
in AP180 (18). In fact, for squid AP180, it was demon-
strated that its in vitro clathrin assembly activity was sig-
nificantly boosted upon addition of purified Eps15 (18).
The alterations in AP2 and clathrin staining at the plasma
membrane that were noted using immunofluorescence in
CALM-depleted HeLa cells (Figure 4) were shown using
electron microscopy to reflect large and irregularly shaped
clathrin coats that were very rarely seen in overviews of
the inner surface of the plasma membrane of control cells.
Occasionally, the flat lattices were decorated with mini
coats. Superficially, these structures seem almost identi-
cal to the ‘mini coats’ that previously were observed in
cells that were exposed either to potassium depleted- or
hypertonic media or to conditions that acidified the cytosol
(31,32). The ultrastructural phenotype of the CALM knock-
down directly supports the conjecture that CALM is
involved in the regulation of the size of clathrin-coated
buds at the plasma membrane. This function would be
analogous to that proposed for AP180 in nerve terminals
on the basis of genetic perturbations in Drosophila and
C. elegans (11,33). In both organisms, mutations of the
respective AP180 orthologs resulted in the accumulation
of enlarged synaptic vesicles that were believed to
originate directly from endocytosed synaptic vesicle
membrane. Despite the gross overall changes in coat struc-
tures, we and others did not see any significant reduction in
the rates of transferrin uptake and recycling of transferrin
[data not shown and ref (16)]. However, we noted disrupt-
ing effects on the organization of the endosomal system.
After 10 min of uptake, transferrin-containing endosomes
CALM AP1
CALM GT
CALM Syntaxin 6
20
μm
Figure 8: Effect of CALM deple-
tion on AP1, syntaxin 6 and
b-1,4-galactosyltransferase
(GT). Reduction of CALM dis-
persed TGN-associated AP1 and
syntaxin 6, whereas the trans-
Golgi marker protein GT was not
affected.
CALM and Clathrin Coat Formation
Traffic 2005; 6: 1225–1234 1231
Page 7
were still scattered throughout CALM-knockdown cells,
whereas in control cells the transferrin was found already
concentrated in the perinuclear region. Similarly, the
cation-independent mannose-6-phosphate receptor and
the endosomal marker EEA1 shifted from the perinuclear
region to more peripherally located structures (Figure 9).
Even the TGN-associated AP1 adaptor was found on scat-
tered vesicular structures throughout the cell, and as
judged by the altered distribution of syntaxin 6, the TGN
seemed also effected (Figure 8). There are at least two
possibilities to explain the effects of CALM depletion on
the endosomal system and the TGN: the most likely con-
jecture is that the cellular function of CALM is not
restricted to the budding of endocytic vesicles at the
plasma membrane. However, to date, there is little mor-
phological evidence for the presence of CALM on internal
organelles. That such an association is in principle possible
can be observed in cells that overexpress YFP-CALM (14).
In addition, treatment of cultured primary fibroblasts with
the cationic amphiphilic drug chlorpromazine results in the
association of AP2 and also of clathrin with endosomal
membranes (34). We made similar observations with
HeLa cells, where we found that significant amounts of
CALM were also translocated together with AP2 to endo-
somal membranes (data not shown). Overall, chlorproma-
zine treatment of cells strongly increases the
concentration of PtdIns-4-P, while the level of PtdIns-4,5-
P
2
is only slightly effected (35). Moreover, it was observed
that the level of PtdIns-4,5-P
2
on internal membranes was
increased on the expense of PtdIns-4,5-P
2
concentration
in the plasma membrane (35). Although overexpression of
CALM or treatment of cells with cationic amphiphilic drugs
constitute unphysiological situations, both manipulations
indicate nevertheless that endosomal membranes have
the principal potential of associating with CALM. Under
physiological conditions, these interactions might occur
only transiently and below the current level of detection,
but they might be important for organelle homeostasis.
