Cyclooxygenase-2 Induction and Prostacyclin Release by Protease-activated Receptors in Endothelial Cells Require Cooperation between Mitogen-activated Protein Kinase and NF- B Pathways

Article (PDF Available)inJournal of Biological Chemistry 281(17):11792-804 · May 2006with28 Reads
DOI: 10.1074/jbc.M509292200 · Source: PubMed
Abstract
The functional significance of protease-activated receptors (PARs) in endothelial cells is largely undefined, and the intracellular consequences of their activation are poorly understood. Here, we show that the serine protease thrombin, a PAR-1-selective peptide (TFLLRN), and SLIGKV (PAR-2-selective peptide) induce cyclooxygenase-2 (COX-2) protein and mRNA expression in human endothelial cells without modifying COX-1 expression. COX-2 induction was accompanied by sustained production of 6-keto-PGF1alpha, the stable hydrolysis product of prostacyclin, and this was inhibited by indomethacin and the COX-2-selective inhibitor NS398. PAR-1 and PAR-2 stimulation rapidly activated both ERK1/2 and p38MAPK, and pharmacological blockade of MEK with either PD98059 or U0126 or of p38MAPK by SB203580 or SB202190 strongly inhibited thrombin- and SLIGKV-induced COX-2 expression and 6-keto-PGF1alpha formation. Thrombin and peptide agonists of PAR-1 and PAR-2 increased luciferase activity in human umbilical vein endothelial cells infected with an NF-kappaB-dependent luciferase reporter adenovirus, and this, as well as PAR-induced 6-keto-PGF1alpha synthesis, was inhibited by co-infection with adenovirus encoding wild-type or mutated (Y42F) IkappaBalpha. Thrombin- and SLIGKV-induced COX-2 expression and 6-keto-PGF1alpha generation were markedly attenuated by the NF-kappaB inhibitor PG490 and partially inhibited by the proteasome pathway inhibitor MG-132. Activation of PAR-1 or PAR-2 promoted nuclear translocation and phosphorylation of p65-NF-kappaB, and thrombin-induced but not PAR-2-induced p65-NF-kappaB phosphorylation was reduced by inhibition of MEK or p38MAPK. Activation of PAR-4 by AYPGKF increased phosphorylation of ERK1/2 and p38MAPK without modifying NF-kappaB activation or COX-2 induction. Our data show that PAR-1 and PAR-2, but not PAR-4, are coupled with COX-2 expression and sustained endothelial production of vasculoprotective prostacyclin by mechanisms that depend on ERK1/2, p38MAPK, and IkappaBalpha-dependent NF-kappaB activation.
7 Figures

Full-text (PDF)

Available from: Tom D Carter
Cyclooxygenase-2 Induction and Prostacyclin Release by
Protease-activated Receptors in Endothelial Cells Require
Cooperation between Mitogen-activated Protein Kinase
and NF-
B Pathways
*
Received for publication, August 23, 2005, and in revised form, February 7, 2006 Published, JBC Papers in Press, February 8, 2006, DOI 10.1074/jbc.M509292200
Farisa Syeda
, Jennifer Grosjean
§
, Rebecca A. Houliston
, Rosemary J. Keogh
, Tom D. Carter
, Ewa Paleolog
§
,
and Caroline P. D. Wheeler-Jones
‡1
From the
Department of Veterinary Basic Sciences, Royal Veterinary College, Royal College Street, London NW1 0TU,
United Kingdom,
§
Kennedy Institute of Rheumatology and Division of Surgery, Oncology, Reproductive Biology, and Anaesthetics,
Faculty of Medicine, Imperial College, London W6 8LH, United Kingdom, and
National Institute for Medical Research, Mill Hill,
London NW7 1AA, United Kingdom
The functional significance of protease-activated receptors (PARs)
in endothelial cells is largely undefined, and the intracellular conse-
quences of their activation are poorly understood. Here, we show that
the serine protease thrombin, a PAR-1-selective peptide (TFLLRN),
and SLIGKV (PAR-2-selective peptide) induce cyclooxygenase-2
(COX-2) protein and mRNA expression in human endothelial cells
without modifying COX-1 expression. COX-2 induction was accom-
panied by sustained production of 6-keto-PGF
1
, the stable hydrolysis
product of prostacyclin, and this was inhibited by indomethacin and
the COX-2-selective inhibitor NS398. PAR-1 and PAR-2 stimulation
rapidly activated both ERK1/2 and p38
MAPK
, and pharmacological
blockade of MEK with either PD98059 or U0126 or of p38
MAPK
by
SB203580 or SB202190 strongly inhibited thrombin- and SLIGKV-in-
duced COX-2 expression and 6-keto-PGF
1
formation. Thrombin
and peptide agonists of PAR-1 and PAR-2 increased luciferase
activity in human umbilical vein endothelial cells infected with an
NF-
B-dependent luciferase reporter adenovirus, and this, as well
as PAR-induced 6-keto-PGF
1
synthesis, was inhibited by co-infec
-
tion with adenovirus encoding wild-type or mutated (Y42F) I
B
.
Thrombin- and SLIGKV-induced COX-2 expression and 6-keto-
PGF
1
generation were markedly attenuated by the NF-
B inhibitor
PG490 and partially inhibited by the proteasome pathway inhibitor
MG-132. Activation of PAR-1 or PAR-2 promoted nuclear translo-
cation and phosphorylation of p65-NF-
B, and thrombin-induced
but not PAR-2-induced p65-NF-
B phosphorylation was reduced
by inhibition of MEK or p38
MAPK
. Activation of PAR-4 by AYPGKF
increased phosphorylation of ERK1/2 and p38
MAPK
without modi
-
fying NF-
B activation or COX-2 induction. Our data show that
PAR-1 and PAR-2, but not PAR-4, are coupled with COX-2 expres-
sion and sustained endothelial production of vasculoprotective
prostacyclin by mechanisms that depend on ERK1/2, p38
MAPK
, and
I
B
-dependent NF-
B activation.
The principal mechanism through which serine proteases regulate
cell behavior is by activation of a unique family of G-protein-coupled
receptors, referred to as protease-activated receptors (PARs)
2
(1, 2).
These receptors are activated by the proteolytic activities of their
ligands, which unmask a cryptic N-terminal receptor sequence that
binds to and triggers receptor function while remaining tethered.
Molecular cloning has identified four subtypes of the PAR family that
exhibit differential tissue expression as well as selectivity in activation by
serine proteases and by peptides that mimic the tethered ligand
sequences. PAR-1 is a ubiquitously expressed receptor and is activated
by the multifunctional serine protease, thrombin, and by the synthetic
PAR-1 peptide TFLLRN. PAR-4 is a second thrombin receptor that
binds thrombin with low affinity and can be activated by the polypeptide
sequence AYPGKF (3, 4). Signaling through PAR-2, in contrast, is pref-
erentially stimulated by trypsin, tryptase, and membrane-type serine
protease-1 (5) and can be activated independently of proteolysis by the
selective PAR-2 peptide SLIGKV. Cellular responses to thrombin and to
other proteases are therefore determined in part by the expression of
PARs as well as by the differential recruitment of signaling pathways
following ligand binding.
