ArticlePDF Available

Biodegradation of phenanthrene, spatial distribution of bacterial populations and dioxygenase expression in the mycorrhizosphere of Lolium perenne inoculated with Glomus mosseae

Authors:

Abstract

Interactions between the plant and its microbial communities in the rhizosphere control microbial polycyclic aromatic hydrocarbons (PAH) biodegradation processes. Arbuscular mycorrhizal (AM) fungi can influence plant survival and PAH degradation in polluted soil. This work was aimed at studying the contribution of the mycorrhizosphere to PAH biodegradation in the presence of ryegrass (Lolium perenne L., cv. Barclay) inoculated with Glomus mosseae (BEG 69) by taking into account the structure and activity of bacterial communities, PAH degrading culturable bacteria as a function of the distance from roots. Ryegrass was grown in compartmentalized systems designed to harvest successive sections of rhizosphere in lateral compartments polluted or not with phenanthrene (PHE). Colonization of roots by G. mosseae (BEG 69) modified the structure and density of bacterial populations in the mycorrhizosphere, compared to the rhizosphere of non-mycorrhizal plants. G. mosseae increased the density of culturable heterotrophic and PAH degrading bacteria beyond the immediate rhizosphere in the presence of PHE, and increased the density of PAH degraders in the absence of the pollutant. Biodegradation was not significantly increased in the mycorrhizosphere, compared to control non-mycorrhizal plants, where PHE biodegradation already reached 92% after 6 weeks. However, dioxygenase transcriptional activity was found to be higher in the immediate mycorrhizosphere in the presence of G. mosseae (BEG 69).
Mycorrhiza (2006) 16: 207212
DOI 10.1007/s00572-006-0049-6
SHORT NOTE
S. C. Corgié .F. Fons .T. Beguiristain .C. Leyval
Biodegradation of phenanthrene, spatial distribution of bacterial
populations and dioxygenase expression in the mycorrhizosphere
of
Lolium perenne
inoculated with
Glomus mosseae
Received: 20 June 2005 / Accepted: 30 January 2006 / Published online: 6 April 2006
#Springer-Verlag 2006
Abstract Interactions between the plant and its microbial
communities in the rhizosphere control microbial polycy-
clic aromatic hydrocarbons (PAH) biodegradation pro-
cesses. Arbuscular mycorrhizal (AM) fungi can influence
plant survival and PAH degradation in polluted soil. This
work was aimed at studying the contribution of the
mycorrhizosphere to PAH biodegradation in the presence
of ryegrass (Lolium perenne L., cv. Barclay) inoculated
with Glomus mosseae (BEG 69) by taking into account the
structure and activity of bacterial communities, PAH
degrading culturable bacteria as a function of the distance
from roots. Ryegrass was grown in compartmentalized
systems designed to harvest successive sections of rhizo-
sphere in lateral compartments polluted or not with
phenanthrene (PHE). Colonization of roots by G. mosseae
(BEG 69) modified the structure and density of bacterial
populations in the mycorrhizosphere, compared to the
rhizosphere of non-mycorrhizal plants. G. mosseae in-
creased the density of culturable heterotrophic and PAH
degrading bacteria beyond the immediate rhizosphere in
the presence of PHE, and increased the density of PAH
degraders in the absence of the pollutant. Biodegradation
was not significantly increased in the mycorrhizosphere,
compared to control non-mycorrhizal plants, where PHE
biodegradation already reached 92% after 6 weeks. Howev-
er, dioxygenase transcriptional activity was found to be
higher in the immediate mycorrhizosphere in the presence of
G. mosseae (BEG 69).
Keywords AM fungi .Bacterial community .
Biodegradation .Glomus mosseae .Phenanthrene .
Naphthalene dioxygenase
Introduction
Rhizodegradation applied to Polycyclic Aromatic Hydro-
carbons (PAH) is a recent technology that uses plants to
remedy soils (Anderson and Coats 1994). Rhizodegrada-
tion refers to the capacity of plants to increase PAH
biodegradation (Günther et al. 1996; Liste and Alexander
2000) through rhizosphere effects on soil microbial
communities (Höflich and Günther 2000; Yoshitomi and
Shann 2001). Ubiquitous symbiotic partners such as
arbuscular mycorrhizal (AM) fungi have been considered
in polluted soils for their capacity to physically, chemically,
and biologically influence the rhizosphere (Joner and
Leyval 2003a). AM fungi are beneficial for the growth and
the survival of plants in PAH-polluted soils where they
facilitate plant nutrition and water uptake (Binet et al.
2000).
Although no evidence of direct PAH catabolism by AM
fungi has been reported yet (Criquet et al. 2000), increased
degradation of PAH in the mycorrhizosphere has been
observed in pot experiments with Glomus mosseae (BEG
69) (Binet et al. 2000; Joner and Leyval 2003a,b). Using
phospholipid fatty acid (PLFA) profiles, Joner et al. (2001)
showed that this AM fungus can alter microbial community
structure and suggested that the mycorrhiza-associated
microflora may be responsible for the reduction in PAH
concentration in the mycorrhizosphere. Several studies
have reported that the development of AM can change
bacterial community structure in the rhizosphere (Joner et
al. 2001; Marschner et al. 2001; Marschner and Baumann
2003), and as extra-radical hyphal density can range
between 1 and 30 m per gram of soil (Smith and Read
1997), AM mycelium may have significant effects, not
only on bacterial communities, but also on their biodeg-
radation activities.
S. C. Corgié .F. Fons .T. Beguiristain .C. Leyval (*)
CNRS-UHP Nancy I,
LIMOS (Laboratoire des Interactions Microorganismes-
Minéraux-Matière Organique dans les Sols), UMR 7137,
Faculté des Sciences, B.P.239,
54506 Vandoeuvre-les-Nancy Cédex, France
e-mail: corinne.leyval@limos.uhp-nancy.fr
Tel.: +33-38368-4282
Fax: +33-338368-4284
Present address:
S. C. Corgié
Biological and Environmental Engineering, Cornell University,
Ithaca, NY 14853, USA
By nature, the rhizosphere has a complex ecology with
numerous feedback loops that regulate microbial popula-
tions (Toal et al. 2000), and interactions between the plant
and its microflora control the fate and degradation of
organic contaminants. Root exudation, water, and nutrient
fluxes create quantitative and qualitative spatial gradients
that affect microbial populations (Fang et al. 2001; Butler
et al. 2003). Using compartmentalized systems, it was
previously shown that PAH biodegradation in the rhizo-
sphere of ryegrass is clearly a function of the distance from
roots (Corgié et al. 2003), with increased PHE degradation
observed in the immediate proximity of roots and degra-
dation diminishing with increasing distance from them.
Furthermore, bacterial densities and community structure
changed with distance from roots in polluted and
unpolluted rhizosphere (Corgié et al. 2004). Compartmen-
talized systems permit an accurate description of rhizo-
sphere spatial dimensions of microbial populations, and
although this approach simplifies to some extent rhizo-
sphere ecology, compared to real soil environments, they
allow easy manipulation of the ecosystem complexity.
In the present study, we have increased the biocomplex-
ity of the system used by Corgié et al. (2004)by
introducing the AM fungus, Glomus mosseae (BEG 69),
as an additional actor in the rhizosphere ecosystem during
the biodegradation processes. To evaluate the impact of the
resulting mycorrhizosphere, we have compared: (1) the
extent of the rhizosphere and the mycorrhizosphere as a
function of distance to roots, (2) bacterial communities
(density, structure, and activities) in a polluted rhizosphere
and mycorrhizosphere, and (3) the resulting effect of G.
mosseae colonization on PHE degradation and on bacterial
catabolism activity measured as the quantity and transcrip-
tional expression of a naphthalene1,2 dioxygenase gene
(NDO), known to perform the primary and limiting step for
oxidation of PAH in bacterial metabolism (Buchan et al.