Given the intimate relationship of the endosomal system
with the TGN, it is not surprising that this compartment
becomes also effected by any disturbances of the mem-
brane flow within the endosomal system. Organelle
homeostasis critically depends on the production and turn-
over of phosphoinositides. For AP180, it was demon-
strated that this protein regulates the activity of
phospholipase C-g1 (36). Given the close homology
between CALM and AP180, it is also possible that the
CALM knockdown interferes with the turnover of phos-
phoinositides. A further hint for a more complex function
of CALM is the significant reduction in EGF uptake in
CALM-depleted cells, first reported by Sorkin and co-workers
(16) and confirmed by us in the context of this study (data
not shown). However, further studies are needed to deter-
mine whether this phenotype results from a disorganized
endosomal compartment or alternatively indicates an addi-
tional function for CALM in the trafficking of signaling
receptors.
Materials and Methods
Antibodies and cDNA constructs
Mouse monoclonal antibodies used for immunofluorescence: X22, anti-
clathrin heavy chain (37); AP.6, anti-a adaptin (37,38); mab 100/3, anti-g
adaptin (39); anti-EEA1 (BD Biosciences, Lexington, KY, USA); anti-syntaxin
6 (BD Biosciences). For detection of CALM, we used the goat antibody sc-
6433 (Santa Cruz, CA, USA) and a rabbit anti-peptide serum (22).
CALM EEA1
CALM Tf
Figure 9: Endosomes in CALM-
depleted HeLa cells. Ten minutes
after uptake, transferrin-loaded
endosomes fail to concentrate in
the perinuclear region of the knock-
down cells. Endosomes associated
with the early endosomal marker
EEA1 remain scattered throughout
knockdown cells. Bar: 20 mm.
Meyerholz et al.
1232 Traffic 2005; 6: 1225–1234
Page 8
Antibodies used for Western blotting: anti-clathrin heavy chain mouse
monoclonal (BD Biosciences) and goat anti-CALM (sc-6433, Santa Cruz).
Rabbit polyclonal antibodies used for immunofluorescence and Western
blotting: affinity-purified R461 (anti-clathrin light chains) (39). Antisera direc-
ted against Eps15, actin and epsin were described previously (22). The
polyclonal rabbit antibody against the cation-independent mannose-6-phos-
phate receptor was obtained from B Hoflack (Dresden, Germany). The
polyclonal rabbit antibody against EEA1 was from M Zerial (Dresden). A
second polyclonal rabbit antibody against epsin used for immunofluores-
cence was obtained from L Traub (Pittsburgh, PA, USA) (40). The mouse
monoclonal antibody against GT was from J Rohrer (Zu¨ rich, Zwitzerland).
Fluoresceine- or rhodamine-labeled anti-mouse or anti-rabbit antibodies
were from Molecular Probes (Leiden, the Netherlands). Secondary horse-
radish peroxidase-conjugated anti-mouse, anti-goat and anti-rabbit antibo-
dies were from ICN (Aurora, OH, USA). Texas-Red labeled transferrin was
from Molecular Probes. YFP-CALM was provided by S Bohlander (Munich,
Germany). YFP-
420
APA-CALM, YFP-
375
AIA-CALM, YFP-
489
AESVA-CALM as
well as the triple mutant were generated using the QuikChange mutagenesis
kit (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instruc-
tions. Mutations were confirmed using DNA sequencing (MWG Biotech,
Eberberg, Germany). R Anderson provided the construct for the GST-a-
appendage domain of murine a
c
(residues 701–938) (41). L Traub provided
the GST-a-appendage mutants W840A and Q782A (17,20). The construct for
GST-clathrin N-TD (residues 1–579) was kindly provided by J Keen (42).
SiRNA
The CALM siRNAs oligo I [GAAAUGGAACCACUAAGAA; identical to Oligo
2 in Huang et al. (16)], oligo II (AAUGGGGUAAUAAAUGCUGCCUU) (22)
and the a-adaptin siRNA (GCAUGUGCACGCUGGCCAG) were from
Dharmacon (Lafayette, LA, USA)
Cell culture and transfection
HeLa SS6 cells were cultured as described previously (22) and transfected with
siRNAs using Lipofectamine 2000 (Invitrogen, Karlsruhe, Germany) following
the manufacturer’s recommendation. Control cells were either transfected
with luciferase-specific siRNA or mock transfected with transfection reagent.
Cells were assayed using Western blotting, immunofluorescence or electron
microscopy 3 days after transfection unless stated otherwise in the figure
legends. When cells were assayed using immunofluorescence, control and
knockdown cells were trypsinized, mixed and replated on glass cover slips 2
days after transfection. For transfection with YFP-CALM constructs, 1 10
6
cells were seeded in 10-cm dishes and on the following day transfected with
24 mg DNA and 30 ml Lipofectamine 2000 per dish.