Endothelial cells respond to PAR-1 activation by thrombin with a
number of functional responses including secretion of von Willebrand
factor (6), up-regulation of IL-8 synthesis (7), and expression of adhe-
sion molecules (8). Thrombin also causes endothelial cell proliferation,
which is essential for wound healing and angiogenesis (9). However,
whereas this protease clearly promotes both proinflammatory and pro-
thrombotic events in the vascular wall, thrombin also increases endo-
thelial expression of complement inhibitory proteins (e.g. decay-accel-
erating factor) (3) and enhances the release of vasodilator molecules that
have vasculoprotective properties (6, 11). In particular, we have shown
that thrombin exposure induces rapid and sustained phases of prosta-
cyclin (PGI
2
) synthesis by human endothelial cells (12). PGI
2
contrib
-
utes to the acute inflammatory response by promoting vasodilation and
increased vascular permeability, is a potent antiplatelet agent, and has
antiproliferative and antifibrotic effects mediated by paracrine actions
on vascular smooth muscle and fibroblasts, respectively (13, 14). The
potential effects of PAR-2 activation on endothelial prostanoid produc-
* This work was supported by the British Heart Foundation. The costs of publication of
this article were defrayed in part by the payment of page charges. This article must
therefore be hereby marked advertisement in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
1
To whom correspondence should be addressed: Dept. of Veterinary Basic Sciences,
Royal Veterinary College, Royal College St., London NW1 0TU, UK. Tel.: 44-0207-468-
5237; Fax: 44-0207-468-5204; E-mail: cwheeler@rvc.ac.uk.
2
The abbreviations used are: PAR, protease-activated receptor; HUVEC, human umbili
-
cal vein endothelial cell(s); COX-1/-2, cyclooxygenase-1/-2; I
B
, inhibitory protein
B
; IKK, I
B-kinase; MEK, mitogen-activated protein kinase/extracellular signal-reg-
ulated kinase kinase; ERK, extracellular signal-regulated kinase; MAPK, mitogen-acti-
vated protein kinase; IL-1
, interleukin-1
; 6-keto-PGF
1
, 6-keto-prostaglandin F
1
;
PGI
2
, prostacyclin (prostaglandin I
2
); Ad, adenovirus; BSA, bovine serum albumin;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered
saline; ANOVA, analysis of variance.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 17, pp. 11792–11804, April 28, 2006
© 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
11792 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281NUMBER 17 APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
tion have received little attention, but there is some evidence that PAR-2
can mediate protective anti-inflammatory responses in vivo (15) as well
as contributing to inflammation (16). PAR-2 is strongly induced in
endothelial cells following cytokine challenge (17), and it has been sug-
gested that activation of this receptor is functionally significant only in
the context of inflammation. We have recently shown, however, that
human endothelial cells respond to PAR-2 activation with increased
prostanoid synthesis without the requirement for cytokine exposure
(12), suggesting that PAR-2 is also a physiologically relevant receptor.
Understanding how signaling through distinct PARs regulates endothe-
lial production of PGI
2
therefore has important implications for both
normal and pathophysiological control of the vasculature.
Prostaglandins are synthesized through the activities of two isoforms
of cyclooxygenase (COX), designated COX-1 and COX-2 (18). COX-1
is a constitutive enzyme present in most tissues. In contrast, COX-2, the
product of a related gene, is strongly up-regulated by cytokines and
growth factors (19, 20) and is now recognized to be constitutively
expressed in several tissues (20). Regulation of COX-2 occurs at both
transcriptional and post-transcriptional levels, and mitogen-activated
protein kinases (MAPKs) are known to be involved in regulating COX-2
expression in response to cytokines (21–23). ERK1/2 and p38
MAPK
have
been implicated in both acute and chronic responses to extracellular
stimuli in endothelial cells and we have shown that both of these MAPK
families are capable of regulating acute thrombin-stimulated PGI
2
syn
-
thesis through their direct and indirect effects on Group IV phospho-
lipase A
2
activation (24). We have also previously shown that COX-2
expression in primary human endothelial cells is enhanced by exposure
to thrombin and the PAR-1-selective peptide TFLLRN and have pro-
vided evidence that activation of PAR-2 by SLIGKV promotes increased
COX-2 expression with kinetics distinct from those evident in throm-
bin-stimulated cells (12). The signaling events that link PAR-1 and
PAR-2 with COX-2 expression and sustained prostanoid production
are not defined, but the ERK1/2 and p38
MAPK
families may play impor
-
tant roles.
The COX-2 gene contains numerous cis-acting promoter elements,
including NF-
B sites (25). NF-
B is a sequence-specific transcription
factor that regulates expression of numerous genes and can exert pro-
tective or detrimental effects, depending upon the cellular context
(26–28). In resting cells, NF-
B is complexed in the cytoplasm with
its inhibitory subunit I
B
. Agonist stimulation promotes serine
phosphorylation of I
B
, which triggers its proteasomal degradation
and subsequently activates NF-
B. NF-
B can also be activated by an
alternative mechanism that involves phosphorylation of I
B
on Tyr
42
(27). In addition, optimal induction of NF-
B-dependent genes may
require agonist-mediated phosphorylation of NF-
B proteins within
their transactivation domain (29). There is some evidence that throm-
bin and a PAR-2-selective peptide can activate NF-
B in vascular cells
(30, 31), suggesting that the NF-
B pathway may be an important com-
ponent of PAR-mediated signaling. However, whereas COX-2 expres-
sion in several cell types is at least partly dependent on NF-
B activity,
the molecular details of its activation in response to ligand binding to
PARs are unknown, and hence its significance as a regulator of endo-
thelial PGI
2
synthesis remains to be determined.
We have investigated the molecular signaling mechanisms underly-
ing PAR-induced COX-2 expression and PGI
2
synthesis in human
endothelial cells. We show for the first time that activation of endothe-
lial PAR-1 and PAR-2, but not PAR-4, promotes COX-2 induction and
sustained formation of the vasculoprotective mediator PGI
2
through
mechanisms that require activation of ERK1/2 and p38
MAPK
as well as
I
B
-dependent NF-
B activation. We further show that phosphoryl-
ation of the p65 subunit of NF-
B is a component of both PAR-1- and
PAR-2-mediated endothelial activation. These findings have important
implications for understanding the vascular effects of therapeutic inter-
ventions that target COX-2 and upstream activators of NF-
B.
EXPERIMENTAL PROCEDURES
Reagents—Human
-thrombin, bovine serum albumin (BSA; frac-
tion V), and polyvinylidene difluoride membranes (Immobilon-P
TM
)
were all purchased from Sigma. The PAR-1-selective peptide TFLLRN
and the PAR-2 peptide SLIGKV were obtained from Bachem (St.
