The mammalian Scribble polarity protein regulates epithelial cell adhesion and migration through E-cadherin

Article (PDF Available)inThe Journal of Cell Biology 171(6):1061-71 · January 2006with63 Reads
DOI: 10.1083/jcb.200506094 · Source: PubMed
Abstract
Scribble (Scrib) is a conserved polarity protein required in Drosophila melanogaster for synaptic function, neuroblast differentiation, and epithelial polarization. It is also a tumor suppressor. In rodents, Scrib has been implicated in receptor recycling and planar polarity but not in apical/basal polarity. We now show that knockdown of Scrib disrupts adhesion between Madin-Darby canine kidney epithelial cells. As a consequence, the cells acquire a mesenchymal appearance, migrate more rapidly, and lose directionality. Although tight junction assembly is delayed, confluent monolayers remain polarized. These effects are independent of Rac activation or Scrib binding to betaPIX. Rather, Scrib depletion disrupts E-cadherin-mediated cell-cell adhesion. The changes in morphology and migration are phenocopied by E-cadherin knockdown. Adhesion is partially rescued by expression of an E-cadherin-alpha-catenin fusion protein but not by E-cadherin-green fluorescent protein. These results suggest that Scrib stabilizes the coupling between E-cadherin and the catenins and are consistent with the idea that mammalian Scrib could behave as a tumor suppressor by regulating epithelial cell adhesion and migration.
THE JOURNAL OF CELL BIOLOGY
©
The Rockefeller University Press $8.00
The Journal of Cell Biology, Vol. 171, No. 6, December 19, 2005 1061–1071
http://www.jcb.org/cgi/doi/10.1083/jcb.200506094
JCB: ARTICLE
JCB 1061
The mammalian Scribble polarity protein regulates
epithelial cell adhesion and migration
through E-cadherin
Yi Qin,
1,2
Christopher Capaldo,
1,2
Barry M. Gumbiner,
3
and Ian G. Macara
1,2
1
Center for Cell Signaling,
2
Department of Microbiology, and
3
Department of Cell Biology, University of Virginia School of Medicine, Charlottesville, VA 22908
cribble (Scrib) is a conserved polarity protein re-
quired in
Drosophila melanogaster
for synaptic
function, neuroblast differentiation, and epithelial
polarization. It is also a tumor suppressor. In rodents,
Scrib has been implicated in receptor recycling and pla-
nar polarity but not in apical/basal polarity. We now
show that knockdown of Scrib disrupts adhesion between
Madin–Darby canine kidney epithelial cells. As a conse-
quence, the cells acquire a mesenchymal appearance, mi-
grate more rapidly, and lose directionality. Although tight
junction assembly is delayed, confluent monolayers re-
S
main polarized. These effects are independent of Rac ac-
tivation or Scrib binding to
PIX. Rather, Scrib deple-
tion disrupts E-cadherin–mediated cell–cell adhesion. The
changes in morphology and migration are phenocopied
by E-cadherin knockdown. Adhesion is partially rescued
by expression of an E-cadherin–
-catenin fusion protein
but not by E-cadherin–green fluorescent protein. These
results suggest that Scrib stabilizes the coupling between
E-cadherin and the catenins and are consistent with the
idea that mammalian Scrib could behave as a tumor sup-
pressor by regulating epithelial cell adhesion and migration.
Introduction
The development of epithelial sheets, which was one of the ear-
liest steps in the evolution of the metazoa, is of fundamental
importance in animal development (Schock and Perrimon,
2002; Nelson, 2003; Zegers et al., 2003). Apical/basal polariza-
tion of epithelial cells is essential to their function, and the loss
of polarity, as occurs during epithelial–mesenchymal transi-
tions (EMTs), has been implicated in tumor progression and
metastasis (Thiery, 2003). Genetic screens in model organisms
have uncovered several conserved proteins that are required for
cell polarization in many different contexts (Kemphues, 2000;
Tepass et al., 2001; Macara, 2004).
One group of three such proteins—Scribble (Scrib),
Discs large (Dlg), and Lethal giant larvae (Lgl)—identified in
Drosophila melanogaster
, also behave as tumor suppressors
(Jacob et al., 1987; Woods and Bryant, 1991; Bilder et al.,
2000; Bilder, 2004), and mutations in any of the genes for these
proteins cause overgrowth of embryonic tissue, particularly the
imaginal disc and brain cells, forming large amorphous masses.
Additionally,
Scrib
,
Lgl
, and
Dlg
mutants cooperate with onco-
genic
Ras
in the transformation of
D. melanogaster
eye disc
cells (Brumby and Richardson, 2003; Pagliarini and Xu, 2003).
Expression of activated Ras causes overproliferation, but the
cells remain in the epithelial layer. However, in the context of a
Scrib
mutant, the Ras cells become metastatic. They degrade
the basement membrane, migrate, and invade neighboring
wild-type tissues. The key mechanism underlying this transi-
tion is the loss of E-cadherin, a transmembrane protein that
forms the adherens junction between epithelial cells and is es-
sential for apical/basal polarization. Forced coexpression of
E-cadherin inhibits invasion (Pagliarini and Xu, 2003).
Scrib is required for maintenance of apical/basal polarity
in
D. melanogaster
epithelial cells (Bilder et al., 2000) but is
also important in synaptic function (Peng et al., 2000) and
in neuroblast asymmetric cell divisions (Albertson and Doe,
2003). The molecular basis for loss of polarity in
D. melano-
gaster
embryos lacking Scrib is not yet entirely understood.
However, elegant genetic analyses revealed that in embryonic
epithelial cells they are part of a complex network involving
multiple polarity proteins (Bilder et al., 2003; Tanentzapf and
Tepass, 2003). The Par-3 polarity complex functions in the ini-
tial specification of the apical domain, and Scrib apparently
helps specify the basolateral surface by repressing the activity
of Par-3. The Crumbs polarity complex is recruited to the apical
Correspondence to Ian G. Macara: igm9c@virginia.edu
Abbreviations used in this paper: EMT, epithelial–mesenchymal transition; ERK,
extracellular signal–regulated kinase; HGF, hepatocyte growth factor; KD,
knockdown; PDZ, PSD-95, ZO-1, and Discs-large; RNAi, RNA interference;
shRNA, small hairpin RNA.
The online version of this article contains supplemental material.
JCB • VOLUME 171 • NUMBER 6 • 20051062
surface by Par-3 and somehow represses Scrib activity. Thus,
the balance between these three groups of polarity proteins lim-
its the extent of the apical and basolateral membranes, but the
molecular mechanisms by which they do this are still unknown.
The mammalian orthologue of Scrib has not yet been
implicated in apical/basal polarization or as a tumor suppressor.
Intriguingly, however, it is targeted for destruction by the E6
oncoprotein of human papillomavirus, the major cause of
cervical cancer (Nakagawa and Huibregtse, 2000). More-
over, progression of uterine cervical carcinomas from pre-
cursor lesions to invasive cancers correlates with a dramatic
decrease in Scrib expression (Nakagawa et al., 2004). Unex-
pectedly, murine Scrib appears to be involved in planar po-
larity because a mutation that introduces a premature stop
codon in the protein causes a defect in the planar polariza-
tion of the inner ear epithelium (Montcouquiol et al., 2003;
Murdoch et al., 2003). Nonetheless, Scrib is widely expressed
and associates with the lateral membranes in epithelial cells
through a mechanism that appears to involve E-cadherin
(Navarro et al., 2005).
Scrib is a large multidomain protein that contains 16
NH
2
-terminal leucine-rich repeats, four PSD-95, ZO-1, and
Discs-large (PDZ) domains, and an uncharacterized COOH-
terminal region (Humbert et al., 2003; Bilder, 2004). It be-
longs to a family of so-called LAP (leucine-rich repeats and
PDZ) proteins, which includes Erbin and Densin-180, although
it remains unclear whether any of these proteins possess related
functions. Recently, mammalian Scrib was found to bind
through its PDZ domains to the COOH terminus of
PIX, a
guanine nucleotide exchange factor for Rac (Audebert et al.,
2004). This interaction has been implicated in thyrotropin re-
ceptor endocytosis and recycling, but whether it is involved in
cell polarity is not known (Lahuna et al., 2005). In
D. melano-
gaster
it is unlikely that a homologous interaction is important
because the PDZ domains of Scrib are dispensable for epithe-
lial polarization and for control of cell proliferation (Albertson
et al., 2004; Zeitler et al., 2004). Other binding partners for
mammalian Scrib have been reported recently, but their physi-
ological significance remains unclear (Metais et al., 2005;
Petit et al., 2005).