Pulldown assays
GST-fusion proteins used in binding studies were purified as described
previously (43). Binding assays using rat brain cytosol and lysates from
transfected HeLa cells as the source for YFP-CALM were performed as
described recently (44).
Immunofluorescence microscopy
Internalization studies with fluorescent transferrin and immunofluores-
cence were performed as described by Kalthoff et al. (45). Stained cells
were viewed with an AxioCam MRm digital camera controlled by
AXIOVISION
(Rel. 4.2) software (Carl Zeiss AG, Oberkochen, Germany). In some
instances, image stacks were taken and deconvoluted using the deconvo-
lution software package
AXIOVISION. Final images were arranged and labeled
using a Macintosh G4 Computer with Adobe Photoshop 7.0 software.
Electron microscopy
For thin section electron microscopy, HeLa SS6 cells were grown in 2-ml
culture dishes. The cells were trypsinized (Trypsin/ethylenediaminetetra-
acetic acid; Invitrogen) for 2 min, pelleted using centrifugation, washed
twice with PBS and immersed in 3% glutaraldehyde buffered in 0.1
M
Na-cacodylate-HCl (pH 7.3) for 4 h at 4
C. Next, the cells were washed
in 0.1
M Na-cacodylate, postfixed for 90 min with 2% OsO
4
(Polysciences
Inc., Warrington, PA, USA) in the same buffer, then reacted with 1% tannic
acid (Mallinckrodt, St. Louis, MO, USA) and subsequently with 1%
Na
2
SO
4
, both in 0.1 M Na-cacodylate. Upon dehydration, in an ascending
series of ethanol, the cells were embedded in epoxy resin (Serva,
Heidelberg, Germany). Specimens destined for immunogold labeling
were fixed in PBS containing 4% formaldehyde for 4 h at 4
C and then
dehydrated and embedded as described above. For conventionally
embedded specimens, ultrathin sections were cut with a Reichert-Jung
Ultracut E ultramicrotome (Leica, Wetzlar, Germany) and collected on
formvar-coated copper slot grids. For immunogold labeling, thin sections
of formaldehyde-fixed cells were collected on uncoated nickel grids.
Immunostaining was performed as described previously (46).
All sections were stained with uranylacetate and lead citrate and examined with
a Zeiss EM 10 CR electron microscope at an acceleration voltage of 80 kV.
HeLa cells grown on glass cover slips were ‘unroofed exactly as described by
Heuser (23). Afterwards, the cover slips were washed for about 10 s with
buffer G (25 m
M Hepes, 125 mM K-Acetate, 50 mM Mg-Acetate,pH7.3)and
then immediately fixed for 30 min in 2% glutaraldehyde (EM grade) in G. The
samples were then washed with distilled water. In most instances, the cells
were treated with 0.1% tannic acid (Mallinckrodt, St. Louis, MO, USA) in
water, then washed three times with water and stained with 0.2% uranyla-
cetate according to a previously published protocol (24). Next, the water was
gradually exchanged for acetone by passing the cover slips through a series of
2 30%, 2 50%, 2 70%, 2 90% and 4 100% acetone for 3 min
each. The acetone was dried using a 4 A
˚
molecular sieve (Roth, Karlsruhe,
Germany). The specimens were critical point dried in a Balzers CPD 030
device (Balzers AG, Balzers, Liechtenstein) and then rotary shadowed at an
angle of 27
with Pt/C using an electron beam gun in a Balzers BAF 400 T-
freeze-etching device (Balzers AG). The replica was stabilized with a 100–
200 A
˚
carbon film. Replicas were dissociated from the glass with 1020%
hydrofluoric acid. The replica was first washed with distilled water afterwards
with household bleach followed by two additional washes with distilled water.
Finally, the replicas were placed on 200 mesh copper grid and viewed in a
Zeiss EM 902 electron microscope at 80 kV. Morphometric analyses were
performed using the
ZEISS AXIOVISION 4.2 software and MS-Excel.