Helens, Merseyside, UK), and 2F-LIGRLO was from Peptides Interna-
tional Inc. (Louisville, KY). These peptides have been extensively char-
acterized with respect to their selectivity of action at PARs (e.g. see Ref.
32). Human recombinant IL-1
was from R&D Systems (Oxford, UK),
and the bicinchoninic acid (BCA) protein assay was from Pierce. PG490
(triptolide), PD98059, SB203580, SB202190, and U0126 were from
Calbiochem. Reagents for SDS-PAGE were purchased from Bio-Rad
(Hemel Hempstead, Hertfordshire, UK) and National Diagnostics
(Hessle, Hull, UK). [
3
H]6-keto-PGF
1
was obtained from Amersham
Biosciences. The RNeasy Mini kit and the Superscript II reverse tran-
scriptase were from Qiagen Ltd. (Crawley, West Sussex, UK) and
Invitrogen, respectively. The DyNAmo SYBR Green quantitative PCR
kit was purchased from Finnzymes (Espoo, Finland). Other molecular
biology reagents were all obtained from Promega (Southampton, UK).
Culture media were purchased from Sigma or Invitrogen. All other
reagents were obtained from Sigma or BDH (Poole, Dorset, UK) at the
equivalent of AnalaR grade.
Antibodies—Polyclonal COX-1, COX-2, and phospho-p65-NF-
B
(Ser
536
) antibodies were purchased from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). Polyclonal antibodies against phospho-ERK1/2,
ERK1/2, p38
MAPK
, and p65-NF-
B were from New England Biolabs
(Beverly, MA). Anti-phospho-p38
MAPK
antibodies were from either
New England Biolabs or BIOSOURCE (Nivelles, Belgium). The I
B
antibody was from Active Motif (Rixensart, Belgium). Fluorescein iso-
thiocyanate-conjugated goat anti-rabbit secondary antibodies were
obtained from Sigma. Horseradish peroxidase-conjugated goat anti-
rabbit and rabbit anti-goat immunoglobulins were from Pierce.
Cell Culture—Human umbilical vein endothelial cells (HUVEC)
were isolated and cultured as previously described (12, 24). Briefly, cells
were grown in medium M199 (Sigma) supplemented with 20% (v/v)
fetal calf serum, 4 m
M glutamine, 100 units/ml penicillin, 100 units/ml
streptomycin, and 20 m
M NaHCO
3
and cultured at 37 °C in a 5% CO
2
,
95% air atmosphere in 25-mm
2
tissue culture flasks (BD Biosciences)
precoated with 1% (w/v) gelatin. At confluence, cells were passaged into
75-mm
2
tissue culture flasks and cultured in the presence of 20 mg/ml
endothelial cell growth factor. Experiments were performed on conflu-
ent passage 2 cells grown in the appropriate gelatin-coated cell culture
dishes.
Western Blotting—HUVEC monolayers in 60-mm
2
dishes (1 10
6
cells/dish) were serum- and endothelial cell growth factor-deprived for
16 h. Quiescent cells were then subjected to treatments as detailed in the
legends to Figs. 1, 4, 5, 7, and 9. Whole cell lysates were prepared, and
immunoblotting analyses were performed as previously described (24).
Blots initially probed with antibodies against either COX-2, phospho-
ERK1/2, or phospho-p38
MAPK
(1:1000) were stripped by incubation in
62.5 m
M Tris-HCl (pH 6.7), 2% (w/v) SDS, and 0.7% (v/v)
-mercapto-
ethanol for 30 min at 50 °C. Following extensive washing, blots were
reprobed with COX-1, total ERK1/2, or total p38
MAPK
(1:1000) antibod
-
ies. Immunoreactive proteins were visualized by enhanced chemilumi-
nescence. Where indicated, densitometric analyses of immunoblots
PAR-induced COX-2 Expression and Prostanoid Synthesis
APRIL 28, 2006 VOLUME 281 NUMBER 17 JOURNAL OF BIOLOGICAL CHEMISTRY 11793
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
were performed using a Bio-Rad scanning densitometer and Quantity
One analyzing software.
RNA Extraction and Real Time Reverse Transcription-PCR—Quies-
cent HUVEC were treated as described in the legends to Figs. 2 and 5, and
RNA was extracted using a Qiagen RNeasy minikit according to the man-
ufacturer’s instructions. Total HUVEC RNA was reverse transcribed by
incubating 1
g of RNA with 0.5
g of oligo(dT)
15
primer and 200 units of
M-Superscript reverse transcriptase for1hat3C,15minat4C,and3
min at 98 °C. 10% of the resulting cDNA was amplified using the SYBR
Green quantitative PCR kit. Primers used for real time PCR were synthe-
sized by MWG-Biotech (Milton Keynes, UK). The 5 to 3 sequences used
were as follows: GCATCTTCTTTTGCGTCGCC (GAPDH-1 forward),
GTCATTGATGGCAACAATATCC (GAPDH-1 reverse), GCCCAG-
CACTTCACGCATCAG (COX-2 forward), and AGACCAGGCACCA-
GACCAAAGACC (COX-2 reverse). The PCR was performed (Opticon II)
using the following parameters: 95 °C for 2 min, 30 cycles of 93 °C for 1 min,
and 60 °C for 1 min and a final extension step at 60 °C for 7 min. Each
analysis contained a range of standards (known concentrations of the same
target sequence). Data were analyzed using the Opticon II monitor 2 anal-
ysis software, and a standard curve was plotted that correlated cycle num-
ber with the amount of product formed after each cycle. COX-2 mRNA
levels were normalized to GAPDH for each sample.
Analysis of NF-
B Activation Using Luciferase Adenovirus Infection
All viruses were E1/E3 (early transcribed regions)-deficient and belonged to
the Adv5 serotype. Viruses were propagated in 293 human embryonic kid-
ney cells (American Type Culture Collection, Manassas, VA) and purified
by cesium chloride ultracentrifugation. Titers of viral stocks were deter-
mined by plaque assay on 293 cells. Replication-deficient control adenoviral
vector without insert (Ad0) was provided by Drs A. Byrnes and M. Wood
(Oxford University). Adenovirus encoding porcine I
B
with a cytomega-
lovirus promoter and a nuclear localization sequence (AdI
B
) was pro-
vided by Dr. R. de Martin (University of Vienna). The adenovirus express-
ing mutated human I
B
(tyrosine 42 to phenylalanine; AdI
B
Y42F) was
from Prof. J. F. Engelhardt (University of Iowa). Efficient infection of cells
(95%) was confirmed using virus encoding bacterial
-galactosidase at a
multiplicity of infection (MOI) of 100:1 followed by the addition of the
fluorimetric substrate, fluorescein-di-
-galactopyranoside (Sigma) (data
not shown). Measurement of NF-
B transactivation is based on the use of
an adenovirus reporter vector, which contains a luciferase gene under the
control of NF-
B (AdNF-
B-Luc). This adenovirus reporter was provided
by Dr. P. B. McCray, Jr. (University of Iowa) and is a modification of the
pNF-
B-Luc reporter vector (BD Biosciences/Clontech). pNF-
B-Luc
contains the firefly luciferase gene from Photinus pyralis and four tandem
copies of the NF-
B consensus sequence fused to a TATA-like promoter
from the herpes simplex virus thymidine kinase promoter. The vector
backbone also contains an f1 origin for single-stranded DNA production, a
pUC origin of replication, and an ampicillin resistance gene for propagation
and selection in Escherichia coli. Therefore, NF-
B-directed promoter
activity is estimated as being proportional to the firefly luciferase activity.