2001; Story et al. 2000).
Materials and methods
Experimental system
Compartmentalized systems, as previously described by
Corgié et al. (2003), were made with a T-shape PVC tube
forming a vertical root compartment (3.5 cm diameter,
250 cm
3
). Two horizontal compartments (3.5 cm diameter,
30 cm
3
) were inserted at the bottom of the vertical one. The
vertical compartment was connected through a mesh to a
reservoir of sterile nutrient solution (1 mM NH
4
NO
3
,1mM
Ca(NO
3
)
2
, 1 mM Na
2
HPO
4
2H
2
O, 1 mM K
2
SO
4
,
0.75 mM MgSO
4
7H
2
O, 12.5 μMH
3
BO
3
, 2.5 μM
MnSO
4
H
2
O, 0.3 μM CuSO
4
5H
2
O, 1 μM ZnSO
4
7H
2
O,
0.05 μMNa
2
MoO
4
2H
2
O, 0.2 μM CoSO
4
7H
2
O, 20 μM
Fe-EDTA; pH 6) that was refreshed on a weekly basis. To
restrict root entry, the lateral compartments were separated
from the central compartment by a 37-μm nylon mesh.
Two hundred spores of Glomus mosseae Gerd. & Trappe
(BEG 69) (Weissenhorn et al. 1993) were inoculated during
the transplantation of a 2-week-old seedling of ryegrass
(Lolium perenne L. cv. Barclay) in the central compart-
ment. G. mosseae BEG 69 was previously shown to
improve plant growth in the presence of PAH (Binet et al.
2000) and to increase their disappearance in the rhizo-
sphere (Joner and Leyval 2003b). Devices were pre-
incubated for 2 weeks in a growth chamber (24/20°C day/
night, 16-h light period, 60% RH, 300350 mmol m
2
s
1
PAR) with lateral compartments containing sterile washed
sand and saturated with sterile nutrient solution. Fresh
lateral compartments containing polluted (500 mg kg
1
phenanthrene) or unpolluted inoculated sand were then
inserted in the central compartment.
The microbial inoculum (final concentration of 10
5
bacteria per gram sand) was prepared as described by
Corgié et al. (2003) from a PAH contaminated soil from the
North of France (Joner et al. 2002). Five treatments (four
replicates each) were performed: non-planted treatments
with phenanthrene in the lateral compartments (no plant);
planted pots without phenanthrene and inoculated (PHE-
myc+) or not (PHE-myc) with G. mosseae BEG 69;
planted pots containing phenanthrene in the lateral
compartments and inoculated (PHE+myc+) or not (PHE
+myc) with the AM fungus. After 6 weeks, lateral
compartments were harvested in consecutive sections of
5 mm each. The sections 05 mm, 1015 mm, and 20
25 mm were kept for analysis. One gram was frozen at
80°C before molecular analysis, 2 g were air-dried for
PHE analysis, and 1 g was immediately used for bacterial
enumeration.
PAH quantification
Extraction and quantification of remaining phenanthrene
were performed at the IFA (Institute for Agrobiotechnol-
ogy, Tulnn, Austria) on 2 g of dried samples from the
lateral compartment. Phenanthrene was extracted with an
automated Soxhlet extractor (Gerherdt Soxtherm extractor,
model 2000 automatic, Bonn, Germany) according to Rost
et al. (2002) and quantified by HPLC (Hewlett Packard)
coupled with a HP 1100 series three-dimensional fluores-
cence detector (Hewlett Packard).
Microbial analysis
Hyphal length was measured by flotation using the
intersection method on a membrane filter (Jakobsen et al.
1992). The results were expressed in meters of mycelium
per gram (dry weight) of sand. The density of culturable
heterotrophic bacteria (enumerated on Nutrient Broth),
including PAH degrading bacteria (enumerated on a
mixture of 4 PAH as sole source of C), was quantified
with an enumeration procedure in microplates (Corgié et al.
2003), and the results were expressed as the most probable
number (MPN) per gram of dry sand. Total DNA and total
RNA were isolated from 1 g of sand (Corgié et al. 2004).
The partial sequence of the 16S gene (V6V8) was
208
amplified by PCR using the bacterial universal primers
968f and 1401r (Heuer et al. 1999) as described by Corgié
et al. (2004). Analysis of bacterial community structure
was performed by TTGE (Dcode, Biorad) on polyacryl-
amide gel [6% (wt/vol) acrylamide, 0.21% (wt/vol)
bisacrylamide, 8 M urea, 1.25×TAE and 0.2% (vol/vol)
glycerol] at a constant voltage (100 V), with a temperature
gradient from 57 to 67°C and an increment of 0.7°C per
hour (Corgié et al. 2004).
Quantification of the Rieske [2Fe2S] gene
of the naphthalene1,2 dioxygenase
The Rieske [2Fe2S] protein (Takizawa et al. 1994) is the
active site of naphthalene1,2 dioxygenase (NDO), the
sequence of which is highly conserved among the PAH
dioxygenase family (Buchan et al. 2001). The protein
sequence of the bacterial naphthalene dioxygenase (ref-
erence 1.14.12.12, Ligand database, Institute for Chemical
Research, Kyoto University, Japan, http://www.genome.
ad.jp/) was used to determine the sequence of the active site
of the enzyme [protein Rieske (2Fe2S)]. Alignments of
the target sequence (EMBL-EBI, Cambridge College, U.
K., http://www.ebi.ac.uk/embl/) were performed with
Blastn software on the Genbank database to determine
the most conserved region (Pseudomonas putida, position
104-369): 5-GGTTTCGTTTGCAGTTATCACGGCTGG
GGCTTCGGCTCCAACGGCGAACTGCAGAGCGTTC
CATTCGAAAAAGAGCTGTACGGCGAGTCGCTCAAC
AAAAAATGTCTGGGGTTGAAAGAAGTCGCTCGCGT
AGAGAGCTTCCATGGGTTCATCTATGCCTGCATCGA
TCAGGAGGCCCCTTCTCTTATGGACTATCTCGGTGA
CGCTGCTTGGTACCTGGAACCCATCTTCAAACATTCA
GGCGGTTTAGAACTGGTAGGCCCTCC-3.
Two primers (NDO265scf: GGTTTCGTTTGCAGTTAT
CA and NDO265scr: ATCTTGACCATCCGGGAGG) were
designed to amplify the sequence from a reference PAH
degrading bacterial strain (Pseudomonas putida, strain 8063
DSMZ). The PCR mix consisted in 50 mM buffer, 3 mM
MgCl2, 0.2 mM dNTP, 1.2 mM of each primer, and 2U taq
polymerase (Fastart, RocheDiagnostic). The probe (265 bp
expected) was amplified from P. p u t i d a (strain 8063 DSMZ)
with an iCycler (Biorad) using the following amplification
program: 94°C for 5 min (1 cycle), 94°C for 30 s, 56°C for
30 s, 72°C for 30 s (35 cycles), and 72°C for 5 min (1 cycle).
The purified probe was coupled with an alkaline phospha-
tase using the Gene Image Alkphos Direct labeling
(Amersham Biosciences), according to the manufacturers
instructions, and stored at 20°C in 50% glycerol.
Reverse transcriptions were performed on crude extracts
of nucleic acids. For each reaction, 8 μl of extracts were
incubated for 30 min at 37°C with DNAse (RQ1 RNAse-
free DNAse, Promega) in buffer plus inhibitors of RNAse
(Recombinant Rnasin Ribonuclease Inhibitor, Promega).