Given the paucity of data on the functions of mammalian
Scrib and the potential importance of the protein in embryonic
development and tumor progression, we investigated the role
of Scrib in MDCK epithelial cells by RNA interference
(RNAi). Cells lacking Scrib appear relatively normal at high
density, when they have formed polarized monolayers, but they
exhibit profound defects at lower cell densities. The cells ap-
pear to undergo a morphological EMT, migrate more rapidly,
and lose directionality during migration. A substantial loss of
cell–cell adhesion occurs as a result of reduced E-cadherin
activity. Therefore, mammalian Scrib plays a key role in reg-
ulating E-cadherin activity, and its loss is predicted to enhance
tumor migration and invasion.
Results
Gene silencing of Scrib in MDCK cells
Several target sequences were selected from the partial canine
Scrib
gene and used to construct pSUPER vectors for the
expression of small hairpin RNAs (shRNAs). Of the three
sequences tested, two efficiently knocked down Scrib expres-
sion when expressed by transient transfection in MDCK II
cells (Fig. 1 A). Immunofluorescence microscopy revealed
Scrib to be associated with the lateral membranes in mamma-
lian epithelial cells, and staining was substantially reduced
by transfection with the ScrbKD1 or 2 vectors (Fig. 1 B).
Figure 1. Suppression of Scrib expression in
MDCK cells causes a delay in tight junction
assembly. (A) MDCK II cells were transiently
transfected with either pS-Luciferase vector
(Luc) as a control or three pSUPER constructs
targeting different sequences of canine Scrib
mRNA (ScrbKD). Equal amounts of proteins
were analyzed by SDS-PAGE and immunoblot.
(B) Control and ScrbKD MDCK cells grown at
high density were fixed and stained for Scrib
and occludin. (C) Control and ScrbKD cells
were subjected to a calcium switch and then
fixed and stained for ZO-1 at the indicated
times after readdition of calcium. Magnified
details of the junctions are shown in inverted
black-and-white scale to highlight the defects
caused by loss of Scrib.
SCRIBBLE REGULATES ADHERENS JUNCTIONS • QIN ET AL.
1063
Surprisingly, however, the tight junctions appeared to be in-
tact in these cells, as assessed by occludin staining (Fig. 1 B)
or ZO-1 staining (not depicted). Moreover, confocal sections
of cells stained for the apical marker gp135 revealed no loss
of apical/basal polarization in cells expressing reduced Scrib
levels (Fig. S1, available at http://www.jcb.org/cgi/content/
full/jcb.200506094/DC1), and cysts grown in Matrigel ap-
peared to be polarized normally (not depicted). These results
suggest that depletion of Scrib does not disrupt tight junction
assembly. However, when the transfected cells were sub-
jected to a calcium switch and stained for ZO-1, a short delay
in junction assembly was observed (Fig. 1 C). ZO-1 accumu-
lated rapidly at the cell–cell contacts in both the control and
Scrib knockdown (KD) cells but, in the absence of Scrib, the
fusion of the ZO-1 lines into a continuous band encircling
each cell was delayed. The defect was particularly noticeable
at vertices where several cell boundaries meet. By 20 h after
calcium switch, however, the ZO-1 staining in the cells lack-
ing Scrib was indistinguishable from that in the control cells.
Scrib is required for maintenance of an
epithelial phenotype at low cell densities
When cells were transfected with pS-ScrbKD vectors and plated
at low densities, they consistently displayed a mesenchymal phe-
notype. Normal MDCK cells organize into discrete, tight islands
with smooth boundaries, but cells lacking Scrib appeared more
fibroblastic (Fig. 2, A and B). They spread over a much larger sur-
face area (approximately three to five times larger; Fig. 2 C), and
the edges of the cell clusters were disorganized as though the cells
were moving apart from one another. When stained with phalloi-
din, the normal cortical actin rings were absent in cells lacking
SCRIB and were replaced by stress fibers often oriented along the
long axis of the cells (Fig. 2 B). These observations suggested that
Scrib might regulate epithelial cell adhesion and/or migration.
Scrib inhibits cell motility and is required
for oriented migration
To determine whether Scrib regulates MDCK cell motility,
transfected cells were plated onto 8-
m filters in Boyden
Figure 2. Cells lacking Scrib lose their epithelial morphology at low density.
(A) Control (Luc) and ScrbKD cells were grown on 6-well plates at low
density for 3 d. Images were obtained by phase-contrast microscopy using a
10 objective. (B) Control and ScrbKD cells were fixed and stained with
phalloidin to visualize F-actin. Typical colonies are shown. (C) Surface areas
per cell (m
2
) were measured for 80–90 frames (as shown in A) and sorted
into bins 200 m
2
wide. The percentage of cells in each bin is shown.
Figure 3. Suppression of Scrib expression increases cell motility and
attenuates orientated migration. (A) Motility of cells transfected with Luc,
ScrbKD1 shRNA, or ScrbKD1 plus GFP-tagged human Scrib was mea-
sured using a Boyden chamber assay. Images were captured after crystal
violet staining of the cells at the bottom side of the filter. (B) Quantification
of cell migration by measuring A595 of eluted crystal violet. Error bars
represent mean SD. (C) Immunoblot analysis of transfected cells with
anti-Scrib antibody. Equal protein concentrations were loaded and nor-
malized using anti-tubulin. (D) Rose plot of individual cell tracks from time-
lapse movies of the wounding assay.
JCB • VOLUME 171 • NUMBER 6 • 20051064
chambers and incubated in normal medium containing 10%
serum (both above and below the filter). The same number of
cells was plated onto each filter. After 16–20 h, cells that had
migrated through the pores to the bottom surface of the filters
were stained with crystal violet. Loss of Scrib substantially in-
creased the number of cells that had migrated through the filter
(Fig. 3, A and B). Importantly, when we expressed a GFP fusion
of a human Scrib in the cells transfected with the pS-ScrbKD1
vector, the number of cells migrating through the filter was re-
duced to control levels (Fig. 3, A and B). It was conceivable
that the reversion to a wild-type phenotype was caused by reex-
pression of the endogenous protein. To test for this possibil-
ity, we blotted cell lysates for Scrib (Fig. 3 C). The endoge-
nous Scrib protein level was reduced upon expression of the
ScrbKD1 shRNA and did not respond to coexpression of the
human GFP–Scrib fusion. The GFP–Scrib fusion can be dis-
tinguished by its lower mobility on SDS-PAGE and was ex-
pressed at approximately two to three times the level of the
endogenous protein in control cells (Fig. 3 C). These data
prove that the effects of Scrib RNAi on motility are indeed
caused by loss of the Scrib protein rather than by off-target
effects of the shRNA.
The filter assay depends not only on cell motility but also
on the rate of cell attachment to and spreading on the filter sur-
face. Therefore, as an alternative approach to measuring cell
motility, we performed wounding assays on MDCK monolay-
ers and tracked the movement of individual cells within the
population at the wound edge by time-lapse microscopy. The
overall rate of wound closure was similar for both the control
cells and those lacking Scrib (0.35 vs. 0.32
m/min). However,
the behavior of cells lacking Scrib was remarkably different
from that of the control (Videos 1 and 2, available at http://
www.jcb.org/cgi/content/full/jcb.200506094/DC1). At the edges
of the wound, control cells extruded lamellipodia and moved
forward as an organized sheet, but the KD cells were less orga-
nized. Some of the KD cells lost their attachment to the sheet,
pulled away from the leading edge, and moved in random di-
rections. This difference can be seen in the Rose plots of cells
tracked over the period of the assay (Fig. 3 D). Calculation of
directionality parameters confirmed that the cells lacking Scrib
move at a significantly higher speed than control cells (2.54
0.19 vs. 1.73
0.41
m/min; P
0.026) and with a lower per-
sistence coefficient (4.3 vs. 11.6 min; P
0.02). The reduced
persistence accounts for the similarity in the overall rate of
wound closure. Interestingly, cells further back from the
wound exhibited a continual jiggling motion, as if they had lost
adhesion to their neighbors and were trying to move away from
one another, and transient gaps appeared in the monolayer
(Video 2). These results support the data shown in Fig. 2, sug-
gesting that loss of Scrib causes a defect in cell–cell adhesion.