For adenoviral infection, HUVEC were seeded at 80% confluence
(9,600 cells) in 30-mm
2
wells and infected in serum-free medium (RPMI
1640) with Ad0 or AdNF-
B-Luc (MOI of 100:1) with or without co-
infection with AdI
B
or AdI
B
Y42F (MOI 100:1). After 1 h of infec-
tion, medium containing free adenoviruses was replaced with complete
culture medium for 24 –36 h to allow expression of the gene(s) of inter-
est. Cells were then stimulated for the time periods detailed in the leg-
end to Fig. 8, subsequently washed with sterile phosphate-buffered
saline (PBS), and lysed in 100
l of lysis buffer (0.65% Nonidet P-40, 10
m
M Tris (pH 8.0), 1 mM EDTA, 150 mM NaCl) on ice for 5 min. 50
lof
lysate were added to the wells of a luminometer cuvette strip containing
120
l of luciferase assay buffer (25 mM Tris-phosphate (pH 7.8), 8 mM
MgCl
2
,1mM EDTA, 1% (v/v) Triton X-100, 1% (v/v) glycerol, 1 mM
dithiothreitol, 0.5 mM ATP). Luciferase activity was measured using a
LabSystems luminometer by dispensing 30
l of luciferin (Bright-
Glo
TM
luciferase assay system; Promega)/assay point. Luciferase activity
was normalized in each experiment to the amount of protein.
Immunofluorescence—HUVEC were plated on 13-mm glass cover-
slips in 4-well plates (Nunc-Nalgene) and grown for 24 48 h until 80%
confluent. Following the required treatments, cells were fixed in 4%
paraformaldehyde, washed with 0.5% BSA-PBS containing 0.5% BSA
(PBS-BSA), and permeabilized in PBS-BSA supplemented with 0.1%
Triton. Coverslips were then incubated for1hwithanti-p65NF-
B
antibodies (10
g/ml) in PBS-BSA at room temperature. After incuba-
tion, coverslips were washed twice in PBS-BSA and incubated with flu-
orescein isothiocyanate-conjugated secondary goat anti-rabbit antibod-
ies (1:100) for 45 min. Cells were then washed (twice), and slides were
mounted with either Fluorsave (Dako, Cambridgeshire, UK) or with
propidium iodide-containing mounting medium (Vectashield, Burl-
ingame, CA). Immunofluorescence was monitored by confocal micros-
copy using a Zeiss LSM 510 inverted microscope.
Measurement of PGI
2
Release—Confluent cultures of HUVEC in
24-well tissue culture trays were treated as described in the legends.
Supernatants were assayed for 6-keto-PGF
1
(the stable hydrolysis
product of PGI
2
) by radioimmunoassay as previously described (12).
Statistical Analysis—Student’s t test or ANOVA, as appropriate,
were used to compare means of groups of data. p 0.05 was considered
statistically significant.
RESULTS
PAR Agonists Differentially Induce COX-2 Expression and PGI
2
Syn
-
thesis in HUVEC—Peptide agonists for PARs have been extensively
characterized for PAR selectivity (e.g. see Ref. 32) and are currently in
wide use to interrogate the functional significance of PARs in a number
of systems. We have recently shown that thrombin enhances expression
of COX-2 protein and mRNA in HUVEC and that this is accompanied
by prolonged PGI
2
synthesis (12). We also provided evidence that the
human PAR-2-selective agonist peptide SLIGKV increased COX-2 pro-
tein in HUVEC and enhanced COX-2 mRNA and PGI
2
release after 2
and 6 h, respectively (12). To gain further insight into the regulation of
COX-2 expression and PGI
2
synthesis in response to activation of PARs,
we initially extended these findings by comparing, within the same
HUVEC cultures, the time courses of expression of COX-2 (mRNA and
protein) as well as examining the detailed time courses of PGI
2
synthesis
for all three stimulants in comparison with IL-1
. Both thrombin and
SLIGKV enhanced COX-2 expression in HUVEC in a concentration-
and time-dependent manner (Fig. 1). Thrombin (1 units/ml) induced a
significant increase in COX-2 protein expression after 2 h, and this was
maintained and further increased after 4- and 8-h exposure. Similar
induction kinetics were evident in cells challenged with the PAR-1-
selective peptide TFFLRN (data not shown). In contrast, SLIGKV (100
M) (Fig. 1A) or the metabolically stable PAR-2 peptide 2F-LIGRLO (10
M) (data not shown) maximally induced COX-2 expression after 2 h,
and this was sustained but not further enhanced with prolonged expo-
sure to peptide. In keeping with our previous findings (12), the expres-
sion of COX-1 was not significantly modified by either thrombin or
SLIGKV (Fig. 1, A and B). We next examined whether PAR-stimulated
COX-2 protein expression is accompanied by changes in COX-2
mRNA expression using real time reverse transcription-PCR analysis.
Both thrombin and SLIGKV caused a 3–4-fold increase in COX-2
mRNA expression after 1–2 h (Fig. 2). However, in SLIGKV-stimulated
PAR-induced COX-2 Expression and Prostanoid Synthesis
11794 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 NUMBER 17 APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
HUVEC, mRNA levels declined rapidly after 1 h, whereas expression
peaked at 2 h after thrombin exposure and was still evident after 4 h.
Together, these results show that activation of either PAR-1 or PAR-2 in
HUVEC promotes increased COX-2 expression but that the time
courses of induction differ between agonists.
We have previously shown that exposure of HUVEC to thrombin
triggers a biphasic PGI
2
synthesis characterized by an initial rapid
release occurring within 30 min of exposure followed by a sustained and
prolonged synthesis lasting for several hours (12). Here, we have con-
firmed this effect and characterized the PGI
2
response to PAR-2 stim
-
ulation. As depicted in Fig. 3, a 30-min exposure to thrombin (1 unit/ml)
markedly enhanced (up to 18-fold) formation of the stable PGI
2
hydrol
-
ysis product, 6-keto-PGF
1
, whereas little effect of either SLIGKV or
IL-1
was evident at this time point. Increasing the exposure time to
thrombin further increased release, which reached a sustained peak
between 4 and 8 h. Similar results were obtained with the PAR-1 peptide
TFFLRN (data not shown). In contrast, no significant 6-keto-PGF
1
generation was evident in SLIGKV-stimulated cells until 2– 4 h after
exposure. Thus, the time of onset of PGI
2
synthesis as well as the mag
-
nitude of the response differs between PAR agonists. To confirm the
involvement of COX-2 activity in these responses, we used the COX-2-
selective inhibitor NS398. As shown in Fig. 3 (inset), 6-keto-PGF
1
for
-
mation in unstimulated HUVEC and in cells subject to prolonged expo-
sure to thrombin was inhibited by 80% following pretreatment with
NS398 (1
M), but virtually abolished by exposure to the COX-1/2
inhibitor indomethacin. These results confirm the importance of
COX-2 activity in prolonged PGI
2
release in response to thrombin and
suggest that a component of thrombin-induced synthesis depends upon
COX-1 activity (12, 24, 52).