One microliter of STOP DNAse was added into each tube
and the samples were incubated for 15 min at 70°C, then
chilled on ice for 10 min. Reverse transcription was
immediately performed with the Reverse Transcription
System (Promega) with 11 μl of nucleic acid crude extract
DNA-free to a final volume of 21 μl (1× buffer, 2.5 mM
MgCl
2
, 1 mM of each dNTP, 1 U/μl of Recombinant
Rnasin Ribonuclease Inhibitor, 1.5 U/μl AMV Reverse
Transcriptase, 25 ng/μl random primer).
Reverse transcription was performed with an iCycler
(Biorad) using the following program: 10 min at 24°C,
60 min at 42°C, 5 min at 95°C, and, finally, 5 min at 4°C.
DNA sample (20 μl) or cDNA sample (10 μl) were mixed
with 10 μl of 20× SSC buffer and completed with water to
a final volume of 100 μl. Samples were incubated for 5 min
in boiling water, chilled on ice, and transferred to the
blotting membrane (Hybond-N+, Amersham Biosciences)
with a transfer cassette (48 wells, PR 648, Amersham
Biosciences). Membranes were incubated at 80°C for 2 h.
The hybridization procedure was performed according
to manufacturers instructions with 10 ng of labeled probe
per milliliter of hybridization buffer at 55°C overnight.
Detection of hybridized NDO265 probe was performed
with the Chemiluminescent CDP-Star Kit (Amersham
Biosciences), and luminescence was revealed on a
photographic film (HyperfilmTM, ECLTM, Kodak) ex-
posed for 2 h to DNA blots and 12 h for cDNA blots. Films
were developed, scanned and intensity of the hybridized
probe signal was quantified using the Kodak 1D 3.5.2.
software. The quantity of NDO265 DNA or cDNA was
calculated comparatively to standards and expressed in
femtogram per gram of sand (dry weight).
Statistical analysis
Analysis of variance (StatView) was performed on micro-
bial numbers and PHE concentration. Principal component
analyses were performed on relative band intensity from
TTGE profiles (Corgié et al. 2004), and analysis of
variance was made on coordination plots. Non-parametric
tests were performed on quantities of NDO hybridized with
crude DNA or cDNA from reverse transcript mRNA.
Results and discussion
The use of compartmentalized systems allows studies of
the spatial distribution of rhizosphere communities and
activities. When ryegrass plants were inoculated with G.
mosseae (BEG 69), hyphal length in lateral compartments
was similar (approximately 3.7 (±1.1) m g
1
sand) in the
presence or absence of PHE, but was significantly higher
(P=0.05) in the section between 0 and 5 mm, where hyphal
density reached 4.9 (±1.8) m g
1
sand. No hyphae were
detected in non-inoculated treatments. Jakobsen et al.
(1992) showed that hyphal density could extend up to
11 cm in compartmentalized systems and decreased with
distance to roots.
Bacterial community structure, compared using PCA
analysis based on relative species abundances from TTGE
gels (Fig. 1), showed variations arising from the presence
of G. mosseae, the presence of PAH, and the distance from
209
roots. The first component (51% of total variance)
separated the treatments as a function of distance from
roots and the presence/absence of G. mosseae. The second
component (32% of total variance) corresponded to the
presence/absence of PHE. Community structures in the
sections farthest from roots, at 1015 mm and 2025 mm,
were always close, and they were similar to the one of the
non-planted treatment in the PHE+myctreatment. How-
ever, both were always significantly different (P=0.05)
from those observed closest to the roots (05 mm) and
which varied between treatments (Fig. 1). These results
concur with those from previous experiments with similar
compartmentalized systems of non-mycorrhizal plants,
where bacterial community structures were shown to
vary up to 9 mm from roots (Corgié et al. 2004). Treatment
with PHE appeared to consistently affect bacterial com-
munities in sections farthest from roots.
The presence of G. mosseae (BEG 69) modified the
structure of bacterial communities in both PAH-polluted
and non-polluted sand. Changes in bacterial community
structure in rhizospheres colonized by AM fungi have
already been reported (Joner et al. 2001; Marschner et al.
2001; Marschner and Baumann 2003). Without PHE, the
communities of non-mycorrhizal and mycorrhizal plants
were clearly different, coordinated in the left and the right
of the PCA plot, respectively (Fig. 1), suggesting that
microbial communities were selected by the presence of G.
mosseae.
Colonization of the lateral compartment by G. mosseae
(BEG 69) increased the number of culturable heterotroph
and PAH degrading bacteria up to 25 mm from the root mat
in the presence of PHE (Table 1). In the PHE+myc+
treatment, heterotroph and PAH degrader densities were
also higher at 1015 and 2025 mm from the root
compartment, compared to non-mycorrhizal plants (PHE
+myc). Without phenanthrene, G. mosseae increased the
number of PAH degraders at all distances from roots,
compared to the non-mycorrhizal treatment. The quantity
of NDO265 probe hybridizing to the crude DNA was
always higher for the treatments with PHE (Table 1),
especially for the sections 05 and 1015 mm of the PHE
+myctreatment. In the PHE+myc+ treatment, quantities
were similar to the ones of the non-planted treatment. The
quantity of NDO transcripts (cDNA) was higher in the first
section of the PHE+myc+ treatment and represented
approximately 47% of the quantity of genomic DNA,
indicating that after 6 weeks, the NDO gene was highly
expressed in that particular zone of the mycorrhizosphere.
Naphthalene1,2 dioxygenase is a α3β3 hexamer protein
in which each subunit contains a (2Fe2S) cluster (Colbert
et al. 2000). The probe hybridizes with the pahAc gene
(position 5578-5843, Pseudomonas putida) coding for the
iron sulphur protein large subunit, part of the active site of
the enzyme. This sequence is highly conserved in the PAH
dioxygenase family, and the enzyme is involved in
bacterial degradation pathway of PAH, including PHE
(Buchan et al. 2001; Story et al. 2000). The quantity of
NDO gene increased in the presence of PHE, especially in
the sections 05 and 1015 mm of the PHE+myc+
treatment. However, here the quantity of NDO transcripts
reached only 3% of the NDO gene.
A significant gradient of PHE biodegradation was
observed for the planted treatments (PHE+myc, PHE+
myc+) (Table 1). In the presence of G. mosseae, PHE
-1
-0.8
-0.6
-0.4
-0.2
0
0.2
0.4
0.6
0.8
1
0 0.2 0.4 0.6 0.8 1
C1 (51% of total variance)
C2 (32% of total variance)
PHE-myc- (0-5 mm)
PHE-myc- (10-15 mm)
PHE-myc- (20-25 mm)
PHE-myc+ (0-5 mm)
PHE-myc+ (10-15 mm)
PHE-myc+ (20-25 mm)
PHE+myc- (0-5 mm)
PHE+myc- (10-15 mm)
PHE+myc- (20-25 mm)
PHE+myc+ (0-5 mm)
PHE+myc+(10-15 mm)
PHE+myc+ (20-25 mm)
No plant
Fig. 1 PCA analysis of relative specie abundance of TTGE analysis. Data points represent the mean coordinate values (n=4) of
corresponding sections within each treatment; bars are SEM
210
biodegradation was the highest in the first (05 mm) and
last (2025 mm) sections of the hyphal compartment.
However, biodegradation was not significantly different in
the presence or absence of G. mosseae for these sections,
and was even lower in the 1015-mm section, compared to
the non-mycorrhizal plants (Table 1). Although Glomus
mosseae BEG 69 has been previously reported to increase
PHE degradation in the mycorrhizosphere (Binet et al.
