Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation but Does Not Alter Cell Survival following DNA Damage

Article (PDF Available)inMolecular and Cellular Biology 26(1):28-38 · February 2006with28 Reads
DOI: 10.1128/MCB.26.1.28-38.2006 · Source: PubMed
Abstract
Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells.
MOLECULAR AND CELLULAR BIOLOGY, Jan. 2006, p. 28–38 Vol. 26, No. 1
0270-7306/06/$08.000 doi:10.1128/MCB.26.1.28–38.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation
but Does Not Alter Cell Survival following DNA Damage
Jonathan M. Solomon, Rao Pasupuleti, Lei Xu, Thomas McDonagh, Rory Curtis,
Peter S. DiStefano, and L. Julie Huber*
Elixir Pharmaceuticals, Inc., One Kendall Square, Cambridge, Massachusetts 02139
Received 16 May 2005/Returned for modification 5 July 2005/Accepted 3 October 2005
Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to
modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527,
a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1
in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased
acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial
cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell
growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also
increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted
synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and
HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had
no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this
does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary
epithelial cells.
SIRT1 is an enzyme that catalyzes the deacetylation of
acetyl-lysine residues by a mechanism in which NAD
is
cleaved and a unique product, O-acetyl ADP-ribose, is gener-
ated (4, 19, 21). In addition, the reaction results in the release
of nicotinamide, which acts as an end product inhibitor (3).
SIRT1 is distinct from the class I and II histone deacetylase
(HDAC) enzymes that remove acetyl groups without hydroly-
sis of NAD
(13). Indeed, SIRT1 catalytic activity is not af-
fected by the class I and II HDAC inhibitor trichostatin A
(TSA) (19).
SIRT1 plays a role in a wide variety of processes including
stress resistance, metabolism, differentiation, and aging (4).
Overexpression of SIRT1 orthologs in Saccharomyces cerevi-
siae,Caenorhabditis elegans, and Drosophila melanogaster leads
to an increased life span of these organisms (23, 43, 49), and
this has excited speculation that SIRT1 might also regulate life
span in mammals (5). SIRT1 binds to and regulates the activity
of several transcription factors, including FOXO1, FOXO3a,
and FOXO4 (8, 16, 37, 38, 51), HES-1 and HEY-2 (48), MyoD
(15), CTIP2 (46), PPAR(40), NF-B (55), and PGC1(42).
SIRT1 has also been shown to interact with and deacetylate
the p53 tumor suppressor protein (25, 30, 53). p53 is a key
transcriptional regulator of genes involved in cell cycle pro-
gression, apoptosis, and DNA repair. Indeed, many human
tumors have inactivated p53 protein (54). p53 becomes acety-
lated after DNA damage, and the acetylated form has been
reported to have increased transcriptional activity, promote
coactivator recruitment, and enhance site-specific DNA bind-
ing (2). Acetylation of p53 is also believed to increase p53
stability by preventing ubiquitination of key lysine residues and
subsequent proteasomal degradation (27).
Compounds that activate p53 function have been success-
fully used to treat tumors in vivo (9, 20, 52). Therefore, small-
molecule inhibitors of SIRT1 might function as anticancer
agents if SIRT1 acts as an inhibitor of p53. This hypothesis is
supported by studies in cell lines in which overexpression of a
catalytically impaired variant of SIRT1 decreased survival and
increased p53 target gene expression after DNA damage (53).
Overexpression of wild-type SIRT1 had the opposite effect of
increasing cell survival after DNA damage (30). Moreover,
thymocytes derived from mice lacking Sir2(mouse SIRT1)
exhibit increased sensitivity to -radiation although, interest-
ingly, embryonic stem cells and fibroblasts from these mice
showed no altered resistance to DNA damage-induced stress
(10, 33).
In this study, the role of SIRT1 on p53 acetylation and
function is examined using a novel, potent, and specific small-
molecule inhibitor of SIRT1 catalytic activity, designated EX-
527. In cells subjected to DNA damage, inhibition of SIRT1
with EX-527 results in increased p53 acetylation but surpris-
ingly does not result in detectable effects on p53-controled
gene expression, cell survival, or cell proliferation. In contrast,
inhibition of class I/II HDAC-mediated p53 deacetylation with
TSA increases p53 acetylation after DNA damage, with re-
duced cell survival and growth. Although p53 acetylation is
synergistically increased by inhibition of both HDAC and
SIRT1, concomitant treatment with EX-527 and TSA does not
further affect cell proliferation or survival after DNA damage.
MATERIALS AND METHODS
Materials and cell culture. Etoposide was obtained from Calbiochem. TSA,
nicotinamide, adriamycin, hydroxyurea, hydrogen peroxide, and other reagent
quality chemicals were from Sigma. Tissue culture plastics were obtained from
* Corresponding author. Mailing address: Elixir Pharmaceuticals,
Inc., One Kendall Square, Cambridge, MA 02139. Phone: (617) 995-
7007. Fax: (617) 995-7050. E-mail: jhuber@elixirpharm.com.
28
Corning except where noted. NCI-H460, MCF-7, IMR-90, 293T, and U-2 OS
cells were obtained from the American Type Tissue Collection. NCI-H460 cells
were cultured in RPMI 1640 medium with 10 mM HEPES, 1 mM sodium
pyruvate, and 10% fetal bovine serum (FBS). MCF-7, IMR-90, and 293T cells
were grown in Dulbecco’s modified Eagle’s medium supplemented with 10%
FBS. U-2 OS cells were cultured in McCoy’s 5a medium with 1.5 mM L-glu-
tamine and 10% FBS. Primary human mammary epithelial cells (HMEC, derived
from normal adult mammary glands) and complete serum-free medium were
obtained from Cell Applications, Inc. HMEC were passaged no more than three
times before use in experiments.
Deacetylation assays and inhibitory compounds. Deacetylation was measured
using the Fluor de Lys kit (AK-555; Biomol) using a fluorogenic peptide encom-
passing residues 379 to 382 of p53, acetylated on lysine 382 (KI-177; Biomol).
The acetylated lysine residue was coupled to an aminomethylcoumarin moiety.
The peptide was deacetylated by SIRT1, followed by the addition of a proteolytic
developer that released the fluorescent aminomethylcoumarin. Briefly, enzyme
preparations were incubated with 170 M NAD
and 100 M p53 fluorogenic
peptide for 45 min at 37°C followed by incubation in developer for 15 min at
37°C. Fluorescence was measured by excitation at 360 nm and emission at 460
nm and enzymatic activity was expressed in relative fluorescence units.
Human SIRT5 (N-terminal glutathione S-transferase [GST] tag) was ex-
pressed in Escherichia coli and purified by affinity chromatography with gluta-
thione-Sepharose (G.E. Healthcare). Deacetylation of p53 lysine 382 was mea-
sured using the Fluor de Lys kit (as described above). SIRT5 activity was also
measured by the deacetylation of cytochrome c, prepared by chemical acetylation
with [
3
H]acetate. First, 1 mg cytochrome c(Sigma) was acetylated for2hatroom
temperature in 140 l of 100 mM morpholineethanesulfonic acid (MES), pH 5.0,
with 250 Ci [
3
H]acetate (ICN) and 2.2 mg/ml 1-ethyl-3-[3-dimethylaminopro-
pyl]carbodiimide hydrochloride (Pierce). Unincorporated [
3
H]acetate was re-
moved on a G-50 microspin column (G.E. Healthcare). The labeled protein was
precipitated with 20% trichloroacetic acid for 20 min on ice, washed three times
with ice-cold acetone, air dried, and resuspended at 1 mg/ml in distilled water.
The deacetylation reaction was performed as described previously (45) using 10
g SIRT5.
EX-527 (see Fig. 1A) and additional SIRT1-inhibitory compounds (EX-519,
EX-586, EX-589, EX-622, and EX-635) were identified in a high-throughput
screen using the Fluor de Lys assay (J. Hixon, T. McDonagh, R. Curtis, P. S.