Involvement of MAPK Signaling Cascades in PAR-induced COX-2
Expression and PGI
2
Synthesis—We and others have shown that MAPK
signaling pathways are important regulators of acute prostanoid synthe-
sis by endothelium (24). However, the molecular mechanisms involved
in regulating prolonged endothelial prostanoid release, particularly in
response to PAR activation, remain to be determined. To define the
importance of ERK1/2 and p38
MAPK
as regulators of PAR-induced
COX-2 expression and prostanoid release, we initially examined the
effects of PAR agonists on the phosphorylation status of ERK1/2 and
p38
MAPK
. Thrombin (Fig. 4
A) and the PAR-1-selective peptide TFLLRN
(not shown) caused a rapid and robust activation of ERK1/2 that was still
evident after 2 h but was significantly reduced ( p 0.05) compared with
that evident after 10 min. In contrast, stimulation with the PAR-2 pep-
FIGURE 1. Thrombin and the PAR-2-selective peptide SLIGKV induce COX-2 protein expression in HUVEC. Confluent, quiescent HUVEC were exposed to vehicle alone (C)or
thrombin (T; 1 unit/ml) for the indicated time periods (A) or to SLIGKV ( SL; 50 –200
M)for2h(B). Whole cell lysates were prepared and analyzed by SDS-PAGE and immunoblotting
with COX-1 and COX-2 antibodies. Immunoblots are each representative of five separate experiments performed on cells isolated from five umbilical cords. Data from densitometric
analyses are presented as mean S.D. (n 5 individual experiments). *, p 0.05 versus unstimulated control cells.
FIGURE 2. Effects of thrombin and SLIGKV on COX-2 mRNA expression in HUVEC.
Confluent, quiescent HUVEC were challenged with vehicle alone (Cont; control), throm-
bin (1 unit/ml), SLIGKV (100
M), or IL-1
(100 units/ml) for 1, 2, or 4 h. Total RNA was
extracted, and COX-2 and GAPDH mRNAs were quantified by real-time PCR as described
under “Experimental Procedures.” Results, normalized to GAPDH expression, are given
as mean S.D. (n 3 individual experiments). *, p 0.01; #, p 0.001 versus unstimu-
lated control cells (ANOVA).
PAR-induced COX-2 Expression and Prostanoid Synthesis
APRIL 28, 2006 VOLUME 281 NUMBER 17 JOURNAL OF BIOLOGICAL CHEMISTRY 11795
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
tide produced a rapid increase in ERK1/2 activation that did not signif-
icantly decline even after4hofexposure. SLIGKV also activated
p38
MAPK
with similar levels of activation evident at both early and late
time points (Fig. 4B). The PAR-4-selective peptide AYPGKF promoted
activation of ERK1/2 and p38
MAPK
in HUVEC that was evident after 10
min of stimulation (Fig. 4C), which contrasts with our previous demon-
stration that ERK1/2 activation by thrombin or PAR-1 peptide occurs
more rapidly (1–5 min of exposure) (33). However, in contrast to PAR-1
or PAR-2 stimulation, MAPK activation in PAR-4 peptide-stimulated
cells was not associated with enhanced COX-2 expression (Fig. 4C)or
6-keto PGF
1
formation (not shown). To explore the role of ERK1/2 and
p38
MAPK
activation in PAR-induced COX-2 expression, we next deter
-
mined the effects of pharmacological blockade of MEK1/2 or p38
MAPK
on COX-2 protein and mRNA levels in HUVEC challenged with throm-
bin and PAR-1- and PAR-2-selective peptides. We have shown previ-
ously that these pharmacological inhibitors block agonist-induced
MAPK activation in HUVEC in a concentration-dependent manner
(24). As shown in Fig. 5, the MEK inhibitors PD98059 (1–10
M) and
U0126 (0.3–3
M) and the p38
MAPK
inhibitor SB203580 (1–10
M)
dose-dependently reduced thrombin-induced, TFLLRN-induced (not
shown), and SLIGKV-induced COX-2 protein expression. A combina-
tion of PD98059 and SB203580 caused a greater reduction in expression
than either inhibitor alone (Fig. 5A). U0126 and SB203580 at maximally
effective concentrations also reduced basal COX-2 mRNA and abol-
ished COX-2 mRNA induction in both thrombin- and SLIGKV-stimu-
lated endothelial cells (Fig. 5C). Blocking COX-2 activity with NS398,
however, did not affect COX-2 protein expression in thrombin-,
TFFLRN-, or SLIGKV-stimulated HUVEC (Fig. 7A). These data show
that, in contrast to COX-2 induction by IL-1
, which is minimally
affected by blockade of the MEK-ERK pathway,
3
COX-2 expression in
HUVEC challenged with PAR agonists is strongly dependent upon both
ERK1/2 and p38
MAPK
activation. They also show that COX-2 induction
by these stimuli is independent of COX-2 activity. To define the MAPK
dependence of COX-2-derived PGI
2
synthesis, we examined the effects
of U0126 and SB202190 on thrombin-, SLIGKV-, and 2F-LIGRLO (not
shown)-induced 6-keto-PGF
1
formation (Fig. 5D). Preexposure to
either inhibitor or to the NF-
B inhibitor PG490 markedly inhibited
3
R. A. Houliston and C. P. D. Wheeler-Jones, manuscript in preparation.
FIGURE 3. Delayed 6-keto-PGF
1
formation in PAR-2 agonist peptide-stimulated HUVEC. Confluent HUVEC monolayers in 24-well tissue culture trays were exposed to thrombin
(1 unit/ml), SLIGKV (100
M), or vehicle control for times ranging between 30 min and 8 h. Supernatants were collected and assayed for 6-keto-PGF
1
, the stable hydrolysis product
of PGI
2
, using radioimmunoassay. The protein contents of whole cell lysates were quantified, and 6-keto PGF
1
formation is expressed as pg/
g protein. Data are presented as
mean S.D. (n 3 separate experiments each with triplicate observations per treatment). **, p 0.001 versus unstimulated control cells (ANOVA). The inset shows the effects of a
30-min pretreatment with either indomethacin (In;1
M) or NS-398 (NS;1
M) on 6-keto-PGF
1
formation basally and after4hofstimulation with thrombin (T; 1 unit/ml) in the
continued presence of inhibitor (mean S.E.; n 3).