2000; Joner and Leyval 2003b), degradation was not
improved in the hyphal compartment in our experimental
conditions. In pot experiments using industrial contami-
nated soils, Joner and Leyval (2003b) observed a region of
the rhizosphere in which PAH dissipation was lower, or
even nil, compared to bulk soils; however, this inhibition
did not occur in the presence of an AM fungus in their
study. In the present study, high degradation already by
control non-mycorrhizal plants (92% in 6 weeks) may have
prevented mycorrhiza from giving any further significant
effect on biodegradation.
No correlation was observed between the numbers of
heterotrophs and PAH degraders and the quantity of NDO
from DNA or RNA analysis. As dioxygenase enzymes are
involved in the early steps of PAH catabolism, NDO
transcription should have been higher at the beginning of
the experiment (Wilson et al. 1999) than at the end when 70
to 90% of PHE was degraded. Also, NDO expression was
increased closest to roots in the presence of G. mosseae
BEG 69. NDO transcription may not be directly related to
PHE biodegradation as other enzymes, often linked to
phthalate and catechol degradation (Ringelberg et al. 2001;
Sei et al. 1999), are involved in the complete mineralization
of PAH.
An extensive study of genes coding PAH degrading
enzymes should be undertaken to identify bacterial cata-
bolic activities in the rhizosphere (Buchan et al. 2001) and
mycorrhizosphere.
Interactions between AM fungi and rhizosphere bacteria
in compartment systems with restricted carbon sources
(root exudates and PHE) may also contribute to the lower
degradation of PAH in the rhizosphere of mycorrhizal
plants. Competition for water and mineral nutrients
between roots and soil microorganisms (George et al.
1992; Kaye and Hart 1997), or modification of root
exudation by mycorrhizal roots (Laheurte et al. 1990;
Azaizeh et al. 1995), may also be limiting factors to
biodegradation. Vazquez et al. (2000) showed that bacterial
activities could be affected by AM fungi and Olsson et al.
(1996) attributed the reduction of bacterial activity to
inhibitory compounds produced by ectomycorrhiza. AM
fungi are not known to have direct biodegrading activities
compared to saprophytes such as the white rot fungus
(Bezalel et al. 1996; Zheng and Obbard 2000).
In conclusion, G. mosseae BEG 69 PAH increased
degrading bacterial populations and the expression of the
naphthalene dioxygenase gene in the mycorrhizosphere of
ryegrass. However, extra-radical hyphae had no significant
effect on PHE biodegradation compared to non-mycor-
rhizal root exudates in the present experimental conditions.
Further studies should focus on effects of other environ-
mental parameters controlling PAH biodegradation such as
nutrients levels, soil carbon content, or the initial
composition of bacterial communities. The compartmental-
ized system used here could be useful for screening dif-
ferent AM fungi in pure culture or mixed communities, and
understanding of the biodegradation processes and effec-
tiveness of bacterial communities in the mycorrhizosphere.
Acknowledgements The authors give special thanks to Pr. Andreas
Loibner and Dr. Helmut Rost from the IFA, Institute for
Agrobiotechnology (Tulnn, Austria) for PAH analysis.
Table 1 Number of culturable heterotrophic bacteria, PAH degrading bacteria per gram of sand, quantity (fg g
1
sand) of probe NDO265
hybridized to DNA and cDNA, and PHE biodegradation (% of initial value and standard deviation)
Sections Heterotroph bacteria
(per g sand)
PAH degrading bacteria
(per g sand)
NDO (DNA)
fg g
1
sand
NDO (cDNA)
fg g
1
sand
PHE biodegradation
Percentage (±) SD
No plant 1.25 10
7
(c) 7.07 10
5
(c) 9.35 10
3
(b) 76.92 (c) 5.32
PHE-myc05 mm 6.31 10
7
(b) 6.76 10
3
(e) 3.41 10
3
(c) 2.65 10
3
(b)
1015 mm 1.90 10
6
(e) 4.07 10
2
(f) 5.38 10
3
(c) 1.85 10
3
(b)
2025 mm 2.05 10
6
(e) 4.57 10
2
(f) 3.20 10
3
(c) 1.02 10
3
(b)
PHE-myc+ 05 mm 2.09 10
7
(b) 6.45 10
5
(c) 6.58 10
3
(c) 2.00 10
3
(b)
1015 mm 3.74 10
6
(e) 1.69 10
4
(d) 4.69 10
3
(c) 2.77 10
2
(c)
2025 mm 5.75 10
6
(d) 5.88 104(d) 3.25 10
3
(c) 1.82 10
3
(b)
PHE+myc05 mm 8.12 10
7
(a) 8.71 10
6
(a) 7.83 10
4
(a) 2.41 10
3
(b) 92.95 (a) 0.93
1015 mm 1.03 10
7
(c) 7.41 10
5
(c) 6.68 10
4
(a) 3.08 10
3
(b) 82.12 (b) 4.31
2025 mm 8.75 10
6
(c) 5.75 10
5
(c) 1.37 10
4
(b) 2.33 10
3
(b) 77.36 (c) 5.34
PHE+myc+ 05 mm 1.69 10
8
(a) 3.09 10
7
(a) 1.11 10
4
(b) 5.23 10
3
(a) 92.69 (a) 4.04
1015 mm 3.02 10
7
(b) 3.54 10
6
(b) 1.06 10
4
(b) 1.95 10
3
(b) 75.84 (c) 5.09
2025 mm 5.20 10
7
(b) 3.09 10
6
(b) 1.29 10
4
(b) 1.36 10
3
(b) 73.43 (c) 5.94
Values followed by the same letter within a column are not significantly different (p>0.05, n=4 for bacterial counts and PHE biodegradation,
n=3 for NDO quantifications)
211
References
Anderson TA, Coats JR (eds) (1994) Bioremediation through
rhizosphere technology. ACS symposium series, American
Chemical Society New York, p 225
Azaizeh HA, Marschner H, Romheld V, Wittenmayer L (1995)
Effects of a vesiculararbuscular mycorrhizal fungus and other
soil microorganisms on growth, mineral nutrient acquisition
and root exudation of soil-grown maize plants. Mycorrhiza
5:321327
Bezalel L, Hadar Y, Fu PP, Freeman JP, Cerniglia CE (1996) Initial
oxidation products in the metabolism of pyrene, anthracene,
fluorene, and dibenzothiophene by the white rot fungus
Pleurotus ostreatus. Appl Environ Microbiol 62:25542559
Binet P, Portal JM, Leyval C (2000) Fate of polycyclic aromatic
hydrocarbons (PAH) in the rhizosphere and mycorrhizosphere
of ryegrass. Plant Soil 227:207213
Buchan A, Neidle EL, Moran MA (2001) Diversity of the ring-
cleaving dioxygenase gene pcah in a salt marsh bacterial
community. Appl Environ Microbiol 67:58015809
Butler JL, Williams MA, Bottomley PJ, Myrold DD (2003)
Microbial community dynamics associated with rhizosphere
carbon flow. Appl Environ Microbiol 69:67936800
Colbert CL, Couture MM-J, Eltis LD, Bolin JT (2000) A cluster
exposed structure of the rieske ferredoxin from biphenyl
dioxygenase and the redox properties of rieske FeS proteins.