Acknowledgments
Gerhard Preiss, Beate Großmann, Christiane Lemke, Angelika Hundt and
Huberta Ungewickell are thanked for expert technical assistance. John
Heuser is thanked for his advice and Alexander Ungewickell for his com-
ments on the manuscript. This study was supported by grants from the
German Research Foundation to EU (UN 43/4 and UN 43/5) and from the
Hannover Medical School (HiLF) to AM.
References
1. Brodsky FM, Chen CY, Knuehl C, Towler MC, Wakeham DE. Biological
basket weaving: formation and function of clathrin-coated vesicles.
Annu Rev Cell Dev Biol 2001;17:517–568.
2. Owen DJ, Collins BM, Evans PR. Adaptors for clathrin coats: structure
and function. Annu Rev Cell Dev Biol 2004;20:153–191.
3. Lemmon SK. Clathrin uncoating: Auxilin comes to life. Curr Biol
2001;11:R49–R52.
4. Dreyling MH, Martinez-Climent JA, Zheng M, Mao J, Rowley JD,
Bohlander SK. The t(10;11)(p13;q14) in the U937 cell line results in
the fusion of the AF10 gene and CALM, encoding a new member of
the AP-3 clathrin assembly protein family. Proc Natl Acad Sci USA
1996;93:4804–4809.
5. Stahelin RV, Long F, Peter BJ, Murray D, De Camilli P, McMahon HT,
Cho W. Contrasting membrane interaction mechanisms of AP180
N-terminal homology (ANTH) and epsin N-terminal homology (ENTH)
domains. J Biol Chem 2003;278:28993–28999.
6. Morgan JR, Zhao X, Womack M, Prasad K, Augustine GJ, Lafer EM. A
role for the clathrin assembly domain of AP180 in synaptic vesicle
endocytosis. J Neurosci 1999;19:10201–10212.
CALM and Clathrin Coat Formation
Traffic 2005; 6: 1225–1234 1233
Page 9
7. Jha A, Agostinelli NR, Mishra SK, Keyel PA, Hawryluk MJ, Traub LM. A
novel AP-2 adaptor interaction motif initially identified in the long-splice
isoform of synaptojanin 1, SJ170. J Biol Chem 2004;279:2281–2290.
8. Praefcke GJ, Ford MG, Schmid EM, Olesen LE, Gallop JL, Peak-Chew SY,
Vallis Y, Babu MM, Mills IG, McMahon HT. Evolving nature of the AP2
alpha-appendage hub during clathrin-coated vesicle endocytosis.
EMBO J 2004;23:4371–4383.
9. Ritter B, Denisov AY, Philie J, Deprez C, Tung EC, Gehring K,
McPherson PS. Two WXXF-based motifs in NECAPs define the specificity
of accessory protein binding to AP-1 and AP-2. Embo J 2004;23:3701–3710.
10. Confalonieri S, Di Fiore PP. The Eps15 homology (EH) domain. FEBS
Lett 2002;513:24–29.
11. Nonet ML, Holgado AM, Brewer F, Serpe CJ, Norbeck BA, Holleran J,
Wei L, Hartwieg E, Jorgensen EM, Alfonso A. UNC-11, a Caenorhabditis
elegans AP180 homologue, regulates the size and protein composition
of synaptic vesicles. Mol Biol Cell 1999;10:2343–2360.
12. Koh TW, Verstreken P, Bellen HJ. Dap160/intersectin acts as a stabiliz-
ing scaffold required for synaptic development and vesicle endocyto-
sis. Neuron 2004;43:193–205.
13. Ford MG, Pearse BM, Higgins MK, Vallis Y, Owen DJ, Gibson A,
Hopkins CR, Evans PR, McMahon HT. Simultaneous binding of
PtdIns (4,5),P2 and clathrin by AP180 in the nucleation of clathrin
lattices on membranes. Science 2001; 291:1051–1055.
14. Tebar F, Bohlander SK, Sorkin A. Clathrin assembly lymphoid myeloid
leukemia (CALM) protein: localization in endocytic–coated pits, inter-
actions with clathrin, and the impact of overexpression on clathrin-
mediated traffic. Mol Biol Cell 1999;10:2687–2702.
15. Tuschl T, Borkhardt A. Small interfering RNAs: a revolutionary tool for
the analysis of gene function and gene therapy. Mol Interv
2002;2:158–167.
16. Huang F, Khvorova A, Marshall W, Sorkin A. Analysis of clathrin-
mediated endocytosis of epidermal growth factor receptor by RNA
interference. J Biol Chem 2004;279:16657–16661.