PAR-induced COX-2 Expression and Prostanoid Synthesis
11796 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 NUMBER 17 APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
6-keto-PGF
1
generation in response to thrombin or the PAR-2-acti
-
vating peptides.
Role of NF-
B in PAR-mediated Signaling—COX-2 expression in
endothelial cells exposed to a number of proinflammatory or mitogenic
stimuli is known to depend in part upon the activation of NF-
B (34
36). To begin to define the involvement of NF-
B-dependent signaling
events in regulating prostanoid production in response to PAR activa-
tion, we initially assessed nuclear translocation of p65-NF-
B by confo-
cal microscopy. As shown in Fig. 6, a 2-h exposure to either thrombin or
IL-1
, but not the PAR-4 peptide (data not shown), caused a marked
translocation of the p65 subunit of NF-
B from the cytoplasm to the
nucleus. Notably, the PAR-2 peptide 2F-LIGRLO at 10
M also strongly
induced the nuclear translocation of p65-NF-
B. We next examined the
consequences of suppression of NF-
B activity on PAR-induced COX-2
expression. Pretreatment with the NF-
B inhibitor PG490 (25 ng/ml)
abrogated thrombin-stimulated, TFFLRN-stimulated (not shown), and
SLIGKV-stimulated COX-2 protein expression by 70 80% (Fig. 7B)
without modifying basal COX-2 protein or basal COX-2 mRNA levels
FIGURE 4. Thrombin and SLIGKV promote acti-
vation of ERK1/2 and p38
MAPK
. Quiescent
HUVEC monolayers were incubated with throm-
bin (1 unit/ml) or SLIGKV (100
M) for the times
indicated. Whole cell lysates were analyzed by
SDS-PAGE and immunoblotting with phos-
phospecific ERK1/2 (p-ERK1/2)(A) and p38
MAPK
(p-p38) (B) antibodies. Equal protein loading was
confirmed by reprobing stripped blots with anti-
bodies against total (Tot) ERK1/2 and p38
MAPK
.
Densitometric analyses of p-ERK1/2 and
p-p38
MAPK
immunoblots from three separate
experiments are given as mean S.D. *, p 0.05
versus unstimulated control cells. C, HUVEC were
exposed to the PAR-4-selective peptide AYPGKF
(50
M) for the times indicated, and the resulting
blots were probed for phosphorylated p38
MAPK
,
phosphorylated ERK1/2, or COX-2. Data are from a
single experiment representative of two with sim-
ilar results.
PAR-induced COX-2 Expression and Prostanoid Synthesis
APRIL 28, 2006 VOLUME 281 NUMBER 17 JOURNAL OF BIOLOGICAL CHEMISTRY 11797
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
(Fig. 5C). PG490 treatment also reduced PAR-stimulated COX-2
mRNA expression by between 50 and 80% (Fig. 5C) without affecting
expression of the COX-1 isoenzyme (not shown). The proteasome
inhibitor MG-132 also partially inhibited PAR-2-selective peptide-in-
duced as well as thrombin-induced COX-2 expression (Fig. 7C). In
these experiments, 6-keto-PGF
1
generation was also partly reduced by
MG-132 treatment (28 5 and 32 6% inhibition of thrombin- and
SLIGKV-induced release, respectively; mean S.E., n 2– 4 experi-
ments). Further parallel studies showed that sustained 6-keto-PGF
1
formation in response to thrombin, SLIGKV, or 2F-LIGRLO (not
shown) was also inhibited by blockade of NF-
B with PG490 (Fig. 5D).
Together, these results suggest that NF-
B-dependent signaling events
are important for regulating COX-2 expression and PGI
2
synthesis
mediated by PAR-1 and PAR-2 activation.
To further investigate the functional significance of NF-
B activation
in response to PAR stimulation, we examined the effect of thrombin and
PAR-selective peptides on the transcriptional activation of NF-
Bin
HUVEC infected with an adenoviral reporter containing four NF-
B
consensus sequences upstream of luciferase (37). As shown in Fig. 8A,
NF-
B-directed promoter activity was increased by exposure to throm-
bin (1 unit/ml) in a biphasic manner with significant activation observed
at both early (30 min) and late (4 6 h) exposure times. In cells infected
with a control adenovirus, no luciferase activity was observed (data not
shown). Thrombin therefore induces a biphasic activation of NF-
Bin
HUVEC. Thrombin-induced NF-
B activation was also concentration-
dependent (Fig. 8B), with activation detected at 0.01 units/ml and max-
imum at 1 unit/ml. We have previously shown that thrombin-driven
COX-2 expression and PGI
2
synthesis show similar concentration
dependences in thrombin-stimulated HUVEC (12). We next examined
the effects of PAR-1-, PAR-2-, and PAR-4-selective peptides on lucifer-
ase activity in infected endothelial cells (Fig. 8C). The PAR-1 peptide
TFLLRN strongly increased luciferase activity, with a peak evident at 6 h
FIGURE 5. MAPK inhibitors attenuate thrombin-
and SLIGKV-induced COX-2 expression and PGI
2
synthesis. A and B, quiescent HUVEC in 60-mm
2
dishes were preexposed (30 min) to the indicated
concentrations of either PD98059 (PD), SB203580
(SB), U0126 (U0), or a combination of PD98059 and
SB203580 and then exposed to thrombin (1 unit/ml)
or SLIGKV (100
M) for 6 or 4 h, respectively. Proteins
in whole cell lysates were separated by SDS-PAGE
and analyzed by immunoblotting with COX-2 anti-
body. Blots are each representative of results from
three similar independent experiments. C and D,
cells were pretreated (30 min) with SB202190 (10
M), U0126 (1
M), or PG490 (PG; 25 ng/ml) and sub-
sequently exposed to vehicle alone (C), thrombin (T;
1 unit/ml), SLIGKV (100
M), or IL-1
(100 unit/ml) in
the continued absence or presence of inhibitor.
COX-2 mRNA expression was quantified by real time
PCR as described under “Experimental Procedures,”
and 6-keto-PGF
1
formation was quantified by
radioimmunoassay. Data are expressed as mean
S.D. (n 3separate experiments). C,*,p 0.01;#,p
0.0001 versus unstimulated control cells; **, p
0.0001 versus agonist-stimulated cells. D,*,p 0.01
versus agonist-stimulated cells; #, p 0.0001 versus
unstimulated control cells; **, p 0.0001 versus ago-
nist-stimulated or control cells.
PAR-induced COX-2 Expression and Prostanoid Synthesis
11798 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 NUMBER 17 APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
after exposure. SLIGKV, the PAR-2 peptide, also enhanced NF-
B
activity, which was smaller in magnitude than that evoked by thrombin
but was sustained over a longer time period (Fig. 8C). Consistent with its
lack of effect on COX-2 expression and PGI
2
formation (Fig. 4C), the
PAR-4 peptide did not modify luciferase activity (Fig. 8C). To define the
potential involvement of I
B
in mediating PAR-induced NF-
B acti-
vation, luciferase activity induced by thrombin was further analyzed
following co-infection with either a native I
B
-expressing adenovirus
(AdI
B
) or with an adenovirus overexpressing I
B
in which tyrosine
residue 42 was mutated to phenylalanine (AdI
B
Y42F). As depicted in
Fig. 8A, biphasic NF-
B activation by thrombin was inhibited by co-
expression of native I
B
, as was the late phase of activation at 6 h (Fig.