Structure (Lond) 8:12671278
Corgié SC, Joner E, Leyval C (2003) Rhizospheric degradation of
phenanthrene is a function of proximity to roots. Plant Soil
257:143150
Corgié SC, Beguiristain T, Leyval C (2004) Spatial distribution of
bacterial communities and phenanthrene (PHE) degradation in
the rhizosphere of Lolium perenne l. Appl Environ Microbiol
70:35523557
Criquet S, Joner EJ, Leglize P, Leyval C (2000) Antracene and
mycorrhiza affect the activity of oxidoreductases in the roots
and rhizosphere of lucerne (Medicago sativa L.). Biotechnol
Lett 22:17331737
Fang C, Radosevich M, Fuhrmann JJ (2001) Characterization of
rhizosphere microbial community structure in five similar grass
species using fame and biolog analyses. Soil Biol Biochem
33:679682
George E, Haussler KU, Vetterlein D, Gorgus E, Marschner H
(1992) Water and nutrient translocation by hyphae of Glomus
mosseae. Can J Bot 70:21302137
Günther T, Dornberger U, Fritsche W (1996) Effects of ryegrass on
biodegradation of hydrocarbons in soil. Chemosphere 33:203
215
Heuer H, Hartung K, Wieland G, Kramer I, Smalla K (1999)
Polynucleotide probes that target a hypervariable region of 16S
rRNA genes to identify bacterial isolates corresponding to
bands of community fingerprints. Appl Environ Microbiol
65:10451049
Höflich G, Günther T (2000) Effect of plant-rhizosphere microor-
ganism-associations on the degradation of polycyclic aromatic
hydrocarbons in soil. Die Dodenkultur 51:9197
Jakobsen I, Abbott LK, Robson AD (1992) External hyphae of
vesiculararbuscular mycorrhizal fungi associated with trifo-
lium subterraneum l. 2. Hyphal transport of
32
P over defined
distances. New Phytol 120:509516
Joner EJ, Leyval C (2003a) Rhizosphere gradients of polycyclic
aromatic hydrocarbon (PAH) dissipation in two industrial soils
and the impact of arbuscular mycorrhiza. Environ Sci Technol
37:23712375
Joner E, Leyval C (2003b) Phytoremediation of organic pollutants
using mycorrizal plants: a new aspect of rhizosphere interac-
tions. Agronomie 23:495502
Joner EJ, Johansen A, Loibner AP, de la Cruz MA, Szolar OH,
Portal JM, Leyval C (2001) Rhizosphere effects on microbial
community structure and dissipation and toxicity of polycyclic
aromatic hydrocarbons (PAHs) in spiked soil. Environ Sci
Technol 35:27732777
Joner EJ, Corgie SC, Amellal N, Leyval C (2002) Nutritional
constraints to degradation of polycyclic aromatic hydrocarbons
in a simulated rhizosphere. Soil Biol Biochem 34:859864
Kaye JP, Hart SC (1997) Competition for nitrogen between plants
and soil microoganisms. Tree 12:139143
Laheurte F, Leyval C, Berthelin J (1990) Root exudates of maize,
pine and beech seedlings influenced by mycorrhizal and
bacterial inoculation. Symbiosis 9:111116
Liste HH, Alexander M (2000) Plant-promoted pyrene degradation
in soil. Chemosphere 40:710
Marschner P, Baumann K (2003) Changes in bacterial community
structure induced by mycorrhizal colonisation in spilt-root
maize. Plant Soil 251:279289
Marschner P, Crowley DE, Lieberei R (2001) Arbuscular mycor-
rhizal infection changes the bacterial 16S rDNA community
composition in the rhizosphere of maize. Mycorrhiza 11:297
302
Olsson PA, Chalot M, Baath E, Finlay RD, Soderstrom B (1996)
Ectomycorrhizal mycelia reduce bacterial activity in a sandy
soil. FEMS Microbiol Ecol 21:7786
Ringelberg DB, Talley JW, Perkins EJ, Tucker SG, Luthy RG,
Bouwer EJ, Fredrickson HL (2001) Succession of phenotypic,
genotypic, and metabolic community characteristics during in
vitro bioslurry treatment of polycyclic aromatic hydrocarbon-
contaminated sediments. Appl Environ Microbiol 67:1542
1550
Rost H, Loibner AP, Hasinger M, Braun R, Szolar OHJ (2002)
Behavior of PAHs during cold storage of historically
contaminated soil samples. Chemosphere 49:12391246
Sei K, Asano K-I, Tateishi N, Mori K, Ike M, Fujita M (1999)
Design of PCR primers and gene probes for the general
detection of bacterial populations capable of degrading aro-
matic compounds via catechol cleavage pathways. J Biosci
Bioeng 88:542550
Smith SE, Read DJ (eds) (1997) Mycorrhizal symbiosis, second
edition. Harcourt Brace, Cambridge, p 605
Story SP, Parker SH, Kline JD, Tzeng T-RJ, Mueller JG, Kline EL
(2000) Identification of four structural genes and two putative
promoters necessary for utilization of phenanthrene, naphtha-
lene, fluoranthene, and by Sphingomonas paucimobilis var.
Epa505. Gene 260:155160
Takizawa N, Kaida N, Torigoe S, Moritani T, Sawada T, Satoh S,
Kiyohara H (1994) Identification and characterization of genes
encoding polycyclic aromatic hydrocarbon dioxygenase and
polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in
Pseudomonas putida ous82. J Bact 176:24442449
Toal ME, Yeomans C, Killham K, Meharg AA (2000) A review of
rhizosphere carbon flow modeling. Plant Soil 222:263281
Vazquez MM, Cesar S, Azcon R, Barea JM (2000) Interactions
between arbuscular mycorrhizal fungi and other microbial
inoculants (azospirillum, pseudomonas, trichoderma) and their
effects on microbial population and enzyme activities in the
rhizosphere of maize plants. Appl Soil Ecol 15:261272
Weissenhorn I, Leyval C, Berthelin J (1993) Cd-tolerant arbuscular
mycorrhizal (AM) fungi from heavy-metal polluted soils. Plant
Soil 157:247256
Wilson MS, Bakermans C, Madsen EL (1999) In situ, real-time
catabolic gene expression: extraction and characterization of
naphthalene dioxygenase mRNA transcripts from groundwater.
Appl Environ Microbiol 65:8087
Yoshitomi KJ, Shann JR (2001) Corn (Zea mays L.) root exudates
and their impact on 14c-pyrene mineralization. Soil Biol
Biochem 33:17691776
Zheng Z, Obbard JP (2000) Removal of polycyclic aromatic
hydrocarbons from soil using surfactant and the white rot
fungus Phanerochaete chrysosporium. J Chem Tech Biotech
75:1831189
212
... Since then, a higher fungal count and an increase of bacterial and archaeal numbers, richness, and diversities in PAHs, PBDEs, dioxins/furans and PCBspolluted soils were determined in link with the POPs dissipation in the mycorrhizosphere (Meglouli et al., 2018;Qin et al., 2014;Teng et al., 2010;Wang et al., 2011). As well, in the presence of PAHs and petroleum, an increase in the population of specific PAHs-and hydrocarbon-degrading bacteria was measured in the mycorrhizosphere in comparison with the rhizosphere of non-colonized ones (Corgié et al., 2006;Małachowska-Jutsz and Kalka, 2010;Małachowska-Jutsz et al., 2011). For example, Qin et al. (2014) found that the association of zucchini with AMF as Acaulospora laevis or F. mosseae increased the dissipation of PCBs, both in bulk and rhizosphere soils. ...