DiStefano, A. Napper, T. Hesterkamp, R. Thomas, K. Keavey, and J. Pons, Soc.
Biomol. Screen. 10th Annu. Meet., poster P10045, 2004). EX-527 was found to
be 200- to 500-fold more selective for SIRT1 than SIRT2 and SIRT3. EX-527 is
a racemic mixture, and its optical isomers were separated by chiral high-perfor-
mance liquid chromatography and designated EX-242 and EX-243. When tested
in the deacetylation assay, EX-243 was active in SIRT1 inhibition, whereas
EX-242 was inactive. The details of the synthesis and separation of EX-527 are
described elsewhere (37a). Compounds were stored at 20°C in dimethyl sul-
foxide and were retested in the deacetylation assay prior to use in cell-based
assays.
Inhibition of GST-SIRT1 deacetylase activity. 293T cells were transiently
transfected with GST-tagged human SIRT1 in the pDEST27 Gateway vector
(Invitrogen) using FuGENE-6 (Roche). After 48 h, the cells were lysed with 50
mM Tris, pH 8.0, 120 mM NaCl, 1 mM EDTA, and 0.5% Nonidet P-40, sup-
plemented with Complete Mini protease inhibitor cocktail tablets (Roche). GST-
SIRT1 was purified from lysates using glutathione-Sepharose beads (G.E.
Healthcare) and washed extensively in the above buffer. The deacetylation assay
was performed with approximately 30 ng of GST-SIRT1 in the presence of
EX-527 (48 pM to 100 M).
Yeast Sir2 silencing assay. The effect of compounds on Sir2-dependent silenc-
ing was assessed by measuring the growth of a yeast strain harboring a telomere-
proximal URA3 gene in the presence or absence of 5-fluoroorotic acid (5-FOA)
(17). Strain SL8c was constructed by mating PSY316AUTa to W303ARUT
(35). Cells were grown overnight in SD medium (2% glucose, 0.67% yeast
nitrogen base, 0.39% Casamino Acids, 0.005% adenine, 0.005% tryptophan).
The culture was split 1:20 into fresh yeast extract-peptone-dextrose medium
containing 2% glucose and grown for 5 h. Cells were plated in 96-well plates
(Costar) in 150 l of SD containing 0.005% uracil either with or without 0.1%
5-FOA, containing 5 to 100 M EX-242 or EX-243. Plates were cultured at 30°C
for 18 to 24 h, and growth of resuspended cells was measured by light scattering
at 600 nm in a spectrophotometer.
Determination of acetylated p53 levels. NCI-H460 cells, MCF-7 cells, U-2 OS
cells, or HMEC (1 to 2 million) were plated in six-well tissue culture plates or
10-cm dishes. After 1 day (NCI-H460, MCF-7, and U-2 OS cells) or 2 days
(HMEC), p53 acetylation was induced for 6 h with one of the following DNA
damaging agents: etoposide (20 M), hydrogen peroxide (400 M), hydroxyurea
(1 mM), or adriamycin (0.2 g/ml for NCI-H460, MCF-7, and U-2 OS cells; 0.8
g/ml for HMEC). To determine the effects of deacetylase inhibitors on p53
acetylation levels, cells were treated with 6.25 to 400 nM TSA and/or 1 M
EX-527. In some experiments, other SIRT1 inhibitors, EX-635, EX-622, EX-519,
EX-586, and EX-589, or the optical isomers, EX-242 and EX-243, were used at
1M instead of EX-527. After washing with phosphate-buffered saline, cells
were lysed in 50 mM Tris, pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1%
Triton X-100, 0.2% Sarkosyl, 1 mM dithiothreitol, and 10% glycerol containing
Complete Mini protease inhibitor cocktail tablets and supplemented with 10 M
TSA and 5 mM nicotinamide to prevent deacetylation after cell lysis.
Immunoprecipitation of total p53 was performed with agarose-conjugated p53
monoclonal antibody (Ab-6; Oncogene Research Products) for2hat4°C, fol-
lowed by incubation with protein A-Sepharose (Pharmacia) for1hat4°C. Beads
were washed extensively with lysis buffer. Cell lysates or immunoprecipitates
were resolved on 10% Criterion Tris-HCl gels (Bio-Rad). p53 acetylation was
detected with anti-acetylated-Lys382 p53 antibody (Cell Signaling Technology),
and total p53 levels were determined with antibodies Ab-6 or Ab-7 (Oncogene
Research Products). Bound antibodies were visualized with horseradish peroxi-
dase-conjugated secondary antibody and SuperSignal West Femto maximum
sensitivity substrate (Pierce). Luminescence was quantified by a Bioimaging
system (UVP).
SIRT1 immunoblotting. SIRT1 in cell lysates was visualized by immunoblot-
ting using antibody 07-131 (Upstate Cell Signaling Solutions). Gels, secondary
antibodies, and horseradish peroxidase substrate were used as described above.
Cell viability and proliferation assays. NCI-H460 cells, MCF-7 cells, U-2 OS
cells, or HMEC were plated at 2,000 cells per well in opaque-walled 96-well
plates (Corning) for the viability assay and 800 cells per well in 96-well Cy-
tostar-T scintillating microplates (Amersham) for the proliferation assay. Cells
were incubated for 1 day (NCI-H460) or 2 days (MCF-7, U-2 OS, and HMEC)
prior to exposure to DNA-damaging agents and deacetylase inhibitors. All ex-
periments were performed in triplicate.
For viability assays, cells were treated with the indicated compounds for 48 h.
Cell viability was then determined using the Cell Titer-Glo luminescent assay
(Promega), which measures total ATP levels as an index of cell number. Lumi-
nescence was measured on a Luminoskan Ascent (ThermoLabSystems).
For the proliferation assay, 0.5 Ci/ml of [
14
C]thymidine was added to the
medium immediately after the genotoxins and deacetylase inhibitors. Plates were
counted at 48 h (HMEC) or 72 h (NCI-H460, MCF-7, and U-2 OS cells) in a
Microbeta liquid scintillation counter (Perkin-Elmer). Thymidine incorporated
by the cells was detected by proximity to the scintillant in the base of the
Cytostar-T tissue culture plate. Values were graphed as means standard
deviations.
Effects on p53-controlled gene expression. NCI-H460 cells, MCF-7 cells, U-2
OS cells, or HMEC (0.5 to 2 million) were plated in 10-cm tissue culture plates.
After 1 to 2 days, cells were treated with various concentrations of etoposide (0
to 100 M) in the presence or absence of 1 M EX-527 for 6 h. RNA was
isolated from cells using the RNAqueous 4-PCR kit (Ambion). cDNA was
generated using the First-Strand cDNA synthesis kit (Roche). Quantitative PCR
was performed to determine mRNA levels using Lightcycler (Roche) and the
following primers: p21 forward, GCGACTGTGATGCGCTAATGG; p21 re-
verse, GCGTTTGGAGTGGTAGAAATCTG; BAX forward, GCGAGTGTC
TCAAGCGC; BAX reverse, GCACCAGTTTGCTGGCA; hypoxanthine phos-
phoribosyltransferase forward, TAGCCCTCTGTGTGCT; hypoxanthine phospho-
ribosyltransferase reverse, CTTCGTGGGGTCCTTT.
To detect p21 protein, NCI-H460 cells were treated with adriamycin (0.2
g/ml) or etoposide (20 M) in the presence or absence of 1 M EX-527 for 6 h
and then lysed in 50 mM Tris buffer, pH 8.0, 120 mM NaCl, 1 mM EDTA, and
0.5% Nonidet P-40, supplemented with Complete Mini protease inhibitor cock-
tail tablets. The samples were resolved on Criterion 10% Tris-HCl gels, and blots
were probed with anti-p21 antibody F-5 (Santa Cruz Biotechnology) at a 1:1,000
dilution. Tubulin was visualized with antibody B-5-1-2 (Sigma) at a 1:5,000
dilution as a protein loading control. Secondary antibodies and horseradish
peroxidase substrate were used as described above.