8D). Overexpression of the mutated I
B
also resulted in inhibition of
thrombin-induced NF-
B activation (Fig. 8D). In keeping with the latter
finding, and with the partial inhibition of SLIGKV- and thrombin-in-
duced COX-2 expression by MG-132 (Fig. 7C), we found that expres-
sion of I
B
protein was only marginally reduced in HUVEC exposed to
either thrombin or the PAR-2 peptide SLIGKV (Fig. 9C). Co-infection
of HUVEC with AdNF-
B-Luc and with either of the I
B
viruses
significantly inhibited 6-keto-PGF
1
generation (Fig. 8D). Collectively,
these results suggest that PAR-1- and PAR-2-stimulated NF-
B activa-
tion occurs in an I
B
-dependent manner and that such pathways are
required for PAR-induced COX-2-derived PGI
2
synthesis.
Growing evidence suggests that posttranslational modification of
p65-NF-
B is also required for efficient transactivation of NF-
B-de-
pendent genes (29, 38, 39). We next examined whether phosphorylation
of p65-NF-
B on serine 536 is triggered by activation of PARs on endo-
thelial cells. Incubation with thrombin or the PAR-2 peptide SLIGKV
caused a rapid and sustained increase in p65 phosphorylation without
modifying total p65-NF-
B expression (Fig. 9A). To determine the
relationship between PAR-induced ERK/p38
MAPK
activation and
p65 phosphorylation, HUVEC were preexposed to the NF-
B inhib-
itor PG490, and the phosphorylation state of ERK1/2, p38
MAPK
, and
FIGURE 6. Nuclear translocation of NF-
B in HUVEC following stimulation with
thrombin, PAR-2-selective peptides, and IL-1
. HUVEC were treated with vehicle
(Control), thrombin, the PAR-2-selective peptide 2F-LIGRLO, or IL-1
at the indicated
concentrations for 2 h. Cells were then fixed, permeabilized, and stained with anti-
p65NF-
B antibody followed by incubation with fluorescein isothiocyanate (FITC)-con-
jugated goat anti-rabbit secondary antibody. Nuclei were counterstained with pro-
pidium iodide (PI), and immunofluorescence was monitored by confocal microscopy
(see “Experimental Procedures”). Results in each panel are representative of four sepa-
rate experiments.
FIGURE 7. PAR-induced COX-2 expression is
inhibited by pharmacological blockade of NF-
B.
A, quiescent HUVEC were preexposed for 30 min to
either the NF-
B inhibitor PG490 (25 ng/ml) or the
COX-2-selective inhibitor NS398 (1
M) for 30 min.
Cells were then challenged with vehicle alone (C),
thrombin (T; 1 unit/ml), the PAR-1-selective peptide
TFLLRN (TF; 100
M), SLIGKV (SL; 100
M), or IL-1
(100 units/ml) in the continued absence or presence
of inhibitor for 4 h. Whole cell lysates were prepared,
and COX-1/2 protein levels were determined by
immunoblotting. The immunoblots shown are rep-
resentative of five separate experiments. B, densito-
metric analysis of immunoblotting data from five
individual experiments. Results are presented as
mean S.D. (n 5). C, HUVEC were incubated for 30
min with vehicle or the proteosome inhibitor
MG-132 (1
M) and then stimulated with either
thrombin (1 unit/ml) or SLIGKV (100
M) for 4 h. Data
are from a representative experiment with four
experiments showing similar results. *, p 0.05 ver-
sus expression in unstimulated control cells. #, p
0.05 versus agonist-stimulated expression.
PAR-induced COX-2 Expression and Prostanoid Synthesis
APRIL 28, 2006 VOLUME 281 NUMBER 17 JOURNAL OF BIOLOGICAL CHEMISTRY 11799
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
p65-NF-
B was assessed using phosphospecific antibodies. As shown
in Fig. 9D, blockade of NF-
B activity did not affect thrombin- or
SLIGKV-induced activation of either ERK1/2 or p38
MAPK
. Similarly,
inhibition of MEK with U0126 or of p38
MAPK
with SB202190 did not
modify PAR-2-induced phosphorylation of NF-
B on serine 536 but
partially reduced thrombin-stimulated p65-NF-
B phosphorylation
(Fig. 9E). These results suggest that phosphorylation of p65-NF-
Bon
serine 536 in HUVEC exposed to PAR-2 activators, but not thrombin,
occurs independently of MEK-ERK- or p38
MAPK
-mediated signaling.
DISCUSSION
In the present study, we have demonstrated that in human endothe-
lial cells, thrombin- and PAR-2 agonist peptide-driven COX-2 expres-
sion and sustained PGI
2
synthesis require the activation of ERK1/2 and
p38
MAPK
signaling pathways as well as NF-
B activity. We further show
that PAR-mediated NF-
B activation is accompanied by p65 phospho-
rylation and is dependent upon I
B
. This is the first report to demon-
strate a functional link between PARs and COX-2-derived endothelial
PGI
2
production involving MAPKs and NF-
B pathways.
Thrombin is known to exert its cellular effects through activation of
PAR-1. However, there is some evidence of transactivation of PAR-2
through cleaved PAR-1 (40). In the present study, we observed that
thrombin and PAR-2-selective peptides induced COX-2 expression.
Although it is possible that the up-regulatory effects of thrombin on
COX-2 and on MAPK activation may be partially mediated through
PAR-2 transactivation, the PAR-2-selective peptides employed in the
present study do not activate PAR-1, thus indicating that PAR-2-pep-
tide-induced effects occur predominantly through PAR-2 activation. In
addition, COX-2 up-regulation, as well as MAPK activation and PGI
2
synthesis, was marked by differences in kinetics and magnitude in
FIGURE 8. Thrombin and SLIGKV stimulate transcriptional activity of NF-
B. A, HUVEC were infected with an NF-
B luciferase adenovirus and co-infected with adenovirus
overexpressing native I
B
(AdI
B
) or with empty adenovirus (Ad0) both at MOI 100:1. Cells were subsequently treated with thrombin (1 unit/ml) for the times indicated, and
luciferase activity was quantified as described under “Experimental Procedures.” Data are mean S.D. (n 4) from a single experiment representative of three with similar results.