... the nature, the concentration and the bioavaibility of POPs in soil(Alarcón et al., 2006;Aranda et al., 2013;Cheung et al., 2008;Ren et al., 2017;Wu, N. et al., 2008a;Yu et al., 2011), (3) the duration of the culture as well as the culture conditions(Gao et al., 2011; Leyval, 2001, 2003a;Liu et al., 2004), (4) the analysis of pollutants in the rhizosphere or the bulk soil(Joner and Leyval, 2003a;Wu, N. et al., 2008a), and (5) the ability of the polluted soil microbiome to metabolise POPs(Chiapusio et al., 2007;Corgié et al., 2006;Joner and Leyval, 2003b;Wang et al., 2011). ...
Chapter
Amongst the methods developed to clean-up contaminated soils, arbuscular mycorrhizal fungi (AMF)-assisted phytoremediation is an emerging eco-sustainable technique to control and manage soil pollution. AMF are known to improve growth and mineral uptake of plants, but also these fungi can mitigate pollutant toxicity, increasing plant tolerance to abiotic stresses, and so allowing their better installation on polluted soils. They influence the pollutant fate in the rhizosphere through several phytotechnologies: phyto/rhizodegradation, phytostabilisation and phytoextraction. To improve phytomanagement efficiency, plant inoculation with AMF could be proposed as an interesting solution. Through this chapter, we tried to present a description of the AMF diversity as well as in persistent organic pollutants and trace elements-polluted soils and summarize current knowledge of AMF contribution in phytomanagement of contaminated soils and the impact of mycorrhizal inoculation on soil refunctionalisation. In conclusion, recommandations for AMF-assisted phytotechnologies adoption in polluted soil phytomanagement will be suggested.
... Especially in contaminated environments, AMF have been reported to improve plant growth and tolerance to metallic contamination. Many studies have been performed using Funneliformis mosseae (previously Glomus mosseae), a globally widespread vesicular-arbuscular mycorrhizal fungus, and on different isolates, some isolated from contaminated soils (Joner and Leyval 2001a;Tonin et al. 2001;Corgié et al. 2006;Hu et al. 2020b). Many studies have shown that plants such as clover and maize growing in zinc (Zn)-, cadmium (Cd)-, and copper (Cu)-contaminated soils are larger when inoculated with F. mosseae Leyval 1997, 2001b;Joner et al. 2004;Vogel-Mikuš et al. 2006;Dupré de Boulois et al. 2008) than when not mycorrhizal. ...
Full-text available
Article
Rare earth elements (REEs) are widely used in high-tech industries, and REE waste emissions have become a concern for ecosystems, food quality and human beings. Arbuscular mycorrhizal fungi (AMF) have repeatedly been reported to alleviate plant stress in metal-contaminated soils. To date, little information is available concerning the role of AMF in REE-contaminated soils. We recently showed that there was no transfer of Sm to alfalfa by Funneliformis mosseae, but only a single REE was examined, while light and heavy REEs are present in contaminated soils. To understand the role of AMF on the transfer of REEs to plants, we carried out an experiment using alfalfa (Medicago sativa) and ryegrass (Lolium perenne) in compartmented pots with separate bottom compartments that only were accessible by F. mosseae fungal hyphae. The bottom compartments contained a mixture of four REEs at equal concentrations (La, Ce, Sm and Yb). The concentration of REEs in plants was higher in roots than in shoots with higher REE soil–root than root–shoot transfer factors. Moreover, significantly higher light-REEs La and Ce were transferred to ryegrass shoots than Sm and the heavy-REE Yb, but this was not observed for alfalfa. Alfalfa dry weight was significantly increased by F. mosseae inoculation, but not ryegrass dry weight. For both plant species, there was significantly higher P uptake by the mycorrhizal plants than the nonmycorrhizal plants, but there was no significant transfer of La, Ce, Sm or Yb to alfalfa and ryegrass roots or shoots due to F. mosseae inoculation.
... A review conducted by Wang et al. (2020) suggesting that the benefits and mechanisms of AMF in ameliorating organic contaminant residues in crops can be summarized as follows, such as promoting nutrient uptake and water acquisition, alleviating oxidative stress of the host plant, enhancing activities of contaminant degradation-related enzymes, changes in soil structure and contaminant-relating microorganisms, influencing the bioavailability of contaminants, and the accumulation and sequestration of contaminants by AMF structures. Similarly, experimental evidence has been obtained by Corgié et al. (2006) and Gao et al. (2010), who found that AMF can promote the removal of polycyclic aromatic hydrocarbons (PAHs, e.g., fluorene and phenanthrene) by enhancing the uptake of the terrestrial plant (Lolium multiflorum Lam.) and modifying the structure and density of bacterial populations in the mycorrhizosphere. However, the occurrence of AMF in wetland systems is generally regarded as lower than that in terrestrial environments according to the natural preference of AMF for aerobic conditions. ...
Article
This study investigated the effects of substrates (sand, perlite, vermiculite, and biochar) on the colonization of arbuscular mycorrhizal fungi (AMF) in the roots of Glyceria maxima in constructed wetlands (CWs) and the impacts of AMF inoculation on the removal of six selected pharmaceuticals and personal care products (PPCPs). Results showed that the application of adsorptive substrates (perlite, vermiculite, and biochar) in CWs had positive effects on AMF colonization. AMF could influence the uptake and translocation of PPCPs in plant tissues. The amount of PPCPs in the roots of inoculated plants was increased by 21–193% and 67–196% in sand and vermiculite systems but decreased by 13–55% and 51–100% in perlite and biochar systems, respectively, compared to the non-inoculated controls. Meanwhile, AMF enhanced the translocation of PPCPs to plant shoots, resulting in higher accumulations of PPCPs in the shoots of inoculated plants than that of non-inoculated plants. AMF had positive effects on removing PPCPs in sand systems but insignificant effects in adsorptive substrate systems. Therefore, these results indicated that the symbiotic relationship between AMF and plant roots could affect the accumulation and translocation of PPCPs in plants, and substrate type can influence this function. This study could be a starting point for exploring the potential role of AMF in PPCPs removal in CWs.
... Especially in contaminated environments, AMF have been reported to improve plant growth and tolerance to metallic contamination. Many studies were performed using Funneliformis mosseae (previously Glomus mosseae), a worldwide spread vesicular-arbuscular mycorrhizal fungus, and on different isolates, some of them isolated from contaminated soils (Joner and Leyval 2001b;Tonin et al. 2001;Corgié et al. 2006;Colombo et al. 2019;Hu et al. 2020b). Many studies showed that plants such as clover and maize growing in zinc (Zn), cadmium (Cd), copper (Cu) contaminated soils were bigger when inoculated by F. mosseae Leyval 1997, 2001a;Joner et al. 2004;Vogel-Mikuš et al. 2006;Dupré de Boulois et al. 2008). ...