SIRT1 overexpression. Constructs that express either SIRT1 or green fluores-
cent protein (GFP) were made using the pLP-LNCX vector (Clontech). The
constructs were packaged into virus by cotransfecting them using FuGENE 6 into
293T cells (500,000 cells per 60-mm dish) with the pVPack-VSV-G and
pVPack-GP vectors (Stratagene). After 24 h, virus was collected from the su-
pernatant and filtered through a 0.45-m filter, and Polybrene (Sigma) was
added to a final concentration of 8 g/ml. IMR-90 and MCF-7 cells cultured in
six-well plates were infected with virus-containing medium for 24 h, after which
the medium was replaced with fresh medium containing G418. Following selec-
tion, cells were plated in 96-well plates at 5,000 cells per well and treated with 200
VOL. 26, 2006 INHIBITION OF SIRT1 DOES NOT ALTER CELL SURVIVAL 29
to 1,600 M hydrogen peroxide for 24 h, and the cell viability was determined
using the Cell Titer-Glo kit (Promega) as described above.
RESULTS
Characterization of a potent inhibitor of SIRT1. EX-527
(Fig. 1A) is an inhibitor of SIRT1 enzymatic activity (50%
inhibitory concentration [IC
50
], 98 nM), identified in a high-
throughput screen using bacterially expressed human SIRT1
(37a). To confirm the activity of EX-527 against SIRT1 pro-
duced in mammalian cells, the potency of EX-527 was deter-
mined using the in vitro Fluor de Lys deacetylation assay. The
activity of GST-tagged human SIRT1, purified from 293T cells,
was measured in the presence of EX-527 (48 pM to 100 M).
As shown in Fig. 1B, EX-527 inhibited SIRT1 in a concentra-
tion-dependent manner with an IC
50
of 38 nM, in agreement
with the activity on bacterially expressed SIRT1.
EX-527 has much lower potency against SIRT2 (IC
50
, 19.6
M) or SIRT3 (IC
50
, 48.7 M) but does not inhibit class I/II
HDAC activity at concentrations up to 100 M (37a). We and
others (39) have found that SIRT5 possesses low, albeit signif-
icant, deacetylase activity, and we sought to determine if this
can be inhibited by EX-527. SIRT5 had no effect on deacety-
lation of p53 lysine 382 peptide in the Fluor de Lys assay (data
not shown). Therefore, the release of [
3
H]acetate from chem-
ically acetylated cytochrome cwas measured. SIRT5-mediated
deacetylation of cytochrome cwas not inhibited by EX-527 at
concentrations up to 50 M (data not shown). No deacetylase
activity was detected for SIRT4, SIRT6, and SIRT7. Thus,
EX-527 is selective for SIRT1 compared to other SIRT family
members and class I/II HDAC enzymes.
To confirm that EX-527 acts on NAD-dependent deacety-
lase enzymes, the compound was tested in the well-character-
ized Sir2-dependent silencing assay in yeast. SIRT1 is the clos-
est human ortholog of the yeast silent information regulator-2
protein, Sir2 (12). Sir2 regulates transcriptional silencing at the
DNA near telomeres, the silent mating type locus, and in the
region encoding rRNA by deacetylating lysines on histone tails
(36). Inhibition of yeast Sir2 activity by the pure optical iso-
mers of EX-527 was determined (Fig. 1C). The optical isomers
are EX-243, which inhibits SIRT1 catalytic activity, and EX-
242, which does not. The inactive isomer serves as a control for
cellular effects of the compound that are unrelated to the
inhibition of catalytic activity. Sir2 activity was assayed by an-
alyzing the silencing of a URA3 gene inserted near a telomere
(17). 5-FOA in the medium blocks the growth of yeast only
when the URA3 gene is expressed. Sir2 activity silences the
URA3 gene near the telomere, and the cells grow normally in
the presence of 5-FOA. However, if Sir2-dependent silencing
is inhibited, the URA3 gene is expressed and growth in the
presence of 5-FOA is reduced. As expected, in the absence of
5-FOA, neither enantiomer had any growth inhibitory effect,
indicating that EX-243 and EX-242 are not toxic at the con-
centrations tested (Fig. 1C). In the presence of 5-FOA, the
active enantiomer EX-243 inhibited growth, whereas EX-242
had no effect, indicating that Sir2 silencing of URA3 is reduced
(Fig. 1C). EX-527 gave results similar to those of EX-243 (data
not shown). These results demonstrate that EX-527 can inhibit
NAD-dependent deacetylation in a cellular environment.
Inhibition of SIRT1 enhances p53 acetylation in response to
DNA damaging agents. Previous studies have shown that the
acetylation of lysine 382 of p53 is modulated by SIRT1 (25, 30,
53). To determine if inhibition of SIRT1 resulted in an in-
crease in p53 acetylation, NCI-H460 cells were treated with
FIG. 1. EX-527 is a potent inhibitor of SIRT1 that also inhibits
Sir2-dependent silencing in yeast. (A) Structure of EX-527. (B) EX-
527 inhibits deacetylase activity of purified human SIRT1. Deacetylase
activity of GST-SIRT1 in the presence of increasing concentrations of
EX-527 was measured by the Fluor de Lys assay. Samples were assayed
in triplicate and analyzed using Prism (Graphpad Software, Inc.).
(C) The active optical isomer of EX-527, EX-243, and not the inactive
optical isomer, EX-242, inhibits Sir2-dependent silencing in yeast. A
yeast strain constructed with a URA3 gene inserted near a telomere
was grown in the presence of compounds with or without 5-FOA.
Growth was measured by light scattering at 600 nm.
30 SOLOMON ET AL. MOL.CELL.BIOL.
EX-527. NCI-H460 cells were chosen because they have pre-
viously been shown to express abundant SIRT1 protein, as well
as wild-type p53, and they have an intact p53 response to DNA
damage (24, 30). EX-527 (1 M) had no detectable effect on
the acetylation of lysine 382 in the absence of genotoxic insult
(data not shown). In contrast, in cells treated with the DNA
damaging agent etoposide, EX-527 produced a concentra-
tion-dependent increase in the amount of acetylated p53,
with a maximal effect at 1 M (Fig. 2A). Nicotinamide (5
mM, a concentration commonly used to inhibit SIRT1) was
less effective at increasing p53 acetylation than 1 M EX-
527 (Fig. 2A).
To eliminate the possibility that EX-527 might influence p53
acetylation via nonspecific effects on p53, several compounds
from the same chemical series as EX-527 were tested. These
compounds varied in their ability to inhibit SIRT1 in the in
vitro deacetylation assay (IC
50
, 124 nM to 80 M). Signifi-
FIG. 2. Inhibition of SIRT1 catalytic activity increases p53 acety-
lation after DNA damage. (A) Effect of EX-527 on p53 acetylation
after DNA damage. NCI-H460 cells were treated with etoposide in
combination with either nicotinamide (Nicot.), EX-527, or dimethyl
sulfoxide vehicle (DMSO) for 6 h. Blots were probed with an anti-
acetylated p53 Lys 382 antibody (upper panel) or p53 antibody (Ab-7)
that recognizes all forms of human p53 (lower panel). (B) Effect of
EX-527 and a series of closely related compounds on p53 acetylation
after DNA damage. Cells were treated with 1 M concentrations of
the indicated compounds for 6 h, and samples were prepared as de-
scribed for panel A, except that cells were treated additionally with 25
nM TSA to inhibit class I/II HDAC activity. (C) Effect of enantiomers
of EX-527 on p53 acetylation after DNA damage. Cells were treated
with EX-242 or EX-243 for 6 h. p53 was immunoprecipitated and
immunoblotted as described for panel A. , present; , absent.