Scrib effects are not mediated by
PIX binding
Cell movement is regulated by Rac, and this GTPase has also
been implicated in controlling adhesion between epithelial
cells (Ehrlich et al., 2002; Van Aelst and Symons, 2002; Chu et
al., 2004). Interestingly, Scrib has been reported to bind, via
its PDZ domains, to the COOH terminus of the Rac guanine
nucleotide exchange factor,
PIX (Audebert et al., 2004). To
determine whether the SCRIB–
PIX interaction is important in
Figure 4. PIX is not involved in Scrib function
at adherens junctions. (A) MDCK II cells were
transiently transfected with either pS-Luciferase
control vector (Luc) or three pSUPER constructs
targeting different sequences of canine PIX
mRNA (PixKD). Proteins were analyzed by
SDS-PAGE and immunoblot. (B) Quantification
of Boyden chamber migration assay with Luc,
ScrbKD, and ScrbKD plus PixKD cells. Error
bars represent mean SD. (C) Immunoblot
showing Scrib single KD and Scrib and PIX
double KD. (D) Rac pull-down assays with con-
trol and ScrbKD cells in both normal medium
(top) and low-calcium medium (bottom). (E)
Immunoblot analysis of phospho-ERK in control
and ScrbKD cells with and without stimulation
by 15 ng/ml HGF.
SCRIBBLE REGULATES ADHERENS JUNCTIONS • QIN ET AL.
1065
mediating the regulation of cell migration and adhesion, we
first confirmed that in MDCK cells we could detect this inter-
action (unpublished data) and then assessed the role of
PIX
by silencing expression of the canine protein in MDCK cells.
Of four pSUPER constructs tested, three efficiently sup-
pressed
PIX expression (Fig. 4 A). In particular, the PixKD1
shRNA reduced expression of the protein by
90%. However,
loss of
PIX had no detectable effect on cell migration as mea-
sured using the Boyden chamber assay (Fig. 4 B). Moreover, in
our hands, overexpression of
PIX did not increase cell migra-
tion in the filter assay (unpublished data). We then performed
double KD experiments in which the expression of both Scrib
and
PIX was suppressed (Fig. 4 C). We reasoned that one func-
tion of Scrib might be to sequester and inactivate
PIX. In this
case, loss of Scrib would release the
PIX, leading to inappropri-
ate activation of Rac and increased migration. If this hypothesis
were correct, a double KD would reverse the migration pheno-
type by removing the excess free
PIX from the cell. As depicted
in Fig. 3 (A and B), migration through filters was increased by
Scrib KD. However, the coordinate loss of
PIX did not signifi-
cantly perturb this effect (Fig. 4 B). Note that cotransfection of
the PixKD shRNA did not interfere with gene silencing of Scrib
(Fig. 4 C). We therefore conclude that Scrib function in cell
adhesion and migration is independent of
PIX binding.
Because
PIX is a guanine nucleotide exchange factor
for Rac, we also asked whether loss of Scrib would alter Rac
activity. Rac-GTP was detected by pull-down assays using a
GST fusion of the Rac binding domain of PAK. No consistent
differences in Rac-GTP were detected, however, in control
cells versus those lacking Scrib (Fig. 4 D). When the cells were
subjected to a calcium switch, Rac was activated within 2 h of
calcium addition in both the control and Scrib KD cells (Fig.
4 E). We therefore conclude that the polarity defects associated
with suppression of Scrib expression are independent of
PIX
and are not mediated through the Rac GTPase. Finally, we
asked whether Scrib might regulate the extracellular signal–
regulated kinase (ERK) signaling pathway, which is activated
by scatter factor (hepatocyte growth factor [HGF]; Tanimura et
al., 1998). HGF induces an EMT in which cells lose adhesive-
ness and become more migratory, a phenotype similar to that
observed in cells lacking SCRIB. However, no significant dif-
ferences in phospho-ERK were detected when Scrib expression
was knocked down either before or after addition of HGF (Fig.
4 E). These data suggest that Scrib does not function to regulate
the HGF signaling pathway.
Scrib is required for E-cadherin–mediated
adhesion
To determine whether cell–cell adhesion is compromised in the
absence of Scrib, we first used an aggregation assay. Cells were
trypsinized, triturated to break up clumps into individual cells,
resuspended in fresh medium in a hanging drop beneath the lid
of a tissue culture plate, and incubated for 18–20 h. Cell ag-
gregation was then assessed microscopically. A dramatic
loss of aggregation was apparent in cells expressing either
pS-ScrbKD1 or 2 vectors, as compared with the control cells
that were transfected with pS-Luc (Fig. 5, A and C). This effect
was not a result of differential loss of E-cadherin in the cell
suspensions as assessed by immunoblotting lysates from the
suspended cell cultures (Fig. 5 B). Importantly, coexpression
of human GFP-Scrib reversed the adhesion defect caused by the
loss of endogenous SCRIB, proving that the effect of the sh-
RNAs on adhesion is specifically mediated through destruction of
the Scrib mRNA rather than through off-target effects (Fig. 5, A
and C). We also tested for a possible role for
PIX on aggrega-
tion, using an shRNA directed against the canine gene (Fig. 4, A
and B). However, loss of
PIX from the cells had no effect on
Figure 5. Decreased adhesiveness of cells lacking Scrib. (A) 3 10
4
control and ScrbKD cells were seeded into hanging drop cultures and
allowed to aggregate overnight. After trituration by passing the cell cluster
10 times through a 200-l pipette tip, images were captured by phase-
contrast microscopy using a 10 objective. (B) E-cadherin is not preferen-
tially lost from the ScrbKD cells in suspension culture. (C) Quantification of
the degree of aggregation shown in A. Data are presented as the area of
the aggregated cells/number of individual nonaggregated cells and
represent means of 10–12 images from triplicates of each sample SD.
(D) Effect of PIX silencing on cell aggregation.
JCB • VOLUME 171 • NUMBER 6 • 20051066
the aggregation of control cells and did not reverse the loss of ag-
gregation observed in the absence of Scrib (Fig. 5 D).
To determine whether the aggregation defect is mediated
through E-cadherin or some other cell adhesion protein, we as-
sayed the ability of the MDCK cells to attach to a surface
coated with the extracellular domain of E-cadherin. Cells were
disassociated using an EGTA solution (with no trypsin), centri-
fuged and resuspended in fresh medium, and added to 96-well
plates coated with the ectodomain of E-cadherin. After 60 min,
the plates were washed and remaining attached cells were
counted. Results are shown in Fig. 6. Almost no cells attached
to the plates in the absence of the E-cadherin ectodomain,
demonstrating that during the 60-min incubation period inte-
grin-mediated attachment is negligible. Control cells attached
efficiently, and attachment was proportional to the amount of
E-cadherin ectodomain on the plate (Fig. 6 B). Importantly,
loss of Scrib caused a substantial drop (approximately threefold)
in cell attachment, demonstrating that E-cadherin homophilic ad-
hesion is compromised in the absence of Scrib. Addition of an
arginine–glycine–aspartic acid peptide to block integrin-mediated
adhesion had no significant effect (unpublished data).
Depletion of Scrib causes a defect in
cell–cell adhesive junctions
These data suggest that Scrib is required for normal E-cadherin
function at cell–cell junctions. We therefore examined the dis-
tribution of E-cadherin and of the Na/K-ATPase, which is a
marker for the basolateral membrane. In control cells, these
proteins colocalize along the lateral cell boundaries. Scrib KD
caused a distinctive phenotype in which the lateral membranes
of the cells became disorganized. The membranes appeared
less vertical and had convoluted edges (Fig. 7 A). A similar
phenotype was observed for
-catenin distribution (Fig. 7 B).