Full-text available
Thesis
Rare earth elements (REE) are a group of strategic metals that have been widely used in modern technologies in the recent decades. However, due to the corresponding REE emission from industries and the over-exploitation, large amounts of anthropogenic rare earth can accumulate in the environment, and be phytotoxic. Arbuscular mycorrhizae (AM) benefit to plants in metal-contaminated soils by improving their survival and growth and alleviating metal toxicity, but little information is available about soil contaminated by rare earth elements. The objective of this PhD project is to understand the transfer of REEs from soil to plants and especially the role of AM fungi on plant growth and REE transfer to plants in REE contaminated soils. Experiments were launched using a model legume plant alfalfa (Medicago sativa), a model REE samarium (Sm), and a metal-tolerant Funneliformis mosseae fungus in a growth chamber. We first studied the bioavailability and transfer of an REE to Medicago sativa grown on two contaminated soils differing in their chemical characteristics. The results showed that DTPA extractable Sm was well correlated with Sm uptake in alfalfa shoots. Although the soil to plant transfer factor was low, alfalfa biomass was reduced when the soils were spiked with 100 to 200 mg kg-1 of Sm. Then the hypothesis was drawn that arbuscular mycorrhizal fungi might protect the plant against REE toxicity. Therefore, a pot experiment was launched to study the role of AM fungi on alfalfa growth and a compartment experiment was performed to study the transfer of Sm to alfalfa via AM fungal hyphae. The biomass of alfalfa grown on Sm-spiked soil was significantly higher following arbuscular mycorrhiza inoculation. P content was also higher in mycorrhizal than nonmycorrhizal plants, but there was no significant Sm transfer to the plant by F.mosseae. Since there are often multiple REEs in contaminated soils, including light (LREE) and heavy (HREE) REEs, a compartment experiment was launched using 4 REEs, alfalfa and ryegrass, which confirmed that there was no transfer of the 4 REEs to alfalfa plants by F.mosseae. Finally, an REE mining soil collected from China was used to analyze the toxicity of REEs to AM fungal spores and to leek plants inoculated or not with the AM fungus, using spore germination assays and a plant growth experiment. The high concentration of REEs significantly inhibited plant growth and spore germination rate, and the fungus tolerated relatively high REE concentrations, but there was no significant difference in REE tolerance between two isolates of F.mosseae. Other fungi and plants should be tested, and field experiments performed, but our results suggest that arbuscular mycorrhizal plants might be considered in phytorestoration of REE-contaminated soils.
... Besides, the exudates of host plant roots can be enhanced by AMF from quality to quantity, which has been proved to directly promote the development of distinct microbial communities in the rhizosphere and the degradation of CECs (Hage-Ahmed et al., 2013). Corgié et al. (2006) investigate the contribution of AMF to phenanthrene biodegradation and found that the presence of AMF modified the structure of bacterial populations in the mycorrhizosphere and increased the density of culturable heterotrophic and phenanthrene degrading bacteria beyond the immediate rhizosphere. Therefore, AMF may increase aerobic metabolizing microorganisms in CW systems, thereby significantly increasing the removal of IBU and the concentrations of aerobic metabolites, such as 2-OH IBU, CA IBU, and 4 ′ -OH DCF (Figs. 5 and 6). ...
Article
This study investigated the role of arbuscular mycorrhizal fungal (AMF) for the removal of ibuprofen (IBU) and diclofenac (DCF) in constructed wetlands (CWs) with four different substrates. Results showed that AMF colonization in adsorptive substrate (perlite, vermiculite, and biochar) systems was higher than that in sand systems. AMF enhanced the tolerance of Glyceria maxima to the stress of IBU and DCF by promoting the activities of antioxidant enzymes (peroxidase and superoxide dismutase) and the contents of soluble protein, while decreasing the contents of malondialdehyde and O2•-. The removal efficiencies of IBU and DCF were increased by 15%–18% and 25%–38% in adsorptive substrate systems compare to sand systems. Adsorptive substrates enhanced the accumulation of IBU and DCF in the rhizosphere and promoted the uptake of IBU and DCF by plant roots. AMF promoted the removal of IBU and DCF in sand systems but limited their reduction in adsorptive substrate systems. In all scenarios, the presence of AMF decreased the contents of CECs metabolites (2-OH IBU, CA IBU, and 4′-OH IBU) in the effluents and promoted the uptake of IBU by plant roots. Therefore, these results indicated that the addition of adsorptive substrates could enhance the removal of IBU and DCF in CWs. The role of AMF on the removal of IBU and DCF was influenced by CW substrate. These may provide useful information for the application of AMF in CWs to remove contaminants of emerging concern.
... Several plants were reported in PAH rhizoremediation assays (Sipila et al. 2008;Pritchina et al. 2011;Bisht et al. 2014;Liu et al. 2014;Salehi et al. 2015;Shahsavari et al. 2015), among which ryegrass has been chosen as a research target due mainly to its large and fibrous root system that enables it to colonize a large area of soil and favors interactions between roots, microbes and pollutants (Joner et al. 2001;Corgi'e et al. 2006;Xu et al. 2014;Chen et al. 2016). The influence of plants on PAHs dissipation may vary according to the distance from growing roots (Bourceret et al. 2015), and it seems that PAH removal efficiency gets higher when proximity to roots increases (Corgi'e et al. 2003). ...
Full-text available
Article
The rhizosphere effect of ryegrass ( Lolium perenne L.) on polycyclic aromatic hydrocarbons (PAHs) dissipation, bioavailability and the structure change of microbial community was investigated using a compartmented device-rhizobox. The PAHs removal efficiency, bioavailability and the change in structure of the microbial community were ascertained using HPLC, Tenax-TA extraction and PCR-DGGE, respectively. The results showed that in the root area (R1) and bulk soil (CK), the removal of 3-ring PAHs were 97.72 ± 0.34% and 95.51 ± 0.75%, 4-ring PAHs were 89.01 ± 1.61% and 78.65 ± 0.47%, 5-ring PAHs were 77.64 ± 4.05% and 48.63 ± 3.19%, 6-ring PAHs were 68.69 ± 3.68% and 36.09 ± 1.78%, respectively. The average removal efficiency of the total PAHs after 80 days followed the order: R1M (91.1%) > CKM (84.9%) > CK (77.6%), indicating that planted soil with inoculation of Mycobacterium sp. as well as non-planted soil inoculated with Mycobacterium sp. could both significantly accelerate the removal of PAHs compared to control soil. The bioavailability ratio of PAHs with 3 and 4 rings tended to decrease (from 59.9% to 14.8% for 3-ring and 7.61% to 5.08% for 4-ring, respectively in R1) while those with 5 rings increased significantly (from 2.41% to 33.78% in R1) during the last 40 days, indicating that bioavailability alteration varies with the number of rings in the PAHs. In addition, PAH bioavailability generally did not show a significant difference between treated soil and control soil. These results suggest that ryegrass rhizosphere effect as well as inoculation of Mycobacterium sp. can accelerate PAH removal in polluted soil. The bacteria community structure demonstrated a complex interplay of soil, bacteria and ryegrass root, and potential PAH degraders were present in abundance. This study provides the exploring data of rhizosphere and bioaugmentation effect on PAH dissipation in agricultural soil, as well as the change of bioavailability and microbial composition thereof.
... In bacterial metabolism, naphthalene1,2-dioxygenase (NDO) is known to catalyze the primary and limiting step for oxidation of PAHs. Colonization of ryegrass roots by F. mosseae modified the structure and density of PAHdegrading bacterial populations and increased the transcriptional activity of NDO in the mycorrhizosphere (Corgi e, Fons, Beguiristain, & Leyval, 2006). PAH-ring hydroxylating dioxygenases (PAH-RHDa) are responsible for the initial step of the aerobic metabolism of PAHs. ...
Article
Arbuscular mycorrhizal (AM) fungi (AMF) can not only improve soil and plant health, but also alter the accumulation of contaminants in plants. Here, the effects of AMF on the contents of organic contaminants and the underlying mechanisms are summarized. Data show that AMF widely occur in sites contaminated with organic chemicals. In most cases, AMF improve plant tolerance to organic contaminants and enhance crop growth, leading to increased biomass of the crops. Overall, AMF decrease organic contaminant residues in crop shoots, but often cause increased accumulation of contaminants, especially persistent organic pollutants (POPs), in crop roots. The benefits and mechanisms behind AMF's role in ameliorating organic contaminant residues in crops can be summarized as follows: (1) increased biomass via improved mineral nutrition and water availability; (2) alleviation of oxidative stress induced by contaminants; (3) enhanced activities of contaminant degradation-related enzymes; (4) accumulation and sequestration of contaminants by AMF structures; (5) gloma-lin-related soil protein (GRSP)-triggered changes in bioavail-ability of contaminants; (6) stimulation of contaminant-degrading microorganisms in soil; (7) improved soil structure; and (8) reduced pesticide application via enhanced crop resistance to pathogens and improved competition with weeds. Finally, future challenges and perspectives regarding AMF's contribution to crop safety are proposed.