FIG. 3. Inhibition of SIRT1 catalytic activity enhances p53 lysine
382 acetylation after a variety of DNA-damaging agents and is not cell
type specific. (A) NCI-H460 cells were treated with adriamycin, hy-
droxyurea, or hydrogen peroxide for 6 h. p53 was immunoprecipitated
and immunoblotted with an anti-acetylated p53 Lys 382 antibody or
p53 antibody (Ab-7). (B) U-2 OS and MCF-7 cells were treated with
etoposide in the presence or absence of 1 M EX-527 for 6 h. Immu-
noprecipitation and immunoblotting was performed as described for
panel A. (C) HMEC were treated with etoposide or adriamycin in the
presence or absence of 1 M EX-527 for 6 h. Immunoprecipitation
and immunoblotting of p53 was performed as described for panel A.
Total SIRT1 levels were measured by immunoblotting using antibody
07-131 (Upstate Cell Signaling Solutions). , present; , absent.
VOL. 26, 2006 INHIBITION OF SIRT1 DOES NOT ALTER CELL SURVIVAL 31
cantly, inhibition of SIRT1 catalytic activity correlated well
with the ability to increase p53 acetylation in etoposide-treated
cells when the compounds were tested at 1 M in the presence
of 25 nM TSA (Fig. 2B). For additional validation, the optical
isomers of EX-527 were tested, with the inactive isomer EX-
242 serving as a control for SIRT1-independent cellular effects.
One micromolar EX-243, the active isomer, enhanced the
acetylation of p53 in the presence of etoposide, whereas 1 M
EX-242 had no effect (Fig. 2C). These results confirm that
EX-527 regulates p53 acetylation directly by inhibition of
SIRT1 catalytic activity.
Acetylation of p53 is known to occur in response to a wide
variety of DNA damaging agents (1). To determine whether
the catalytic activity of SIRT1 plays a general role in control-
ling DNA damage-induced acetylation, NCI-H460 cells were
treated with 1 M EX-527 in combination with a variety of
genotoxic agents. EX-527 increased acetylation of lysine 382 in
response to adriamycin, hydroxyurea, and hydrogen peroxide
(Fig. 3A) as well as etoposide (Fig. 2). We also investigated
whether inhibition of SIRT1 with EX-527 can regulate acetyl-
p53 in other cell lines as well as primary human cells. In
addition to NCI-H460 cells, EX-527 inhibited p53 deacetyla-
tion in U-2 OS and MCF-7 cells treated with etoposide
(Fig. 3B). Both of these cell lines express SIRT1 as assessed by
immunoblotting (data not shown).
HMEC were treated with etoposide or adriamycin in the
presence or absence of EX-527 (Fig. 3C). These cells express
SIRT1, as shown by immunoblotting, and inhibition with EX-
527 increased acetylation of p53 lysine 382 in response to both
etoposide and adriamycin. These results show that SIRT1 reg-
ulates p53 acetylation in several cell types, including primary
cells, under a broad range of conditions.
Effects of inhibition of SIRT1 on p53-controlled gene ex-
pression. As p53 carries out many of its effects by functioning
as a transcription factor, for instance, increasing the expression
of p21 and BAX (26), we assessed the role of SIRT1-mediated
FIG. 4. p53-controlled gene expression is not altered by inhibition of SIRT1 in several p53-positive cell lines. (A) NCI-H460, MCF-7, U-2 OS,
and HMEC were treated with various concentrations of etoposide for6hinthepresence of 1 M EX-527 or dimethyl sulfoxide vehicle (DMSO).
Levels of p21 mRNA were measured using quantitative PCR and normalized to the expression levels of hypoxanthine phosphoribosyltransferase
(HPRT). (B) NCI-H460 cells were treated with etoposide or adriamycin in the presence or absence of EX-527 for 6 h. Cell lysates were prepared
for immunoblotting and were probed with antibodies directed against p21 and tubulin. , present; , absent.
32 SOLOMON ET AL. MOL.CELL.BIOL.
deacetylation in p53-controlled gene expression. NCI-H460,
MCF-7, and U-2 OS cells were treated with various concen-
trations of etoposide (0 to 20 M) with or without 1 M
EX-527, and then p21 mRNA was measured by quantitative
reverse transcription-PCR. As expected, p21 transcripts
showed a progressive increase with 0.2 M, 2 M, and 20 M
etoposide. Primary HMEC were also treated with etoposide
(0.8 to 100 M), as higher concentrations were needed to
induce p21 in these cells. SIRT1 inhibition by 1 M EX-527
had no effect on p21 mRNA levels in the absence of etoposide
(no DNA damage) or at any concentration of etoposide in any
of the cells tested (Fig. 4A). We also found no effect of SIRT1
inhibition on the regulation of BAX mRNA in the same sam-
ples (data not shown). p21 protein was not affected by 1 M
EX-527 in NCI-H460 cells treated with either etoposide (20
M) or adriamycin (0.2 g/ml) (Fig. 4B). These data suggest
that the levels of two specific p53 target genes are not regu-
lated by SIRT1-mediated deacetylation of p53 at lysine 382,
following etoposide-induced DNA damage.
Effects of SIRT1 inhibition on cell viability and growth.
Previous studies have suggested that acetylation regulates p53
activity, although this is controversial (41). If increased p53
acetylation leads to increased p53 activity, then the ability of
cells to survive and proliferate after DNA damage might be
altered by treatment with SIRT1 inhibitors. To test this idea,
NCI-H460 and U-2 OS cells were treated with 0 to 20 M
etoposide in the presence or absence of 1 M EX-527 and cell
survival and growth were measured. NCI-H460 cells were also
treated with 0 to 20 M etoposide and 5 mM nicotinamide. In
addition, MCF-7 cells showed limited responses to etoposide
at these concentrations and were therefore treated with adria-
mycin (0 to 1,000 ng/ml) to induce DNA damage in the same
assays.
First, cell viability was reduced in a concentration-depen-
dent manner by 48 h of exposure to etoposide or adriamycin
(Fig. 5A, C, and E). There was no effect of 1 M EX-527 on
cell viability in the absence of etoposide or adriamycin, indi-
cating that 1 M EX-527 is not toxic to these cells (Fig. 5A, C,
FIG. 5. Effect of inhibition of SIRT1 catalytic activity on cell viability and proliferation following DNA damage in cell lines. NCI-H460, U-2
OS, and MCF-7 cells were treated with increasing concentrations of etoposide or adriamycin in the presence or absence of 1 M EX-527.
NCI-H460 cells were additionally treated with 5 mM nicotinamide. (A, C, and E) Cell viability was measured at 48 h; (B, D, and F) cell proliferation
at 72 h was measured by monitoring [
14
C]thymidine incorporation.
VOL. 26, 2006 INHIBITION OF SIRT1 DOES NOT ALTER CELL SURVIVAL 33
and E). In contrast, exposure to 5 mM nicotinamide for 48 h
reduced NCI-H460 cell viability in the absence of etoposide,
suggesting that nicotinamide has toxic effects not caused by
SIRT1 inhibition (Fig. 5A). At all concentrations of etoposide
tested, EX-527 had no effect on cell viability in NCI-H460 or
U-2 OS cells (Fig. 5A and C). Likewise, EX-527 had no effect on
cell viability in MCF-7 cells at any concentration of adriamycin
(Fig. 5E). Next, the effect of EX-527 on cell proliferation was
determined by measuring incorporation of [
14
C]thymidine. Cell
proliferation was reduced by treatment with etoposide (NCI-
H460 and U-2 OS cells) or adriamycin (MCF-7 cells) in a con-
centration-dependent manner, but EX-527 had no effect on pro-
liferation (Fig. 5B, D, and F). These results suggest that survival
and cell proliferation following DNA damage are unaffected by
inhibition of SIRT1 catalytic activity.
We also tested the effects of 1 M EX-527 on the survival
and growth of primary HMEC (Fig. 6). In preliminary exper-
iments, we found that higher concentrations of DNA-damag-
ing agents were needed to affect primary cells compared to
tumor cell lines. HMEC exposed to 0 to 600 M etoposide or
0to10g/ml adriamycin showed a concentration-dependent
decrease in cell viability and proliferation. However, 1 M
EX-527 had no effect on survival or proliferation in response to
etoposide (Fig. 6A and B) or adriamycin (Fig. 6C and D),
suggesting that the response to DNA damage in these cells is
not regulated by SIRT1-mediated deacetylation.