However, the total amounts of E-cadherin,
-catenin, and
-catenin expressed in cells depleted of Scrib were the same as
the amounts in control cells (Fig. 7 C). Scrib does not, there-
fore, regulate the expression of these junctional proteins. More-
over, when surface proteins were biotinylated, captured on
streptavidin beads, and blotted for E-cadherin, no reproducible
difference was observed between the control and Scrib KD
cells (Fig. 7 D). These data demonstrate that there is no change
in the amount of E-cadherin on the cell surface, and we con-
clude that Scrib is not involved in controlling the exocytosis or
endocytosis of E-cadherin.
When adherens junctions form, a fraction of the
- and
-catenin becomes stabilized at the cell cortex, either through
clustering of the E-cadherin or perhaps through attachment to
actin, and is detergent insoluble. We measured the detergent-
insoluble fraction in control and Scrib KD cells and found that
in the absence of Scrib the amounts of both
- and
-catenin in
this fraction were substantially reduced (Fig. 7, E and F).
Together, these results suggest that Scrib is required for the
normal stabilization of
- and
-catenin at the cell cortex.
Depletion of E-cadherin phenocopies the
effects of Scrib KD
If both the adhesion defect and the increased motility observed
in response to Scrib silencing are caused by decreased E-cad-
herin activity, one would predict that depletion of E-cadherin
would produce the same phenotype. We therefore expressed a
shRNA targeted against the canine E-cadherin in MDCK cells
and achieved a
50% reduction in E-cadherin expression (Fig.
8 A). Interestingly, cells depleted of E-cadherin migrated
through filters significantly faster than the control (Fig. 8 B).
Moreover, these cells were larger and more fibroblastic in appear-
ance than control cells when plated at low densities (Fig. 8 C),
Figure 6. Suppression of Scrib expression
reduces E-cadherin–mediated adhesion. (A) In
vitro E-cadherin binding assay. Different con-
centrations of recombinant E-cadherin extracel-
lular domain were coated on plates. Control
(Luc) and ScrbKD cells were collected in sus-
pension and allowed to adhere to the plates
for 60 min. Images were captured for non-
washed plates (to give total cell numbers), and
plates were subjected to washing (to deter-
mine attached cell numbers). (B) Quantification
of cell attachment to E-cadherin ectodomain.
Data represent means of 10–12 images from
triplicates of each condition SD.
SCRIBBLE REGULATES ADHERENS JUNCTIONS • QIN ET AL.
1067
just as observed for the Scrib KD cells. Based on these data, we
conclude that both the morphological changes and increased
motility in cells depleted of Scrib can be ascribed to a failure of
the E-cadherin to form normal trans-adhesive interactions.
An E-cadherin–
-catenin fusion protein
can reverse the effects of silencing Scrib
expression
To determine the locus of action of Scrib, we attempted to re-
verse the effects of Scrib depletion by the ectopic expression
either of a cadherin–GFP fusion (Ecad–GFP) or of a cadherin–
-catenin fusion protein (Ecad–
cat). This latter construct
lacks
-catenin binding sites but can connect to the actin cyto-
skeleton through the COOH-terminal domain of the
-catenin
and can promote homophilic adhesion (Nagafuchi et al., 1994;
Gottardi et al., 2001). The Ecad–GFP has been shown previ-
ously to be fully functional (Adams et al., 1998).
Both constructs were expressed only at very low levels
compared with the level of endogenous E-cadherin (Fig. 8 D).
Nonetheless, the Ecad–
cat fusion was partially able to reverse
the increase in migratory behavior of the cells depleted of Scrib
(Fig. 8 E). Importantly, however, a similar level of Ecad–GFP
was unable to reduce migration of these cells. Next, using an
aggregation assay, we asked whether the fusion proteins could
also reverse the adhesion defect in the Scrib KD cells. Again,
the Ecad–
cat provided a partial restoration of cell–cell adhe-
sion, whereas the Ecad–GFP fusion did not (Fig. 8, F and G).
The Ecad–
cat fusion did not appear to increase aggregation of
control cells, although a small effect would not have been de-
tectable in this assay. Therefore, the forced, constitutive link-
age of E-cadherin to
-catenin can restore normal adhesive and
migratory behavior on cells in which Scrib expression has been
reduced, suggesting that Scrib acts to modulate this linkage.
Discussion
Polarization is a fundamental aspect of metazoan development,
and a core set of proteins is required for the polarization of
cells in many different developmental contexts (Macara, 2004).
These proteins appear to execute conserved functions during
Figure 7. Loss of Scrib causes a defect in
adherens junction structure. (A) Control and
Scrib-depleted cells were plated at subconflu-
ence and allowed to form islands of cells. They
were then fixed and stained for E-cadherin
(red) and Na/K-ATPase (green). Image stacks
were collected using confocal microscopy
with 0.95-m z steps. (B) Control and ScrbKD
cells were fixed and stained for Scrib and
-catenin. (C) Immunoblot of junctional proteins
in control and ScrbKD cells. Whole cell lysates
were blotted for E-cadherin, - and -catenin,
and -tubulin. (D) Cells were treated with a non-
permeable biotin linker, sulfo-NHS-SS-biotin,
and biotinylated proteins were captured onto
streptavidin-agarose and detected by immuno-
blot. (E) Control and ScrbKD cells plated at
low density were lysed with buffer containing
0.5% Triton X-100. After centrifugation, super-
natants and pellets were resolved by SDS-
PAGE. Distributions of - and -catenin were
detected with immunoblot. 25% of the soluble
and 50% of the insoluble fractions are shown.
(F) Quantification by Odyssey image system.
Data are presented as the ratio of insoluble to
soluble fractions. Error bars represent the SD
from four independent experiments.
JCB • VOLUME 171 • NUMBER 6 • 20051068
polarization, but they also possess tissue- and organism-specific
functions. For example, the Par-3 polarity protein interacts with
Par-6 in worms, flies, and vertebrates, but its association with the
Rac exchange factor Tiam1 might be vertebrate specific (Chen
and Macara, 2005). In D. melanogaster, Scrib is a tumor sup-
pressor that is essential for apical/basal polarization of epithelial
cells and neuroblasts, but in mice it has been implicated in planar
polarity of the inner ear epithelium and has not so far been linked
to epithelial cell or neuroblast apical/basal differentiation or to
neoplastic transformation (Humbert et al., 2003; Bilder, 2004).
We have now found that mammalian Scrib is a key regu-
lator of E-cadherin adhesive activity in MDCK epithelial cells.
E-cadherin is an essential component of the adherens junction
and is required both for adhesive contacts between epithelial
cells and, in vertebrates, for the assembly of tight junctions
(Gumbiner, 2000, 2005). Initial interactions between E-cadherin
on adjacent cells form rapidly and are independent both of the
cytoplasmic domain of E-cadherin and of the actin cytoskele-
ton (Chu et al., 2004). Over time, however, the adhesive force
between cells increases as the cytoplasmic domain of E-cadherin
clusters and attaches to the actin cytoskeleton via - and -catenin
(Yap et al., 1998; Chu et al., 2004).
E-cadherin also possesses the characteristics of a tumor
suppressor. For example, it is down-regulated in many carcino-
mas, heterozygosity in the E-cadherin gene increases the risk
for diffuse gastric cancer, and mutations in E-cadherin are
present in many types of epithelial cancer (Cavallaro and
Christofori, 2004). In D. melanogaster, mutation of Scrib in the
context of Ras-transformed eye disc cells suppresses E-cadherin
expression, which induces invasion of the basement membrane
and metastasis (Brumby and Richardson, 2003; Pagliarini and
Xu, 2003). We found that KD of E-cadherin in MDCK cells
phenocopied the effects of Scrib KD on migration and adhe-
sion, confirming that Scrib acts on E-cadherin function and that
the changes in migratory behavior and cell–cell adhesion are
causally related to one another. However, unlike in D. melano-
Figure 8. Effects of E-cadherin depletion and
expression of an E-cadherin–-catenin fusion
protein. (A) Cells were transfected with an
shRNA targeted against canine E-cadherin.
Lysates were immunoblotted for E-cadherin
and Scrib. Equal protein concentrations were
loaded and normalized using anti-tubulin. (B)
Quantification of the motility of cells trans-
fected with Luc or EcadKD shRNAs using
Boyden chamber assay as described in Fig. 3.