17. Mishra SK, Hawryluk MJ, Brett TJ, Keyel PA, Dupin AL, Jha A,
Heuser JE, Fremont DH, Traub LM. Dual engagement regulation of
protein interactions with the AP-2 adaptor alpha appendage. J Biol
Chem 2004;279:46191–46203.
18. Morgan JR, Prasad K, Jin S, Augustine GJ, Lafer EM. EPS15 homology
domain–NPF motif interactions regulate clathrin coat assembly during
synaptic vesicle recycling. J Biol Chem 2003;278:33583–33592.
19. Traub LM, Downs MA, Westrich JL, Fremont DH. Crystal structure of
the alpha appendage of AP-2 reveals a recruitment platform for
clathrin-coat assembly. Proc Natl Acad Sci USA 1999;96:8907–8912.
20. Brett TJ, Traub LM, Fremont DH. Accessory protein recruitment motifs
in clathrin-mediated endocytosis. Structure (Camb) 2002;10:797–809.
21. ter Haar E, Musacchio A, Harrison SC, Kirchhausen T. Atomic structure
of clathrin: a beta propeller terminal domain joins an alpha zigzag linker.
Cell 1998;95:563–573.
22. Hinrichsen L, Harborth J, Andrees L, Weber K, Ungewickell EJ. Effect
of clathrin heavy chain- and alpha-adaptin-specific small inhibitory
RNAs on endocytic accessory proteins and receptor trafficking in
HeLa cells. J Biol Chem 2003;278:45160–45170.
23. Heuser J. The production of ‘cell cortices’ for light and electron micro-
scopy. Traffic 2000;1:545–552.
24. Svitkina TM, Borisy GG. Correlative light and electron microscopy of the
cytoskeleton of cultured cells. Methods Enzymol 1998;298:570–592.
25. Roth J, Berger EG. Immunocytochemical localization of galactosyl-
transferase in HeLa cells: codistribution with thiamine pyrophospha-
tase in trans-Golgi cisternae. J Cell Biol 1982;93:223–229.
26. Padron D, Wang YJ, Yamamoto M, Yin H, Roth MG.
Phosphatidylinositol phosphate 5-kinase Ibeta recruits AP-2 to the
plasma membrane and regulates rates of constitutive endocytosis.
J Cell Biol 2003;162:693–701.
27. Krauss M, Kinuta M, Wenk MR, De Camilli P, Takei K, Haucke V. ARF6
stimulates clathrin/AP-2 recruitment to synaptic membranes by acti-
vating phosphatidylinositol phosphate kinase type Igamma. J Cell Biol
2003;162:113–124.
28. Zhang JZ, Davletov BA, Sudhof TC, Anderson RG. Synaptotagmin I is a
high affinity receptor for clathrin AP-2: implications for membrane
recycling. Cell 1994;78:751–760.
29. Wu X, Zhao X, Baylor L, Kaushal S, Eisenberg E, Greene LE. Clathrin
exchange during clathrin-mediated endocytosis. J Cell Biol
2001;155:291–300.
30. Morgan JR, Prasad K, Hao W, Augustine GJ, Lafer EM. A conserved
clathrin assembly motif essential for synaptic vesicle endocytosis.
J Neurosci 2000;20:8667–8676.
31. Heuser J. Effects of cytoplasmic acidification on clathrin lattice mor-
phology. J Cell Biol 1989;108:401–411.
32. Heuser JE, Anderson RG. Hypertonic media inhibit receptor-mediated
endocytosis by blocking clathrin-coated pit formation. J Cell Biol
1989;108:389–400.
33. Zhang B, Koh YH, Beckstead RB, Budnik V, Ganetzky B, Bellen HJ.
Synaptic vesicle size and number are regulated by a clathrin adaptor
protein required for endocytosis. Neuron 1998;21:1465–1475.
34. Wang LH, Rothberg KG, Anderson RG. Mis-assembly of clathrin lat-
tices on endosomes reveals a regulatory switch for coated pit forma-
tion. J Cell Biol 1993;123:1107–1117.
35. Raucher D, Sheetz MP. Phospholipase C activation by anesthetics
decreases membrane-cytoskeleton adhesion. J Cell Sci
2001;114:3759–3766.