SIRT1 is not the only p53 deacetylase, as it has been estab-
lished that HDAC1 also binds to and deacetylates p53 (7, 22).
It is possible that the level of p53 acetylation caused by inhi-
bition of SIRT1 alone is insufficient to produce phenotypic
effects. It has been shown previously that addition of TSA, a
potent HDAC inhibitor, enhances the effects of dominant-
negative SIRT1 or nicotinamide on p53 acetylation (29, 53).
Therefore, the effects of SIRT1 inhibition on p53 might only be
apparent when both SIRT1 and HDAC1 activities are inhib-
ited. To test this hypothesis, etoposide-induced p53 acetylation
was measured in NCI-H460 cells treated with 6.25 to 400 nM
TSA in the presence or absence of 1 M EX-527 (Fig. 7A).
TSA at concentrations of 6.25 to 25 nM had comparable effects
to1M EX-527 on p53 acetylation, whereas combining EX-
527 and TSA led to a synergistic increase in acetyl-p53. This
confirms the model that HDAC1 and SIRT1 coordinately reg-
ulate p53 acetylation and that TSA can enhance the effects of
SIRT1 inhibition. Furthermore, these data establish that a com-
bination of 1 M EX-527 and 25 nM TSA consistently increases
acetyl-p53 to higher levels than either compound alone.
To determine the effect of high acetyl-p53 levels achieved
with the combination of EX-527 and TSA, cell viability and
proliferation were measured after DNA damage (Fig. 7B to
E). NCI-H460 cells were treated with etoposide (0 to 60 M)
or adriamycin (0 to 1,000 ng/ml) in the presence of 1 M
EX-527 and/or 25 nM TSA (Fig. 7B to E). Twenty-five nano-
molar TSA decreased cell viability and proliferation in con-
junction with both DNA-damaging agents. However, combin-
ing EX-527 and TSA had no further effects on viability or
proliferation compared to TSA alone. Furthermore, EX-527
alone did not affect cell viability and proliferation in response
to etoposide (Fig. 7B and C) or adriamycin (Fig. 7D and E).
These results suggest that SIRT1 inhibition in NCI-H460 cells
does not significantly alter p53 function with regard to cell
survival and proliferation relative to the effects of TSA alone.
Modulation of SIRT1 protein levels by overexpression or
gene knockout technology provides conflicting results, suggest-
ing that SIRT1 can either affect apoptosis (8, 30) or has no
FIG. 6. Effect of inhibition of SIRT1 catalytic activity on cell viability and proliferation following DNA damage in primary human cells. HMEC
were treated with increasing concentrations of etoposide or adriamycin in the presence or absence of 1 M EX-527. (A and C) Cell viability was
measured at 48 h; (B and D) cell proliferation at 48 h was measured by monitoring [
14
C]thymidine incorporation.
34 SOLOMON ET AL. MOL.CELL.BIOL.
effect on this process (53). As inhibition of SIRT1 catalytic
activity with EX-527 had no effects on cell viability, we tested
the ability of SIRT1 overexpression to regulate cell survival
(Fig. 8). Stable cell lines were generated which overexpressed
either human SIRT1 or GFP. SIRT1 overexpression was con-
firmed by immunoblot analysis (Fig. 8), and the ectopically
expressed SIRT1 protein was functional, as the levels of acety-
lated p53 lysine 382 in response to etoposide were strikingly
reduced in the overexpressing cells. In MCF7 cells overex-
pressing SIRT1, the ratio of acetylated p53 to total p53 was
0.038, a sevenfold reduction from the ratio observed in GFP-
expressing control cells (0.275). However, no effect of SIRT1
overexpression on cell viability was detected after exposure to
200 to 1,600 M hydrogen peroxide in either IMR-90 or
MCF-7 cells.
DISCUSSION
We have used a novel small-molecule inhibitor of SIRT1 to
determine the role of SIRT1 catalytic activity in p53 function.
EX-527 inhibits the deacetylase activity of SIRT1 purified from
human cells (IC
50
, 38 nM). Thus, EX-527 is approximately
1,000-fold more potent than nicotinamide (IC
50
,40to50M)
(3, 31) and other SIRT1 inhibitor compounds, including spli-
tomicin (IC
50
,60M) (3), M15, and sirtinol (IC
50
,40to70
M) (17). Moreover, EX-527 is selective for SIRT1 and is
FIG. 7. Effect of inhibiting SIRT1 and HDAC1 on p53 lysine 382 acetylation and cell growth. (A) NCI-H460 cells were treated for 6 h with
various concentrations of TSA and 1 M EX-527 in the presence of 20 M etoposide. Cell lysates were analyzed by immunoblotting with an
anti-acetylated p53 Lys 382 antibody or p53 antibody (Ab-7). The graph shows the quantification of bands on the gel shown, but this is
representative of the results from two such experiments. , present; , absent. (B to E) NCI-H460 cells were treated with increasing concen-
trations of etoposide or adriamycin and deacetylase inhibitors as indicated. Dimethyl sulfoxide (DMSO) was used as the vehicle control. (B and
D) Cell proliferation at 72 h was measured by monitoring [
14
C]thymidine incorporation; (C and E) cell viability was measured at 48 h.
VOL. 26, 2006 INHIBITION OF SIRT1 DOES NOT ALTER CELL SURVIVAL 35
more than 200- to 500-fold less active against the closely re-
lated enzymes SIRT2 and SIRT3 (37a). We found that 1 M
EX-527 is nontoxic and remains active in cell culture for sev-
eral days, enabling its use in longer term studies (data not
shown). The potency, specificity, stability, and low toxicity sug-
gest that EX-527 is a more useful reagent than other inhibitors
of SIRT1 catalytic activity identified to date.
EX-527 was used to examine the effects of inhibiting SIRT1
catalytic activity on p53 acetylation and cell survival following
treatment with a diverse set of DNA-damaging agents. In the
presence of EX-527, acetylation at lysine 382 is increased,
indicating that SIRT1 is a physiological regulator of p53 acet-
ylation. The effects of EX-527 were due to inhibition of SIRT1
rather than nonspecific activities, as the active enantiomer
EX-243 increased acetyl-p53 levels, whereas the inactive iso-
mer did not. In other words, acetyl-p53 levels are raised by the
inhibition of SIRT1 catalytic activity and not by any nonspecific
activity. The most likely mechanism by which EX-527 increases
acetylation is by inhibition of SIRT1 acting directly on p53 as
a substrate. It is also possible that inhibition of SIRT1 in-
creases p53 acetylation indirectly by effects on p300 acetyl-
transferase activity (6). Although EX-527 inhibits p53 deacety-
lation, this did not affect expression of some p53 target genes
in three cell lines and primary HMEC. Furthermore, EX-527
did not affect cell viability or cell proliferation following DNA
damage in the same cells. Addition of TSA and EX-527 caused
a synergistic increase in p53 acetylation in NCI-H460 cells;
however, no additional effects on cell proliferation or viability
were detected compared to TSA alone. Taken together, these
data are consistent with the notion that acetylation at lysine
382 does not alter the activity of p53. Indeed, the role of p53
acetylation at lysine 382 remains unclear. Fibroblasts and em-
bryonic stem cells obtained from SIRT1 knockout mice are not
sensitized to genotoxic stress in spite of increased p53 acety-
lation (10, 34). In a recent report, mouse embryonic fibroblasts
were engineered so that endogenous p53 could not be acety-
lated because six lysine residues were mutated, including lysine
379 (the mouse equivalent of human lysine 382). Strikingly,
p53 activity was not altered in response to DNA damage in
these cells (14).