(C) Morphology of cells depleted of E-cadherin.
Control and EcadKD cells were grown on six-
well plates at low density for 3 d. Images
were obtained by phase-contrast microscopy
using a 10 objective. (D) Expression of an
Ecad–cat and Ecad–GFP fusion in MDCK cells.
The fusion proteins and endogenous E-cadherin
were detected by immunoblot with anti–E-cad-
herin antibodies. (E) Effects of the Ecad–cat
and Ecad–GFP fusions on motility of cells de-
pleted of Scrib. Migration through filters was
quantified as in Fig. 3. (F) Aggregation assay.
3 10
4
cells were seeded into hanging drop
cultures and allowed to aggregate for over-
night. After trituration with a 200-l pipet tip,
images were captured by phase-contrast mi-
croscopy using a 10 objective. (G) Quanti-
fication of the aggregation assay. Data are
presented as the area of the aggregated
cells/number of individual nonaggregated
cells per field and represent means of 10–12
fields from triplicates of each sample SD.
SCRIBBLE REGULATES ADHERENS JUNCTIONS • QIN ET AL. 1069
gaster, reduction of Scrib levels in MDCK cells had no effect on
E-cadherin expression, and it did not alter either delivery to the
plasma membrane or endocytosis because the surface expression
of the protein was unchanged after Scrib depletion. But the
amounts of detergent-insoluble - and -catenin were increased,
suggesting that Scrib acts downstream of E-cadherin.
How does Scrib operate? We were unable to detect any
association of Scrib with E-cadherin, -catenin, or -catenin
by coimmunoprecipitations (unpublished data), suggesting that
the mechanism does not involve direct binding. Rac and Cdc42
are activated during the formation of cell–cell adhesions
through E-cadherin, and expression of dominant-interfering
Rac and Cdc42 mutants can block this formation (Chu et al.,
2004). Therefore, we initially assumed that Scrib might act by
promoting the activation of Rac through association with the
guanine nucleotide exchange factor PIX. However, suppres-
sion of Scrib expression did not detectably alter E-cadherin
trafficking, and its role in cell–cell adhesion and migration
appears to be independent of PIX expression. Moreover,
although Rac has been shown to be important in epithelial
cell–cell adhesion (Hordijk et al., 1997), Rac activity was not
altered by suppression of Scrib expression. These data there-
fore identify a new, PIX-independent function for Scrib in
mammalian epithelial cells.
To identify the step at which Scrib acts, we tested the ef-
fects of a fusion between E-cadherin and -catenin, which cannot
bind to -catenin. Remarkably, even very low amounts of this
construct could partially rescue aggregation and reduce migration
of Scrib KD cells, whereas expression of an Ecad–GFP fusion
had no effect. Therefore, we propose that the lesion in the Scrib
KD cells is confined to the coupling between the cadherin and
-catenin. The data also suggest that the coupling of E-cadherin
to -catenin is normally dynamic and that Scrib is required to sta-
bilize the linkage so as to permit adhesive junctions to form. The
covalent attachment of E-cadherin to -catenin would eliminate
the need for this stabilization, thus permitting adhesions to form
even when Scrib levels are reduced. If Scrib acted at another
point, for instance to stabilize the coupling of -catenin to the
actin cytoskeleton, one would not expect the expression of an
Ecad–cat fusion to reverse the effects of Scrib depletion. We
speculate that Scrib reduces the mobility of the catenins so as to
encourage the formation of connections to the actin cytoskeleton,
which in turn will reduce the lateral mobility of E-cadherin in the
plasma membrane and facilitate clustering at nascent junctions.
It is important to note that Scrib might possess other
functions in mammalian epithelial polarization that were not
revealed by partial silencing of its expression in MDCK cells.
For example, it is unclear at present whether the minor defect
in tight junction assembly would be exaggerated in a Scrib
knockout. However, we note that shRNA-mediated reduction
of ZO-1 expression by 80–90% in MDCK cells (unpublished
data) closely phenocopies a ZO-1 knockout, suggesting that in
some cases at least the principal biological functions of pro-
teins are uncovered even by incomplete gene silencing. Future
studies will focus on the nature of the link between Scrib and
the cadherin–catenin complex and on the mechanism by which
the dynamics of the complex regulate adhesiveness.
Materials and methods
Constructs
A partial cDNA to human Scrib was provided by J. Huibregtse (University
of Texas, Austin, TX). The 5 and 3 ends of the open reading frame were
obtained by PCR from human kidney cDNA and subcloned into the frag-
ment to recover full-length hScrb cDNA. GFP-hScrb was constructed by
cloning full-length human Scrb into the HindIII and EcoRI sites of the
pEGFPC1 (CLONTECH Laboratories, Inc.) vector. GFP–E-cadherin was a
gift from J. Nelson (Stanford University, Stanford, CA).
To generate shRNAs against the canine Scrib, partial sequences
were obtained by RT-PCR from MDCK II cells and screened for candidate
small interfering RNA primers using rational design criteria (Reynolds et
al., 2004). Target sequences ScrbKD1 and 2 gave efficient suppression of
Scrib expression. Sequences of the ScrbKD sense oligonucleotides are as
follows: ScrbKD1 (5-GATCCCCCAGATGGTCCTCAGCAAGTTTCAAGA-
GAACTTGCTGAGGACCATCTGTTTTTTGGAAA-3) and ScrbKD2 (5-
GATCCCCGAGGTGACACTGTGCAGCATTCAAGAGATGCTGCACAGT
GTCACCTCTTTTTTGGAAA-3). Partial canine PIX and E-cadherin se-
quences were obtained from the boxer genome project (GenBank, Na-
tional Center for Biotechnology Information, National Institutes of Health).
ShRNA sequences are as follows: PixKD1 (5-GATCCCCCGAGCTCT-
CCTTTACGAAATTCAAGAGATTTCGTAAAGGAGAGCTCGTTTTTTGGAAA-
3), PixKD2 (5-GATCCCCCACGCACAATGGCAAGACTTTCAAGA-
GAAGTCTTGCCATTGTGCGTGTTTTTTGGAAA-3), PixKD3 (5-GAT-
CCCCCATCCAGCAAGCATGCAGATTCAAGAGATCTGCATGCTTGCTG-
GATGTTTTTTGGAAA-3), and EcadKD (5-GATCCCCGTCTAACAG-
GGACAAAGAATTCAAGAGATTCTTTGTCCCTGTTAGACTTTTTGGAAA-3).
Sense and antisense oligonucleotides for shRNAs were annealed,
phosphorylated, and ligated into the BglII and HindIII sites of pSUPER.
As a negative control we used pS-Luc, which targets a sequence within
the luciferase gene that is not present in the canine genome (Chen and
Macara, 2005).
Cell culture, transfection, and calcium switch
Cell culture, transfection, and calcium switch of MDCK II cells were per-
formed as described previously (Chen and Macara, 2005). Cells (2 10
6
)
were transiently transfected in suspension by electroporation, using 2.5–
18 g DNA (Amaxa, Inc.). Transfection efficiency was generally 70%.
For calcium switch experiments, 3 10
4
MDCK II cells were plated into
8-well Lab-Tek II chambers (Nunc) with normal growth medium. After 40–
44 h, the medium was replaced with MEM lacking calcium and supple-
mented with 2% dialyzed calf serum. After 16–20 h, cells were switched
back to normal growth medium.
Immunological methods
For analysis of total cell extracts by immunoblot, cells were scraped di-
rectly into Laemmli sample buffer. After SDS-PAGE, proteins were trans-
ferred to nitrocellulose and detected by chemiluminescence (Kirkegaard
and Perry Laboratories) or, for quantification of the proteins, with the
Odyssey Infrared Imaging System (LI-COR Corp.). For immunoblots of the
soluble fraction, cells were washed with cold PBS and lysed in lysis buffer
(25 mM Hepes, pH 7.4, 150 mM NaCl, 5 mM MgCl
2
, 0.5 mM EDTA,
1% Triton X-100, 1 mM DTT, and 1 mM PMSF). After centrifugation (10
min at 14,000 rpm), supernatants were assayed for protein concentration
using Bradford reagent and then boiled in Laemmli sample buffer.