36. Han SJ, Lee JH, Hong SH, Park SD, Kim CG, Song MD, Park TK, Kim CG.
AP180 binds to the C-terminal SH2 domain of phospholipase
C-gamma1 and inhibits its enzymatic activity. Biochem Biophys Res
Commun 2002;290:35–41.
37. Brodsky FM. Clathrin structure characterized with monoclonal anti-
bodies. II. Identification of in vivo forms of clathrin. J Cell Biol
1985;101:2055–2062.
38. Chin DJ, Straubinger RM, Acton S, Nathke I, Brodsky FM. 100-kDa
polypeptides in peripheral clathrin-coated vesicles are required for
receptor-mediated endocytosis. Proc Natl Acad Sci USA
1989;86:9289–9293.
39. Ahle S, Mann A, Eichelsbacher U, Ungewickell E. Structural relation-
ships between clathrin assembly proteins from the Golgi and the
plasma membrane. EMBO J 1988;7:919–929.
40. Drake MT, Downs MA, Traub LM. Epsin binds to clathrin by associating
directly with the clathrin- terminal domain. Evidence for cooperative
binding through two discrete sites. J Biol Chem 2000;275:6479–6489.
41. Wang LH, Sudhof TC, Anderson RG. The appendage domain of alpha-
adaptin is a high affinity binding site for dynamin. J Biol Chem
1995;270:10079–10083.
42. Goodman OB, Krupnick JG, Gurevich VV, Benovic JL, Keen JH.
Arrestin/clathrin Interaction. Localization of the arrestin binding locus
to the clathrin terminal domain. J Biol Chem 1997;272:15017–15022.
43. Scheele U, Kalthoff C, Ungewickell E. Multiple interactions of auxilin 1
with clathrin and the AP-2 adaptor complex. J Biol Chem
2001;276:36131–36138.
44. Ungewickell A, Ward ME, Ungewickell E, Majerus PW. The inositol
polyphosphate 5-phosphatase ocrl associates with endosomes that
are partially coated with clathrin. Proc Natl Acad Sci USA
2004;101:13501–13506.
45. Kalthoff C, Groos S, Kohl R, Mahrhold S, Ungewickell EJ. Clint: a novel
clathrin-binding ENTH-domain protein at the Golgi. Mol Biol Cell
2002;13:4060–4073.
46. Groos S, Reale E, Luciano L. Re-evaluation of epoxy resin sections for
light and electron microscopic immunostaining. J Histochem
Cytochem 2001;49:397–406.
Meyerholz et al.
1234 Traffic 2005; 6: 1225–1234
Page 10
  • Source
    • "Instead, our data are most consistent with a model according to which clathrin/AP180 depending on the frequency of firing reform Syb2-containing SVs either directly from the plasma membrane via conventional CME or from ELVs following clathrin-independent membrane retrieval (Kononenko and Haucke, 2015; Kononenko et al., 2014), possibly involving ultrafast (Watanabe et al., 2013b; Watanabe et al., 2014) or other forms of bulk endocytosis (Cheung and Cousin, 2013). Genetic manipulation of endocytic proteins in this model would lead to alterations in SV size and shape due to defects in membrane deformation and/or coat assembly as reported for several endocytic protein mutants (Dittman and Ryan, 2009; Ferguson et al., 2007; Milosevic et al., 2011; Nonet et al., 1999; Saheki and De Camilli, 2012; Zhang et al., 1998), acute perturbation of AP180 function in squid axons (Morgan et al., 1999), and endocytic vesicles in non-neuronal cells depleted of the clathrin-associated AP180 paralog CALM (Meyerholz et al., 2005; Miller et al., 2015). Neurons from AP180 À/À mice suffer from accelerated synaptic rundown, indicative of faster depletion of the releasable vesicle pool in response to repeated stimulation (seeFigure 3F ). "
    [Show abstract] [Hide abstract] ABSTRACT: Neurotransmission depends on synaptic vesicle (SV) exocytosis driven by soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex formation of vesicular synaptobrevin/VAMP2 (Syb2). Exocytic fusion is followed by endocytic SV membrane retrieval and the high-fidelity reformation of SVs. Syb2 is the most abundant SV protein with 70 copies per SV, yet, one to three Syb2 molecules appear to be sufficient for basal exocytosis. Here we demonstrate that loss of the Syb2-specific endocytic adaptor AP180 causes a moderate activity-dependent reduction of vesicular Syb2 levels, defects in SV reformation, and a corresponding impairment of neurotransmission that lead to excitatory/inhibitory imbalance, epileptic seizures, and premature death. Further reduction of Syb2 levels in AP180(-/-)/Syb2(+/-) mice results in perinatal lethality, whereas Syb2(+/-) mice partially phenocopy loss of AP180, indicating that reduced vesicular Syb2 levels underlie the observed defects in neurotransmission. Thus, a large vesicular Syb2 pool maintained by AP180 is crucial to sustain efficient neurotransmission and SV reformation.