These results contrast with previous studies in which over-
expression of a catalytically impaired variant, SIRT1
H363Y
,de
-
creased cell survival following DNA damage (53). Importantly,
the effects of SIRT1
H363Y
could be reversed by overexpression
of dominant-negative p53, demonstrating that the effect of
SIRT1
H363Y
on cell viability requires active p53. EX-527, like
SIRT1
H363Y
, caused a significant increase in p53 acetylation;
however, no consequences on cell viability were observed. This
suggests that the effects of SIRT1
H363Y
are not due solely to
effects on its catalytic activity. Perhaps, in addition to reducing
catalytic activity, the SIRT1
H363Y
mutation causes a change in
the conformation of SIRT1 that affects its interaction with
other proteins. This raises the possibility that, in some cases,
the interactions of SIRT1 with other proteins may be more
important than its catalytic activity.
Overexpression of mouse SIRT1 has been reported to in-
crease cell survival after exposure to hydrogen peroxide and
reduce apoptosis after exposure to etoposide (30). However,
we did not observe any effect of overexpression of human
SIRT1 on cell viability after exposure to hydrogen peroxide.
These data are consistent with the work of Vaziri et al., who
showed that SIRT1 overexpression in BJ cells had no effect on
cell survival after exposure to gamma irradiation (53).
Nicotinamide, as well as EX-527, was able to increase p53
acetylation in the presence of DNA damage. However, in con-
trast to EX-527, nicotinamide reduced cell viability in the ab-
sence of DNA damage. This suggests that nicotinamide has
effects that are independent of inhibition of SIRT1 deacetylase
activity. Nicotinamide is a known inhibitor of the enzyme poly-
(ADP-ribose) polymerase, whose inhibition can result in cell
cycle arrest or apoptosis (44). Nicotinamide also inhibits
SIRT2 (39) and SIRT3 (45) (Hixon et al., Soc. Biomol. Screen.
10th Annu. Meet.). The effects of nicotinamide on poly(ADP-
ribose) polymerase, SIRT2, or SIRT3 may be responsible for
the observed reduction in cell viability. These data suggest that
cell-based experiments using nicotinamide as a means to se-
lectively inhibit SIRT1 catalytic activity must be interpreted
with caution.
The HDAC1 inhibitor TSA increased p53 acetylation after
DNA damage and, interestingly, reduced cell survival and pro-
liferation. Although HDAC1 may be a more important regu-
lator of p53 than SIRT1, it is more likely that inhibition of
FIG. 8. Effect of overexpression of SIRT1 on hydrogen peroxide-induced cell death. Cell viability was measured in IMR-90 (A) or MCF-7
(B) cells overexpressing SIRT1 or GFP treated with increasing concentrations of hydrogen peroxide for 24 h. Overexpression of SIRT1 in these
cells was confirmed using immunoblot analysis (insets). Endogenous SIRT1 is not visible because very small amounts of protein (2 to 4 g) were
needed to obtain a clean signal from cells overexpressing SIRT1 protein.
36 SOLOMON ET AL. MOL.CELL.BIOL.
HDAC1 affects cellular function via hyperacetylation of pro-
teins other than p53. The effects of 25 nM TSA on survival and
proliferation in the absence of etoposide are consistent with
stimulation of non-p53-dependent pathways, as 1 M EX-527
induced equivalent levels of acetylation on p53 lysine 382 with-
out reducing cell survival or proliferation. Indeed, TSA inhibits
all class I and II HDAC enzymes, and it has been shown that
reduced levels of HDAC2 lead to p53-independent increases
in p21 expression and decreased cell viability (18).
Our data do not preclude a role for SIRT1 in the regulation
of p53. First, physical interactions between SIRT1 and p53 may
play a role in p53 function; therefore, inhibition of SIRT1
catalytic activity may not reveal the importance of SIRT1.
Second, SIRT1 may be an important regulator of p53 function
in cell types that we have not yet examined. Intriguingly, thy-
mocytes from SIRT1 knockout mice have been shown to be
sensitized to the effects of gamma irradiation (10). It will be
interesting to determine whether this effect is dependent on
p53, as a recent report demonstrates that SIRT1 is involved in
p53-independent responses to DNA damage (32). SIRT1 has
been shown to have a role in the regulation of p53 during
senescence (11, 25). This suggests that SIRT1, which is ex-
pressed in a wide range of adult tissues, may regulate other
functions of p53, including differentiation, DNA repair, and
aging (25, 28, 47, 50).
ACKNOWLEDGMENTS
We are indebted to members of the Elixir laboratory for critical
reading of the manuscript and helpful discussions. We thank Su-Ju Lin
for providing yeast strain SL8c.
All of the authors are employees of Elixir Pharmaceuticals, Inc.
REFERENCES
1. Appella, E., and C. W. Anderson. 2001. Post-translational modifications and
activation of p53 by genotoxic stresses. Eur. J. Biochem. 268:2764–2772.
2. Barlev, N. A., L. Liu, N. H. Chehab, K. Mansfield, K. G. Harris, T. D.
Halazonetis, and S. L. Berger. 2001. Acetylation of p53 activates transcrip-
tion through recruitment of coactivators/histone acetyltransferases. Mol.
Cell 8:1243–1254.
3. Bitterman, K. J., R. M. Anderson, H. Y. Cohen, M. Latorre-Esteves, and
D. A. Sinclair. 2002. Inhibition of silencing and accelerated aging by nico-
tinamide, a putative negative regulator of yeast sir2 and human SIRT1.
J. Biol. Chem. 277:45099–45107.
4. Blander, G., and L. Guarente. 2004. The Sir2 family of protein deacetylases.
Annu. Rev. Biochem. 73:417–435.
5. Bordone, L., and L. Guarente. 2005. Calorie restriction, SIRT1 and metab-
olism: understanding longevity. Nat. Rev. Mol. Cell Biol. 6:298–305.
6. Bouras, T., M. Fu, A. A. Sauve, F. Wang, A. A. Quong, N. D. Perkins, R. T.
Hay, W. Gu, and R. G. Pestell. 2005. SIRT1 deacetylation and repression of
p300 involves lysine residues 1020/1024 within the cell cycle regulatory do-
main 1. J. Biol. Chem. 280:10264–10276.
7. Brooks, C. L., and W. Gu. 2003. Ubiquitination, phosphorylation and acet-
ylation: the molecular basis for p53 regulation. Curr. Opin. Cell Biol. 15:
164–171.
8. Brunet, A., L. B. Sweeney, J. F. Sturgill, K. F. Chua, P. L. Greer, Y. Lin, H.
Tran, S. E. Ross, R. Mostoslavsky, H. Y. Cohen, L. S. Hu, H. L. Cheng, M. P.
Jedrychowski, S. P. Gygi, D. A. Sinclair, F. W. Alt, and M. E. Greenberg.
2004. Stress-dependent regulation of FOXO transcription factors by the
SIRT1 deacetylase. Science 303:2011–2015.
9. Bykov, V. J., N. Issaeva, A. Shilov, M. Hultcrantz, E. Pugacheva, P.
Chumakov, J. Bergman, K. G. Wiman, and G. Selivanova. 2002. Resto-
ration of the tumor suppressor function to mutant p53 by a low-molec-
ular-weight compound. Nat. Med. 8:282–288.
10. Cheng, H. L., R. Mostoslavsky, S. Saito, J. P. Manis, Y. Gu, P. Patel, R.
Bronson, E. Appella, F. W. Alt, and K. F. Chua. 2003. Developmental defects
and p53 hyperacetylation in Sir2 homolog (SIRT1)-deficient mice. Proc.
Natl. Acad. Sci. USA 100:10794–10799.
11. Chua, K. F., R. Mostoslavsky, D. B. Lombard, W. W. Pang, S. Saito, S.
Franco, D. Kaushal, H. L. Cheng, M. R. Fischer, N. Stokes, M. M. Murphy,
E. Appella, and F. W. Alt. 2005. Mammalian SIRT1 limits replicative life
span in response to chronic genotoxic stress. Cell Metab. 2:67–76.