Antibodies used were as follows: anti-Scrib (1:150; Santa Cruz
Biotechnology, Inc.), anti–-catenin (1:3,000); anti-PIX (1:500), anti–
E-cadherin (1:3,000), anti-ERK (1:5,000), and anti–-catenin (1:2,000;
BD Biosciences); anti–-tubulin (1:5,000; Sigma-Aldrich); anti-Rac (1:500,
Upstate Biotechnology); anti-ERK and phospho-ERK antibodies (provided
by D. Lannigan, University of Virginia, Charlotteseville, VA); and 1 g/ml
anti-myc 9E10 and anti-HA 12CA5. HRP-conjugated goat anti–mouse,
mouse anti–goat, or goat anti–rabbit secondary antibodies were used at a
dilution of 1:5,000–1:10,000 (Jackson ImmunoResearch Laboratories).
For Odyssey detection, Alexa Fluor 680–conjugated goat anti–mouse,
mouse anti–goat (Invitrogen), or IRDye 800–conjugated goat anti–rabbit
(Rockland, Inc.) secondary antibodies were used. For immunofluores-
cence, cells were usually fixed in 4% paraformaldehyde, permeabilized
with 0.5% Triton X-100 in PBS, and blocked with 5% BSA in PBS for 1 h
before incubation with antibodies. For detection of Na/K-ATPase, cells
were fixed in methanol/acetone (1:1) at 20C for 10 min. Primary anti-
bodies were anti-Scrib (1:100) or anti–ZO-1 (1:500), anti-occludin
(1:500; Zymed Laboratories), anti–-catenin, anti–E-cadherin (1:500), and
JCB • VOLUME 171 • NUMBER 6 • 20051070
anti–Na/K-ATPase (1:250; Abcam). Anti-gp35 (1:300) was a gift from
G. Ojakian (State University of New York Downstate Medical Center,
Brooklyn, NY). Alexa Fluor–conjugated secondary antibodies (Invitrogen)
were used at a dilution of 1:1:500–1:1,000. Alexa 594–conjugated
phalloidin was used at a dilution of 1:50. Cells were mounted in Slow-
fade (Invitrogen).
Imaging
Epifluorescence images were collected using an inverted microscope
(T200; Nikon) with a 60 water-immersion lens (Plan Achromatic, NA
1.2) coupled to a charge-coupled device camera (Orca; Hamamatsu), con-
trolled by Openlab 4.0 software (Improvision). Images were collected at
12-bit depth, 1,024 1,280 pixels resolution, and converted to TIFF files.
Images were postprocessed in Photoshop 7.0 (Adobe) to increase the gray-
scale range and to reduce haze using an unsharp mask and were con-
verted to 8-bit depth. In some cases (Fig. 1 C), the black and white values
were inverted, and the contrast was further enhanced to emphasize cell
junctions. Movies were converted to QuickTime format. Confocal imaging
was performed using a microscope (LSM510; Carl Zeiss MicroImaging, Inc.)
with a 100 oil-immersion objective (Plan Achromatic, NA 1.3).
Triton X-100 solubility
The Triton X-100 solubility assay was performed as previously described
(Tsukamoto and Nigam, 1999; Palacios et al., 2002). After transfection,
1.2 10
5
cells were plated on 6-well plates. Cells were lysed after 3 d in
100 l CSK-A buffer containing 0.5% Triton X-100 for 15 min on ice. Cell
lysates were collected and centrifuged at 14,000 rpm for 10 min. Super-
natants and pellets were boiled with sample buffer, and equal volumes
were resolved by SDS-PAGE. Proteins were visualized by immunoblotting
and quantified with the Odyssey Infrared Imaging System.
Cell surface biotinylation
Cell surface biotinylation was performed as described previously (Le et
al., 1999). MDCK cells were grown on filters and incubated with 1.0
mg/ml sulfosuccinimidyl 2-(biotinamido) ethyl-dithioproprionate (sulfo-
NHS-SS-biotin) (Pierce Chemical Co.) on both sides of the filter for 1 h.
Cells were then washed with quenching reagent (50 mM NH
4
Cl in PBS
containing 1 mM MgCl
2
and 0.1 mM CaCl
2
) for 10 min, followed by fur-
ther washes in PBS. Cells were then scraped off the filters and lysed in
RIPA buffer, and cell lysates were incubated with streptavidin beads
(Pierce Chemical Co.) to collect biotinylated proteins. Biotinylated E-cadherin
was detected by immunoblot.
Rac activity assays
Assays were performed as described previously using a GST fusion of the
Rac binding domain of PAK1 to capture Rac-GTP (Ren et al., 1999; Chen
and Macara, 2005).
Aggregation assay
The hanging drop aggregation assay was performed essentially as de-
scribed previously (Thoreson et al., 2000). Cells were trypsinized in the
presence of EDTA, washed twice in PBS, and resuspended at 10
6
cells per
milliliter in normal growth medium. 3 10
4
cells were then suspended as
hanging drops from the lid of a 24-well culture dish and allowed to aggre-
gate overnight. The cells were subjected to shear force by passage 10
times through a 200-l filter pipet tip (Continental Laboratory). Cells were
then imaged using a 10 phase-contrast objective. For quantification, in
each field, the degree of aggregation was measured as the ratio of the
area of the aggregates to the number of individual nonaggregated cells
using Openlab software (Improvision).
E-cadherin binding assay
The E-cadherin binding assay was a modified version of one described pre-
viously (Yap et al., 1998). Wells in a 96-well ELISA high-binding plate
(Corning) were coated with 0–50 g/ml of E-cadherin extracellular do-
main–Fc fusion protein (provided by B. Gumbiner, University of Virginia,
Charlottesville, VA) in coating buffer (100 mM NaCl, 20 mM Hepes, and 1
mM CaCl
2
, pH 7.2) overnight at 4C. Wells were then blocked with 3% BSA
for 2 h, followed by three washes in HBSS (containing 1.2 mM Ca; Invitro-
gen). MDCK cells were dispersed using a cell disassociation solution (Sigma-
Aldrich) at 37C for 30 min and washed twice with normal medium. Cells
were then resuspended in HBSS with 1 mM additional Ca. About 10
5
cells
were added to wells in the presence of 0.2 mg/ml GRGDTP peptide (Sigma-
Aldrich) and allowed to incubate for 60 min. After gentle washing with
HBSS, cells bound to plates were imaged. The number of cells in un-
washed wells was counted, and data are presented as the percentage of
cells remaining in each washed well, compared with the unwashed control.
Boyden chamber cell migration and wound-healing assays
Modified Boyden chamber assays were performed essentially as de-
scribed previously (Sander et al., 1998). Approximately 10
5
cells in
DME with 10% serum were seeded in the upper compartment of cell cul-
ture–treated Transwell filters (6.5-mm diam and 8-m pores; Corning).
The lower compartment contained DME
with 10% serum. After 16–20 h
at 37C, nonmigrating cells in the top chamber were removed with a cot-
ton swab and cells that had migrated to the underside of the filter were
fixed with 4% paraformaldehyde and stained with 0.4% crystal violet.
For quantification, crystal violet was eluted with 10% acetic acid and the
absorbance at 595 nm of eluant was measured. To normalize for vari-
ability in cell numbers, an identical volume of cells was seeded into an-
other well, fixed, stained, and eluted, without the cells from the upper
well being removed.
For the wounding assay, confluent monolayers grown on Delta T
dishes (Fisher Scientific) in DME 10% serum 20 mM Hepes, pH 7.4,
were scraped with the tip of a microinjection pipette to form a linear
wound. After 4 h of recovery, wound closure was recorded using a phase-
contrast 20 objective lens at 5-min intervals for 16 h at 37C. Individual
cells were tracked over the course of the movie using Openlab software,
transposed to the same initial x,y coordinates (0,0), and displayed as
Rose plots. The mean square displacement, d
2
(t), was calculated for each
cell. Migration parameters were then estimated, assuming the cells mi-
grate as persistent random walkers: d
2
(t) 2S
2
P[t P(1 e
t/P
)], where
S is the cell speed and P is the directional persistence time. An Excel
macro for calculating the correlation functions was provided by R. Horwitz
(University of Virginia, Charlottesville, VA).