    Full-text · Article · Sep 2015 · Neuron
  • Source
    • "Multiple studies indicate that proteins involved in CME and endosomal-lysosomal trafficking can play key roles in maintaining normal cellular cholesterol homeostasis505152535455. Given PICALM's well-established contribution to CME and its possible role in cellular trafficking, [2, 14, 56] we explored how PICALM perturbation might modulate cellular cholesterol metabolism . To this end, we used 13 C tracer analysis [39]. "
    [Show abstract] [Hide abstract] ABSTRACT: PICALM (Phosphatidyl Inositol Clathrin Assembly Lymphoid Myeloid protein) is a ubiquitously expressed protein that plays a role in clathrin-mediated endocytosis. PICALM also affects the internalization and trafficking of SNAREs and modulates macroautophagy. Chromosomal translocations that result in the fusion of PICALM to heterologous proteins cause leukemias, and genome-wide association studies have linked PICALM Single Nucleotide Polymorphisms (SNPs) to Alzheimer's disease. To obtain insight into the biological role of PICALM, we performed gene expression studies of PICALM-deficient and PICALM-expressing cells. Pathway analysis demonstrated that PICALM expression influences the expression of genes that encode proteins involved in cholesterol biosynthesis and lipoprotein uptake. Gas Chromatography-Mass Spectrometry (GC-MS) studies indicated that loss of PICALM increases cellular cholesterol pool size. Isotopic labeling studies revealed that loss of PICALM alters increased net scavenging of cholesterol. Flow cytometry analyses confirmed that internalization of the LDL receptor is enhanced in PICALM-deficient cells as a result of higher levels of LDLR expression. These findings suggest that PICALM is required for cellular cholesterol homeostasis and point to a novel mechanism by which PICALM alterations may contribute to disease.
    Full-text · Article · Jun 2015 · PLoS ONE
  • Source
    • "The liposomes were then collected by ultracentrifugation and subjected to negative staining electron microscopy. For ultra-thin sectioning, liposomes were pelleted and fixed with 3% glutaraldehyde, and further processed for embedding in Epon and staining, as described previously (Meyerholz et al., 2005). "
    [Show abstract] [Hide abstract] ABSTRACT: Pex11p family proteins are key players in peroxisomal fission, but their molecular mechanisms remains mostly unknown. In the present study, overexpression of Pex11pβ caused substantial vesiculation of peroxisomes in mammalian cells. This vesicle formation was dependent on dynamin-like protein 1 (DLP1) and mitochondrial fission factor (Mff), as knockdown of these proteins diminished peroxisomal fission after Pex11pβ overexpression. The fission-deficient peroxisomes exhibited an elongated morphology, and peroxisomal marker proteins, such as Pex14p or matrix proteins harboring peroxisomal targeting signal 1, were discernible in a segmented staining pattern, like beads on a string. Endogenous Pex11pβ was also distributed a striped pattern, but which was not coincide with Pex14p and PTS1 matrix proteins. Altered morphology of the lipid membrane was observed when recombinant Pex11p proteins were introduced into proteo-liposomes. Constriction of proteo-liposomes was observed under confocal microscopy and electron microscopy, and the reconstituted Pex11pβ protein localized to the membrane constriction site. Introducing point mutations into the N-terminal amphiphathic helix of Pex11pβ strongly reduced peroxisomal fission, and decreased the oligomer formation. These results suggest that Pex11p contributes to the morphogenesis of the peroxisomal membrane, which is required for subsequent fission by DLP1. © 2015. Published by The Company of Biologists Ltd.
    Full-text · Article · Apr 2015 · Biology Open
Show more