12. Denu, J. M. 2003. Linking chromatin function with metabolic networks: Sir2
family of NAD()-dependent deacetylases. Trends Biochem. Sci. 28:41–48.
13. de Ruijter, A. J., A. H. van Gennip, H. N. Caron, S. Kemp, and A. B. van
Kuilenburg. 2003. Histone deacetylases (HDACs): characterization of the
classical HDAC family. Biochem. J. 370:737–749.
14. Feng, L., T. Lin, H. Uranishi, W. Gu, and Y. Xu. 2005. Functional analysis of
the roles of posttranslational modifications at the p53 C terminus in regu-
lating p53 stability and activity. Mol. Cell. Biol. 25:5389–5395.
15. Fulco, M., R. L. Schiltz, S. Iezzi, M. T. King, P. Zhao, Y. Kashiwaya, E.
Hoffman, R. L. Veech, and V. Sartorelli. 2003. Sir2 regulates skeletal muscle
differentiation as a potential sensor of the redox state. Mol. Cell 12:51–62.
16. Giannakou, M. E., and L. Partridge. 2004. The interaction between FOXO
and SIRT1: tipping the balance towards survival. Trends Cell Biol. 14:408–
412.
17. Grozinger, C. M., E. D. Chao, H. E. Blackwell, D. Moazed, and S. L.
Schreiber. 2001. Identification of a class of small molecule inhibitors of the
sirtuin family of NAD-dependent deacetylases by phenotypic screening.
J. Biol. Chem. 276:38837–38843.
18. Huang, B. H., M. Laban, C. H. Leung, L. Lee, C. K. Lee, M. Salto-Tellez,
G. C. Raju, and S. C. Hooi. 2005. Inhibition of histone deacetylase 2 in-
creases apoptosis and p21(Cip1/WAF1) expression, independent of histone
deacetylase 1. Cell Death Differ. 12:395–404.
19. Imai, S., C. M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Tran-
scriptional silencing and longevity protein Sir2 is an NAD-dependent histone
deacetylase. Nature 403:795–800.
20. Issaeva, N., P. Bozko, M. Enge, M. Protopopova, L. G. Verhoef, M. Masucci,
A. Pramanik, and G. Selivanova. 2004. Small molecule RITA binds to p53,
blocks p53-HDM-2 interaction and activates p53 function in tumors. Nat.
Med. 10:1321–1328.
21. Jackson, M. D., and J. M. Denu. 2002. Structural identification of 2- and
3-O-acetyl-ADP-ribose as novel metabolites derived from the Sir2 family of
beta-NAD-dependent histone/protein deacetylases. J. Biol. Chem. 277:
18535–18544.
22. Juan, L. J., W. J. Shia, M. H. Chen, W. M. Yang, E. Seto, Y. S. Lin, and C. W.
Wu. 2000. Histone deacetylases specifically down-regulate p53-dependent
gene activation. J. Biol. Chem. 275:20436–20443.
23. Kaeberlein, M., M. McVey, and L. Guarente. 1999. The SIR2/3/4 complex
and SIR2 alone promote longevity in Saccharomyces cerevisiae by two dif-
ferent mechanisms. Genes Dev. 13:2570–2580.
24. Lai, S. L., R. P. Perng, and J. Hwang. 2000. p53 gene status modulates the
chemosensitivity of non-small cell lung cancer cells. J. Biomed. Sci. 7:64–70.
25. Langley, E., M. Pearson, M. Faretta, U. M. Bauer, R. A. Frye, S. Minucci,
P. G. Pelicci, and T. Kouzarides. 2002. Human SIR2 deacetylates p53 and
antagonizes PML/p53-induced cellular senescence. EMBO J. 21:2383–2396.
26. Levine, A. J. 1997. p53, the cellular gatekeeper for growth and division. Cell
88:323–331.
27. Li, M., J. Luo, C. L. Brooks, and W. Gu. 2002. Acetylation of p53 inhibits its
ubiquitination by Mdm2. J. Biol. Chem. 277:50607–50611.
28. Lin, T., C. Chao, S. Saito, S. J. Mazur, M. E. Murphy, E. Appella, and Y. Xu.
2005. p53 induces differentiation of mouse embryonic stem cells by suppress-
ing Nanog expression. Nat. Cell Biol. 7:165–171.
29. Luo, J., M. Li, Y. Tang, M. Laszkowska, R. G. Roeder, and W. Gu. 2004.
Acetylation of p53 augments its site-specific DNA binding both in vitro and
in vivo. Proc. Natl. Acad. Sci. USA 101:2259–2264.
30. Luo, J., A. Y. Nikolaev, S. Imai, D. Chen, F. Su, A. Shiloh, L. Guarente, and
W. Gu. 2001. Negative control of p53 by Sir2alpha promotes cell survival
under stress. Cell 107:137–148.
31. Marcotte, P. A., P. R. Richardson, J. Guo, L. W. Barrett, N. Xu, A. Gunasekera, and
K. B. Glaser. 2004. Fluorescence assay of SIRT protein deacetylases using an
acetylated peptide substrate and a secondary trypsin reaction. Anal. Bio-
chem. 332:90–99.
32. Matsushita, N., Y. Takami, M. Kimura, S. Tachiiri, M. Ishiai, T. Nakayama,
and M. Takata. 2005. Role of NAD-dependent deacetylases SIRT1 and
SIRT2 in radiation and cisplatin-induced cell death in vertebrate cells. Genes
Cells 10:321–332.
33. McBurney, M. W., X. Yang, K. Jardine, M. Bieman, J. Th’ng, and M.
Lemieux. 2003. The absence of SIR2alpha protein has no effect on global
gene silencing in mouse embryonic stem cells. Mol. Cancer Res. 1:402–409.
34. McBurney, M. W., X. Yang, K. Jardine, M. Hixon, K. Boekelheide, J. R.
Webb, P. M. Lansdorp, and M. Lemieux. 2003. The mammalian SIR2alpha
protein has a role in embryogenesis and gametogenesis. Mol. Cell. Biol.
23:38–54.
35. Mills, K. D., D. A. Sinclair, and L. Guarente. 1999. MEC1-dependent re-
distribution of the Sir3 silencing protein from telomeres to DNA double-
strand breaks. Cell 97:609–620.
36. Moazed, D. 2001. Common themes in mechanisms of gene silencing. Mol.
Cell 8:489–498.
37. Motta, M. C., N. Divecha, M. Lemieux, C. Kamel, D. Chen, W. Gu, Y.
Bultsma, M. McBurney, and L. Guarente. 2004. Mammalian SIRT1 re-
presses forkhead transcription factors. Cell 116:551–563.
37a.Napper, A. D., J. Hixon, T. McDonagh, K. Keavey, J.-F. Pons, J. Barker,
W. T. Yau, P. Amouzegh, A. Flagg, E. Hamelin, R. J. Thomas, M. Kates,
VOL. 26, 2006 INHIBITION OF SIRT1 DOES NOT ALTER CELL SURVIVAL 37
S. Jones, M. A. Navia, J. O. Saunders, P. S. DiStefano, and R. Curtis. 9
November 2005, posting date. Discovery of indoles as potent and selective
inhibitors of the deacetylase SIRT1. J. Med. Chem. doi:10.121/jm050522v.
38. Nemoto, S., M. M. Fergusson, and T. Finkel. 2004. Nutrient availability
regulates SIRT1 through a forkhead-dependent pathway. Science 306:2105–
2108.
39. North, B. J., B. L. Marshall, M. T. Borra, J. M. Denu, and E. Verdin. 2003.
The human Sir2 ortholog, SIRT2, is an NAD-dependent tubulin deacety-
lase. Mol. Cell 11:437–444.
40. Picard, F., M. Kurtev, N. Chung, A. Topark-Ngarm, T. Senawong, R.
Machado De Oliveira, M. Leid, M. W. McBurney, and L. Guarente. 2004.
Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-
gamma. Nature 429:771–776.