Online supplemental material
Fig. S1 shows confocal images of control and Scrib KD cells stained for
Scrib and for the apical marker gp135. Videos 1 and 2 show cell migration
in response to wounding of MDCK monolayers. Video 1 (control) shows the
migration of wild-type cells; Video 2 (ScrbKD) shows the migration of cells
depleted of Scrib by RNAi. Online supplemental material is available at
http://www.jcb.org/cgi/content/full/jcb.200506094/DC1.
We thank James Nelson for Ecad–GFP, Rick Horwitz for the cell migration
analysis macro, Deborah Lannigan for the ERK antibodies, George Ojakian
for anti-gp135, members of the Macara group for helpful suggestions, and
the anonymous reviewers for insightful comments. We also thank Kathleen
Schwartz, Xiao Chen, and Xuejun Chen from the Gumbiner Laboratory for in-
valuable help with the E-cadherin binding assay. We thank Anne Spang for
critical reading of the manuscript.
This work was supported by grants GM070902 and CA040042 from
the National Institutes of Health, Department of Health and Human Services.
Submitted: 16 June 2005
Accepted: 8 November 2005
References
Adams, C.L., Y.T. Chen, S.J. Smith, and W.J. Nelson. 1998. Mechanisms of
epithelial cell–cell adhesion and cell compaction revealed by high-res-
olution tracking of E-cadherin–green fluorescent protein. J. Cell Biol.
142:1105–1119.
Albertson, R., and C.Q. Doe. 2003. Dlg, Scrib and Lgl regulate neuroblast cell
size and mitotic spindle asymmetry. Nat. Cell Biol. 5:166–170.
Albertson, R., C. Chabu, A. Sheehan, and C.Q. Doe. 2004. Scribble protein do-
main mapping reveals a multistep localization mechanism and domains
necessary for establishing cortical polarity. J. Cell Sci. 117:6061–6070.
Audebert, S., C. Navarro, C. Nourry, S. Chasserot-Golaz, P. Lecine, Y. Bel-
laiche, J.L. Dupont, R.T. Premont, C. Sempere, J.M. Strub, et al. 2004.
Mammalian Scribble forms a tight complex with the betaPIX exchange
factor. Curr. Biol. 14:987–995.
Bilder, D. 2004. Epithelial polarity and proliferation control: links from the
Drosophila neoplastic tumor suppressors. Genes Dev. 18:1909–1925.
Bilder, D., M. Li, and N. Perrimon. 2000. Cooperative regulation of cell polarity
and growth by Drosophila tumor suppressors. Science. 289:113–116.
Bilder, D., M. Schober, and N. Perrimon. 2003. Integrated activity of PDZ pro-
tein complexes regulates epithelial polarity. Nat. Cell Biol. 5:53–58.
Brumby, A.M., and H.E. Richardson. 2003. scribble mutants cooperate with on-
cogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.
SCRIBBLE REGULATES ADHERENS JUNCTIONS • QIN ET AL. 1071
EMBO J. 22:5769–5779.
Cavallaro, U., and G. Christofori. 2004. Multitasking in tumor progression: signal-
ing functions of cell adhesion molecules. Ann. NY Acad. Sci. 1014:58–66.
Chen, X., and I.G. Macara. 2005. Par-3 controls tight junction assembly through
the Rac exchange factor Tiam1. Nat. Cell Biol. 7:262–269.
Chu, Y.S., W.A. Thomas, O. Eder, F. Pincet, E. Perez, J.P. Thiery, and S. Du-
four. 2004. Force measurements in E-cadherin–mediated cell doublets
reveal rapid adhesion strengthened by actin cytoskeleton remodeling
through Rac and Cdc42. J. Cell Biol. 167:1183–1194.
Ehrlich, J.S., M.D. Hansen, and W.J. Nelson. 2002. Spatio-temporal regulation
of Rac1 localization and lamellipodia dynamics during epithelial cell-
cell adhesion. Dev. Cell. 3:259–270.
Gottardi, C.J., E. Wong, and B.M. Gumbiner. 2001. E-cadherin suppresses cel-
lular transformation by inhibiting -catenin signaling in an adhesion-
independent manner. J. Cell Biol. 153:1049–1060.
Gumbiner, B.M. 2000. Regulation of cadherin adhesive activity. J. Cell Biol.
148:399–404.
Gumbiner, B.M. 2005. Regulation of cadherin-mediated adhesion in morpho-
genesis. Nat. Rev. Mol. Cell Biol. 6:622–634.
Hordijk, P.L., J.P. ten Klooster, R.A. van der Kammen, F. Michiels, L.C.
Oomen, and J.G. Collard. 1997. Inhibition of invasion of epithelial cells
by Tiam1-Rac signaling. Science. 278:1464–1466.
Humbert, P., S. Russell, and H. Richardson. 2003. Dlg, Scribble and Lgl in cell
polarity, cell proliferation and cancer. Bioessays. 25:542–553.
Jacob, L., M. Opper, B. Metzroth, B. Phannavong, and B.M. Mechler. 1987.
Structure of the l(2)gl gene of Drosophila and delimitation of its tumor
suppressor domain. Cell. 50:215–225.
Kemphues, K. 2000. PARsing embryonic polarity. Cell. 101:345–348.
Lahuna, O., M. Quellari, C. Achard, S. Nola, G. Meduri, C. Navarro, N. Vitale,
J.P. Borg, and M. Misrahi. 2005. Thyrotropin receptor trafficking relies
on the hScrib-betaPIX-GIT1-ARF6 pathway. EMBO J. 24:1364–1374.
Le, T.L., A.S. Yap, and J.L. Stow. 1999. Recycling of E-cadherin: a potential
mechanism for regulating cadherin dynamics. J. Cell Biol. 146:219–232.
Macara, I.G. 2004. Parsing the polarity code. Nat. Rev. Mol. Cell Biol. 5:220–231.
Metais, J.Y., C. Navarro, M.J. Santoni, S. Audebert, and J.P. Borg. 2005. hScrib
interacts with ZO-2 at the cell-cell junctions of epithelial cells. FEBS
Lett. 579:3725–3730.
Montcouquiol, M., R.A. Rachel, P.J. Lanford, N.G. Copeland, N.A. Jenkins,
and M.W. Kelley. 2003. Identification of Vangl2 and Scrb1 as planar po-
larity genes in mammals. Nature. 423:173–177.
Murdoch, J.N., D.J. Henderson, K. Doudney, C. Gaston-Massuet, H.M. Phillips,
C. Paternotte, R. Arkell, P. Stanier, and A.J. Copp. 2003. Disruption of
scribble (Scrb1) causes severe neural tube defects in the circletail mouse.
Hum. Mol. Genet. 12:87–98.
Nagafuchi, A., S. Ishihara, and S. Tsukita. 1994. The roles of catenins in the
cadherin-mediated cell adhesion: functional analysis of E-cadherin–
catenin fusion molecules. J. Cell Biol. 127:235–245.
Nakagawa, S., and J.M. Huibregtse. 2000. Human scribble (Vartul) is tar-
geted for ubiquitin-mediated degradation by the high-risk papillomavi-
rus E6 proteins and the E6AP ubiquitin-protein ligase. Mol. Cell. Biol.
20:8244–8253.
Nakagawa, S., T. Yano, K. Nakagawa, S. Takizawa, Y. Suzuki, T. Yasugi, J.M.
Huibregtse, and Y. Taketani. 2004. Analysis of the expression and local-
isation of a LAP protein, human scribble, in the normal and neoplastic
epithelium of uterine cervix. Br. J. Cancer. 90:194–199.
Navarro, C., S. Nola, S. Audebert, M.J. Santoni, J.P. Arsanto, C. Ginestier, S.
Marchetto, J. Jacquemier, D. Isnardon, A. Le Bivic, et al. 2005. Junctional
recruitment of mammalian Scribble relies on E-cadherin engagement.
Oncogene. 24:4330–4339.
Nelson, W.J. 2003. Adaptation of core mechanisms to generate cell polarity.
Nature. 422:766–774.
Pagliarini, R.A., and T. Xu. 2003. A genetic screen in Drosophila for metastatic
behavior. Science. 302:1227–1231.
Palacios, F., J.K. Schweitzer, R.L. Boshans, and C. D’Souza-Schorey. 2002.