B, HUVEC infected with NF-
B luciferase adenovirus were exposed to thrombin for4hattheindicated concentrations. Results are given as mean S.E. (n 3 experiments). C, HUVEC
infected with NF-
B luciferase adenovirus (MOI 100:1) were stimulated with PAR-agonist peptides (100
M; PAR-1, TFLLRN; PAR-2, SLIGKV; PAR-4, AYPGKF) for the indicated time
periods. Data are mean S.E. from four individual experiments. Data in D are from thrombin-stimulated HUVEC co-infected with the NF-
B luciferase adenovirus and either the
adenovirus overexpressing I
B
(AdI
B
) or a virus encoding a mutated I
B
(AdI
B
Y42F). Data shown in open columns (left y axis) are expressed as percentage of luciferase activity
observed in thrombin-stimulated, Ad0-infected cells and 6-keto-PGF
1
formation (closed symbols; right y axis) was quantified in parallel by radioimmunoassay. Results are means
S.E. from seven individual experiments. *, p 0.05; ***, p 0.001 versus unstimulated control cells by one-way ANOVA. #, p 0.05; ###, p 0.001 versus Ad0-infected cells by one-way
ANOVA.
PAR-induced COX-2 Expression and Prostanoid Synthesis
11800 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 NUMBER 17 APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
HUVEC exposed to thrombin versus PAR-2-selective peptides.
Whereas these differences may well be explained by a difference in
potency of PAR-1 versus PAR-2 agonists at their receptors, the possibil-
ity that these differences could have functional significance is suggested
by the fact that the PAR-2-selective peptide, unlike thrombin or the
PAR-1-selective peptide, does not promote acute prostanoid synthesis.
This may reflect an inability of PAR-2 agonists to activate acute calcium-
dependent pathways in HUVEC that are required for rapid prostanoid
production (24). Although the ability of thrombin to promote prostan-
oid release in several tissues is well documented, the potential roles of
proteases and their receptors in regulating sustained endothelial cell
PGI
2
synthesis have received little attention, and few reports document
the ability of thrombin to promote prolonged prostanoid production via
COX-2 induction in these cells (12, 39). However, our results are con-
sistent with those of a recent study showing that activated protein C, as
well as thrombin, can induce COX-2 expression in HUVEC through
activation of PAR-1-mediated signaling (42).
Endothelial PGI
2
production in response to thrombin or PAR-2 pep
-
tides occurred with different time courses and to different extents. As
previously reported (12) PGI
2
release in thrombin-stimulated cells was
characterized by an initial rapid increase (principally COX-1-derived)
and a later prolonged and sustained phase lasting several hours. The
extent of inhibition of thrombin-driven PGI
2
release by COX-2 block
-
ade with NS-398 versus that with indomethacin (COX-1/2 inhibitor)
confirms the COX-2 dependence of chronic PAR-induced prostanoid
synthesis as well as the contribution from COX-1 to overall synthesis. In
marked contrast, our present studies with the PAR-2-selective peptide
have shown that SLIGKV does not trigger an acute release of PGI
2
synthesis but that release was only detectable 2– 4 h after peptide expo-
sure and was sustained thereafter. These differential effects of PAR-1
versus PAR-2 activation were concomitant with increased COX-2 pro-
tein levels at the same time points and were not accompanied by
changes in COX-1 expression.
Our present data report an up-regulation of COX-2 and COX-2-
derived PGI
2
synthesis in HUVEC in response to PAR-1 and PAR-2
activation. The observation that PARs are capable of stimulating COX-
2-driven PGI
2
release emphasizes the pathophysiological significance of
PAR-1 and PAR-2 activation by circulating proteases and suggests
that they contribute to the early inflammatory response by tran-
siently increasing COX-2 expression and PGI
2
synthesis. Although
the endogenous ligand(s) responsible for driving COX-2 induction
in HUVEC through PAR-2 activation remain to be defined, our pre-
liminary data indicate that ligands previously identified as PAR-2-
FIGURE 9. Thrombin and SLIGKV promote early
phosphorylation of p65-NF-
B in HUVEC. Cells
were stimulated with vehicle alone (C), thrombin
(T; 1 unit/ml), SLIGKV (SL; 100
M), or IL-1
(100
units/ml) for the times indicated. Proteins in cell
lysates were then separated by SDS-PAGE and
analyzed by immunoblotting with phosphospe-
cific p65-NF-
B or total p65-NF-
B antibodies (A, B
(left), C, and E) or with an antibody raised against
total I
B
(C, right). D, HUVEC were preexposed to
PG490 (25 ng/ml) and then challenged with vehi-
cle alone (C), thrombin (T; 1 units/ml), or SLIGKV
(100
M) for 10 or 30 min in the presence or
absence of PG490. The phosphorylation status of
p65-NF-
B, ERK1/2, and p38
MAPK
were each
assessed by immunoblotting with phosphospe-
cific antibodies. E, cells were preincubated with
vehicle alone (C), SB202190 (SB;1
M), or U0126
(U0;1
M) and then exposed to SLIGKV (100
M)or
thrombin (1 unit/ml) in the continued absence or
presence of inhibitor for the times shown. The
resulting blots were probed with an anti-phos-
pho-p65-NF-
B antibody. Immunoblots in each
panel are representative of two or three individual
experiments.
PAR-induced COX-2 Expression and Prostanoid Synthesis
APRIL 28, 2006 VOLUME 281 NUMBER 17 JOURNAL OF BIOLOGICAL CHEMISTRY 11801
at MRC National Institute for Medical Research, on August 20, 2010www.jbc.orgDownloaded from
selective (e.g. tryptase; trypsin) are capable of enhancing COX-2
expression in HUVEC.
COX-2 induction in the inflammatory setting has largely been con-
sidered deleterious, but relatively less is known about its role under
normal physiological conditions. Our current data, along with our pre-
vious studies (12, 24), have shown that PGI
2
synthesis occurs in resting
unperturbed endothelial cells. Our data also indicate that, under our
experimental culture conditions, unstimulated HUVEC cultures exhibit
variable COX-2 expression. Whereas this could be due at least in part to
serum-stimulated induction, inhibition of basal PGI
2
synthesis by the
COX-2-selective inhibitor NS-398 would support the suggestion that a
component of basal release is COX-2-derived under the conditions of
our experiments. Although there is evidence that human and mouse
arteries express COX-2 ex vivo (43), further studies are required to
unequivocally demonstrate that COX-2 is present in normal endothe-
lium. PAR-2 expression in endothelium and other cells is known to be
strongly induced by proinflammatory stimuli (17), and PAR-2-mediated
events can then exacerbate inflammation-based disease (44). Impor-
tantly, our results clearly show that prostanoid production in response
to PAR-2 activation occurs without the requirement for pretreatment
with a proinflammatory stimulus, suggesting that PAR-2 activation and
its associated signaling events are physiologically relevant components
of transient (and hence resolved) inflammation. The significance of
these findings and the potential protective role of the PAR-COX-2-PGI
2
axis in the vasculature are highlighted by the observations that produc-
tion of circulating PGI
2
is COX-2-dependent (45) and that COX-2-
derived PGI
2
reduces the detrimental vascular remodeling associated
with hemodynamic stress (46). Protective roles for COX-2-derived
mediators have also