41. Prives, C., and J. L. Manley. 2001. Why is p53 acetylated? Cell 107:815–818.
42. Rodgers, J. T., C. Lerin, W. Haas, S. P. Gygi, B. M. Spiegelman, and P.
Puigserver. 2005. Nutrient control of glucose homeostasis through a complex
of PGC-1alpha and SIRT1. Nature 434:113–118.
43. Rogina, B., and S. L. Helfand. 2004. Sir2 mediates longevity in the fly
through a pathway related to calorie restriction. Proc. Natl. Acad. Sci. USA
101:15998–16003.
44. Saldeen, J., L. Tillmar, E. Karlsson, and N. Welsh. 2003. Nicotinamide- and
caspase-mediated inhibition of poly(ADP-ribose) polymerase are associated
with p53-independent cell cycle (G2) arrest and apoptosis. Mol. Cell. Bio-
chem. 243:113–122.
45. Schwer, B., B. J. North, R. A. Frye, M. Ott, and E. Verdin. 2002. The human
silent information regulator (Sir)2 homologue hSIRT3 is a mitochondrial
nicotinamide adenine dinucleotide-dependent deacetylase. J. Cell Biol. 158:
647–657.
46. Senawong, T., V. J. Peterson, D. Avram, D. M. Shepherd, R. A. Frye, S.
Minucci, and M. Leid. 2003. Involvement of the histone deacetylase SIRT1
in chicken ovalbumin upstream promoter transcription factor (COUP-TF)-
interacting protein 2-mediated transcriptional repression. J. Biol. Chem.
278:43041–43050.
47. Sengupta, S., and C. C. Harris. 2005. p53: traffic cop at the crossroads of
DNA repair and recombination. Nat. Rev. Mol. Cell Biol. 6:44–55.
48. Takata, T., and F. Ishikawa. 2003. Human Sir2-related protein SIRT1 asso-
ciates with the bHLH repressors HES1 and HEY2 and is involved in HES1-
and HEY2-mediated transcriptional repression. Biochem. Biophys. Res.
Commun. 301:250–257.
49. Tissenbaum, H. A., and L. Guarente. 2001. Increased dosage of a sir-2 gene
extends lifespan in Caenorhabditis elegans. Nature 410:227–230.
50. Tyner, S. D., S. Venkatachalam, J. Choi, S. Jones, N. Ghebranious, H.
Igelmann, X. Lu, G. Soron, B. Cooper, C. Brayton, S. Hee Park, T. Thompson, G.
Karsenty, A. Bradley, and L. A. Donehower. 2002. p53 mutant mice that
display early ageing-associated phenotypes. Nature 415:45–53.
51. van der Horst, A., L. G. Tertoolen, L. M. de Vries-Smits, R. A. Frye, R. H.
Medema, and B. M. Burgering. 2004. FOXO4 is acetylated upon peroxide
stress and deacetylated by the longevity protein hSir2(SIRT1). J. Biol. Chem.
279:28873–28879.
52. Vassilev, L. T., B. T. Vu, B. Graves, D. Carvajal, F. Podlaski, Z. Filipovic, N.
Kong, U. Kammlott, C. Lukacs, C. Klein, N. Fotouhi, and E. A. Liu. 2004. In
vivo activation of the p53 pathway by small-molecule antagonists of MDM2.
Science 303:844–848.
53. Vaziri, H., S. K. Dessain, E. Ng Eaton, S. I. Imai, R. A. Frye, T. K. Pandita,
L. Guarente, and R. A. Weinberg. 2001. hSIR2(SIRT1) functions as an
NAD-dependent p53 deacetylase. Cell 107:149–159.
54. Vogelstein, B., and K. W. Kinzler. 2004. Cancer genes and the pathways they
control. Nat. Med. 10:789–799.
55. Yeung, F., J. E. Hoberg, C. S. Ramsey, M. D. Keller, D. R. Jones, R. A. Frye,
and M. W. Mayo. 2004. Modulation of NF-kappaB-dependent transcription
and cell survival by the SIRT1 deacetylase. EMBO J. 23:2369–2380.
38 SOLOMON ET AL. MOL.CELL.BIOL.
    • "Discovered in 2005, EX-527 (selisistat , 5, Table 2) was the first potent, selective (over SIRT2/3), and cell-permeable SIRT1i [45, 46]. Despite increasing p53 acetylation, EX-527 has no major effect on viability and proliferation in various tumors [47] . EX- 527 is being developed for HD. "
    [Show abstract] [Hide abstract] ABSTRACT: Sirtuins are NAD+-dependent histone deacetylases regulating important metabolic pathways in prokaryotes and eukaryotes and are involved in many biological processes such as cell survival, senescence, proliferation, apoptosis, DNA repair, cell metabolism, and caloric restriction. The seven members of this family of enzymes are considered potential targets for the treatment of human pathologies including neurodegenerative diseases, cardiovascular diseases, and cancer. Furthermore, recent interest focusing on sirtuin modulators as epigenetic players in the regulation of fundamental biological pathways has prompted increased efforts to discover new small molecules able to modify sirtuin activity. Here, we review the role, mechanism of action, and biological function of the seven sirtuins, as well as their inhibitors and activators.
    Full-text · Article · Dec 2016
    • "Reversibly, the overexpression of SIRT1 has been negatively regulated by p53 through deacetylation at lysine 382 residues. It can further inhibit the transcriptional activity of p53 and completely blocks the p53 mediated apoptosis resulting in tumor formation [117]. If retinoblastoma (Rb) gets inactivates, it forms neoplastic transformation by inhibition of cell cycle arrest in order to move damaged DNA on to the next phase of the cell cycle [118,119]. "
    [Show abstract] [Hide abstract] ABSTRACT: The Aurora kinases belong to the family of serine/threonine kinase, a central regulator of mitosis and their expression increased during G2/M phase. It is classified into Aurora A, B and C, each has distinct roles in cellular processes, which includes regulation of spindle assembly, function of centrosomes, cytoskeleton and cytokinesis. During cancer growth, their rapid increase makes most attractive marker for cancer treatment at present. However Aurora A kinase is known to be a marker for cancer therapy, the most important serine/threonine kinase of Aurora B kinase involvement in cancer is still inadequate. Subsequently, the recent findings revealed that the class III histone deacetylase of SIRT1 is a key regulator to activate Aurora kinases from S phase damaged DNA through Wnt signaling pathway. Even if both Aurora A kinase and SIRT1 serve as a marker for cancer therapy, the present review reveals it is interaction in Wnt signaling pathway that solely for colorectal cancer.
    Full-text · Article · Aug 2016
    • "Reversibly, the overexpression of SIRT1 has been negatively regulated by p53 through deacetylation at lysine 382 residues. It can further inhibit the transcriptional activity of p53 and completely blocks the p53 mediated apoptosis resulting in tumor formation [117]. If retinoblastoma (Rb) gets inactivates, it forms neoplastic transformation by inhibition of cell cycle arrest in order to move damaged DNA on to the next phase of the cell cycle [118,119]. "
    [Show abstract] [Hide abstract] ABSTRACT: The Aurora kinases belong to the family of serine/threonine kinase, a central regulator of mitosis and their expression increased during G2/M phase. It is classified into Aurora A, B and C, each has distinct roles in cellular processes, which includes regulation of spindle assembly, function of centrosomes, cytoskeleton and cytokinesis. During cancer growth, their rapid increase makes most attractive marker for cancer treatment at present. However Aurora A kinase is known to be a marker for cancer therapy, the most important serine/threonine kinase of Aurora B kinase involvement in cancer is still inadequate. Subsequently, the recent findings revealed that the class III histone deacetylase of SIRT1 is a key regulator to activate Aurora kinases from S phase damaged DNA through Wnt signaling pathway. Even if both Aurora A kinase and SIRT1 serve as a marker for cancer therapy, the present review reveals it is interaction in Wnt signaling pathway that solely for colorectal cancer.
    Full-text · Article · Aug 2016
Show more