ARF6-GTP recruits Nm23-H1 to facilitate dynamin-mediated endocyto-
sis during adherens junctions disassembly. Nat. Cell Biol. 4:929–936.
Peng, C.Y., L. Manning, R. Albertson, and C.Q. Doe. 2000. The tumour-sup-
pressor genes lgl and dlg regulate basal protein targeting in Drosophila
neuroblasts. Nature. 408:596–600.
Petit, M.M., S.M. Meulemans, P. Alen, T.A. Ayoubi, E. Jansen, and W.J. Van de
Ven. 2005. The tumor suppressor Scrib interacts with the zyxin-related
protein LPP, which shuttles between cell adhesion sites and the nucleus.
BMC Cell Biol. 6:1.
Ren, X.D., W.B. Kiosses, and M.A. Schwartz. 1999. Regulation of the small
GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J.
18:578–585.
Reynolds, A., D. Leake, Q. Boese, S. Scaringe, W.S. Marshall, and A. Kh-
vorova. 2004. Rational siRNA design for RNA interference. Nat. Bio-
technol. 22:326–330.
Sander, E.E., S. van Delft, J.P. ten Klooster, T. Reid, R.A. van der Kammen,
F. Michiels, and J.G. Collard. 1998. Matrix-dependent Tiam1/Rac sig-
naling in epithelial cells promotes either cell–cell adhesion or cell mi-
gration and is regulated by phosphatidylinositol 3-kinase. J. Cell Biol.
143:1385–1398.
Schock, F., and N. Perrimon. 2002. Molecular mechanisms of epithelial mor-
phogenesis. Annu. Rev. Cell Dev. Biol. 18:463–493.
Tanentzapf, G., and U. Tepass. 2003. Interactions between the crumbs, lethal gi-
ant larvae and bazooka pathways in epithelial polarization. Nat. Cell
Biol. 5:46–52.
Tanimura, S., Y. Chatani, R. Hoshino, M. Sato, S. Watanabe, T. Kataoka, T.
Nakamura, and M. Kohno. 1998. Activation of the 41/43 kDa mitogen-
activated protein kinase signaling pathway is required for hepatocyte
growth factor-induced cell scattering. Oncogene. 17:57–65.
Tepass, U., G. Tanentzapf, R. Ward, and R. Fehon. 2001. Epithelial cell polarity
and cell junctions in Drosophila. Annu. Rev. Genet. 35:747–784.
Thiery, J.P. 2003. Epithelial-mesenchymal transitions in development and pa-
thologies. Curr. Opin. Cell Biol. 15:740–746.
Thoreson, M.A., P.Z. Anastasiadis, J.M. Daniel, R.C. Ireton, M.J. Wheelock,
K.R. Johnson, D.K. Hummingbird, and A.B. Reynolds. 2000. Selective
uncoupling of p120
ctn
from E-cadherin disrupts strong adhesion. J. Cell
Biol. 148:189–202.
Tsukamoto, T., and S.K. Nigam. 1999. Cell-cell dissociation upon epithelial cell
scattering requires a step mediated by the proteasome. J. Biol. Chem.
274:24579–24584.
Van Aelst, L., and M. Symons. 2002. Role of Rho family GTPases in epithelial
morphogenesis. Genes Dev. 16:1032–1054.
Woods, D.F., and P.J. Bryant. 1991. The discs-large tumor suppressor gene of
Drosophila encodes a guanylate kinase homolog localized at septate
junctions. Cell. 66:451–464.
Yap, A.S., C.M. Niessen, and B.M. Gumbiner. 1998. The juxtamembrane re-
gion of the cadherin cytoplasmic tail supports lateral clustering, adhesive
strengthening, and interaction with p120
ctn
. J. Cell Biol. 141:779–789.
Zegers, M.M., L.E. O’Brien, W. Yu, A. Datta, and K.E. Mostov. 2003. Epithe-
lial polarity and tubulogenesis in vitro. Trends Cell Biol. 13:169–176.
Zeitler, J., C.P. Hsu, H. Dionne, and D. Bilder. 2004. Domains controlling cell
polarity and proliferation in the Drosophila tumor suppressor Scribble.
J. Cell Biol. 167:1137–1146.
    • "In epithelial cells planar polarity is maintained by proteins that are encoded by tumor suppressor genes such as SCRIB (). Scribble, the protein product of SCRIB, is crucial for the proper maintenance of epithelial cell integrity and function (Zhan et al., 2008); it is required for E-cadherin-mediated cell-cell adhesion and, when its expression is down-regulated, epithelial cells acquire mesenchymal appearance and their migration is augmented (Qin et al., 2005 ). In epithelial cells the orientation of the mitotic spindle is restricted to the plane of the epithelium to ensure that daughter cells will remain within the layer. "
    [Show abstract] [Hide abstract] ABSTRACT: SCRIB is a polarity regulator known to be abnormally expressed in cancer at the protein level. Here we report that, in breast cancer, an additional and hidden dimension of deregulations exists: an unexpected SCRIB exon usage pattern appears to mark a more malignant tumor phenotype and significantly correlates with survival. Conserved exons encoding the leucine-rich repeats tend to be overexpressed while others are underused. Mechanistic studies revealed that the underused exons encode part of the protein necessary for interaction with Vimentin and Numa1, a protein which is required for proper positioning of the mitotic spindle. Thus, the inclusion/exclusion of specific SCRIB exons is a mechanistic hallmark of breast cancer, which could potentially be exploited to develop more efficient diagnostics and therapies.
    Full-text · Article · May 2016
    • "The Scribble complex defines the basolateral membrane. This depends on prior formation of a nascent AJ by E-cadherin [77]. In turn, Scribble actively excludes Crumbs and Par6 from basal membranes [78]. "
    [Show abstract] [Hide abstract] ABSTRACT: The transition of sessile epithelial cells to a migratory, mesenchymal phenotype is essential for metazoan development and tissue repair, but this program is exploited by tumor cells in order to escape the confines of the primary organ site, evade immunosurveillance, and resist chemo-radiation. In addition, epithelial-to-mesenchymal transition (EMT) confers stem-like properties that increase efficiency of colonization of distant organs. This review evaluates the role of cell-cell junctions in suppressing EMT and maintaining a quiescent epithelium. We discuss the conflicting data on junctional signaling in cancer and recent developments that resolve some of these conflicts. We focus on evidence from breast cancer, but include other organ sites where appropriate. Current and potential strategies for inhibition of EMT are discussed.
    Full-text · Article · Feb 2016
    • "Another EMT promoting transcription factor ZEB1 represses Crumbs, PATJ and Lgl along with several TJ and AJ proteins by directly binding their promoter regions [55]. The polarity protein Scribble can also affect expression of epithelial proteins, as the loss of E-cadherin during EMT could be induced by Scribble knockdown [43]. Other studies link the polarity proteins with the TGFβ pathway, which can impair the function of polarity proteins both at the transcriptional and non-transcriptional level. "
    [Show abstract] [Hide abstract] ABSTRACT: Apico-basal polarity is typical of cells present in differentiated epithelium while front-rear polarity develops in motile cells. In cancer development, the transition from epithelial to migratory polarity may be seen as the hallmark of cancer progression to an invasive and metastatic disease. Despite the morphological and functional dissimilarity, both epithelial and migratory polarity are controlled by a common set of polarity complexes Par, Scribble and Crumbs, phosphoinositides, and small Rho GTPases Rac, Rho and Cdc42. In epithelial tissues, their mutual interplay ensures apico-basal and planar cell polarity. Accordingly, altered functions of these polarity determinants lead to disrupted cell-cell adhesions, cytoskeleton rearrangements and overall loss of epithelial homeostasis. Polarity proteins are further engaged in diverse interactions that promote the establishment of front-rear polarity, and they help cancer cells to adopt different invasion modes. Invading cancer cells can employ either the collective, mesenchymal or amoeboid invasion modes or actively switch between them and gain intermediate phenotypes. Elucidation of the role of polarity proteins during these invasion modes and the associated transitions is a necessary step towards understanding the complex problem of metastasis. In this review we summarize the current knowledge of the role of cell polarity signaling in the plasticity of cancer cell invasiveness.
    Full-text · Article · Feb 2016
Show more