... Furthermore, they observed that AMF colonization enhanced the metabolization of atrazine (Huang et al. 2007;Lenoir et al. 2016). It is confirmed that in the hyphosphere and mycorhizosphere zones high enzymatic activities such as dehydrogenase, catalase, dioxygenase etc. were observed (Rabie 2005;Corgie et al. 2006;Huang et al. 2009). ...
Full-text available
Chapter
Bioremediation is an integrative process where the polluted sites are decontaminated by potential exploitation of microorganisms. Arbuscular mycorrhizal fungi (AMF) often found in association with the roots of higher vascular plants and may constitute up to 50% of the total soil microbial biomass. AMF is considered as better alternative to impetus the phytoremediation process because the hyphae intermingled together and create a wide area network in order to make bridge between plant roots, soil and rhizospheric microorganisms. This chapter is focused on the role and significance of AMF in phytoremediation of hydrocarbon contaminated sites. Additionally the metabolite formation during bioremediation of organic compounds is discussed. Furthermore the factors affecting the bioremediation process is also summarized.
Full-text available
Article
Background: Petroleum hydrocarbons affect plant growth, but little is known about physiological responses of mycorrhizal plants facing diesel contamination. Objective: To evaluate the effects of arbuscular mycorrhizal fungi (AMF) on the nutritional status, peroxidase activity (POX), and hydrogen peroxide content (H2O2) in leaves of Melilotus albus planted under diesel-contaminated sand (7500 mg kg⁻¹). Methods: A 2x2 factorial experiment was set in a completely randomized design, under greenhouse conditions for 35 days. Seedlings were pre-inoculated with AMF and transplanted to sand with or without diesel, including non-AMF plants. Results and conclusions: Diesel contamination impaired plant growth; AMF plants had similar growth than non-AMF plants at diesel-contamination, but low nutrient content. Protein content decreased due to diesel in non-AMF plants, but this content was low in AMF plants regardless diesel contamination. Diesel increased POX; whereas AMF plants with or without diesel had higher POX than non-AMF plants. The H2O2 content in AMF plants with or without diesel was low than non-AMF plants. Diesel contamination diminished AMF-colonization, but AMF dissipate more diesel hydrocarbons (>40%). Overall, AMF alleviated the toxic effects of diesel on plants.
Chapter
With the escalating world population along with urbanization and changing consumption patterns, the global need for food is projected to elevate. Econometric models predict that global cereal demand will increase by 1.3% annually through 2015; cereal yields must increase by 1% annually to meet this demand. This scenario projects 50 Mha (million hectares) rise in cereal production area. Climate smart agriculture (CSA) is a new and trending approach towards improving livelihood and food security. CSA is often defined as a combination of practices and technologies. Practicing CSA leads to reduction of greenhouse gas (GHG) emission. CSA helps farmers to meet the global food demand by coping changing climatic conditions. CSA and sustainable intensification are complementary with each other. Under the scenario of changing climate, there is increase in competition for energy, water, labor, and land for food production. Many agricultural practices contribute in formation of GHG (anthropogenic). CSA possesses three objectives: enhancing agricultural productivity, developing capacity to adapt at multiple levels, and eliminating emission of GHG along with encouraging carbon sinks. Sustainable intensification involves improving and maintaining soil biodiversity and monitoring and balancing the biogeochemical cycles. Negative influence of the ongoing agricultural activities involves acidification, erosion, soil structure loss, soil organic matter reduction, gradual buildup of toxic elements in soil, biodiversity loss, and land utilization for nonagricultural purposes. These influences further the enhancement of soil quality from the agronomic side. Physical and chemical properties of soil are governed by glomalin, and economical and ecological importance in this aspect is the actual outcome of mycorrhiza. Glomalin is recalcitrant, difficult to dissolve in water, and heat resistant and forms soil aggregates. This therefore promotes the productivity of the soil and helps to cope with the food security issues.KeywordsAgroecosystem managementClimate smart agricultureFood securityGlomalinSoil health
Article
The degradation of the polycyclic aromatic hydrocarbons (PAH) anthracene and pyrene (each 50 mg·kg-1 soil) in the root zone of different plants was investigated in pot experiments with loamy sand. The PAHs inhibited the plant growth, but the stimulated rhizosphere bacteria accelerated the degradation of anthracene in the soil of the root zone of wheat, oat, ryegrass and pea. The degradation of pyrene was only accelerated in the root zone of ryegrasses. Inoculation of seedlings with selected plant growth promoting bacteria enhanced the plant growth in PAH contaminated soils. The degradation of PAH was stimulated by Agrobacterium rhizogenes (A1A4) in assoziation with wheath, ryegrass and maize and by Pseudomonas fluorescens in association with maize. There were no correlations between plant growth stimulation and PAH-degradation.
Article
Mycorrhizal and non-mycorrhizal (NM) maize plants were grown for 4 or 7 weeks in an autoclaved quartz sand-soil mix. Half of the NM plants were supplied with soluble P (NM-HP) while the other half (NM-LP), like the mycorrhizal plants, received poorly soluble Fe and Al phosphate. The mycorrhizal plants were inoculated with Glomus mosseae or G. intraradices. Soil bacteria and those associated with the mycorrhizal inoculum were reintroduced by adding a filtrate of a low P soil and of the inocula. At 4 and 7 weeks, plants were harvested and root samples were taken from the root tip (0-1 cm), the subapical zone (1-2 cm) and the mature root zone at the site of lateral root emergence. DNA was extracted from the roots with adhering soil. At both harvests, the NM-HP plants had higher shoot dry weight than the plants grown on poorly soluble P. Mycorrhizal infection of both fungi ranged between 78% and 93% and had no effect on shoot growth or shoot P content. Eubacterial community compositions were examined by polymerase chain reaction-denaturing gradient gel electrophoresis of 16 S rDNA, digitisation of the band patterns and multivariate analysis. The community composition changed with time and was root zone specific. The differences in bacterial community composition in the rhizosphere between the NM plants and the mycorrhizal plants were greater at 7 than at 4 weeks. The two fungi had similar bacterial communities after 4 weeks, but these differed after 7 weeks. The observed differences are probably due to changes in substrate composition and amount in the rhizosphere.
Article
Phosphorus transport by hyphae of the three VA mycorrhizal fungi, Acaulospora laevis Gerdemann & Trappe, Glomus sp. and Scutellospora calospora (Nicol. & Gerd.) Walker & Sanders, associated with Trifolium subterraneum L. was investigated by means of radiotracer techniques. Plants with roots heavily colonized by each mycorrhizal fungus were transplanted to two-compartment systems, where a hyphal compartment was separated from the main compartment by a fine mesh preventing root penetration. The hyphal compartment contained layers of 32P-labelled soil, which were placed at 0, 1, 2.5, 4.5 or 7 cm from the root compartment. A time-course study over 37 d showed that Glomus sp. transported most 32P to shoots over soil-root distances shorter than 1 cm. In contrast, A. laevis transported most 32P to shoots over soil–root distances longer than 1 cm. This ability of A. laevis to transport phosphorus over longer distances than Glomus sp. parallels previous observations that hyphae of A. laevis spread faster and further in soil than hyphae of the Glomus sp. Scutellospora calospora transported much less 32P to plants, but accumulated more 32P in its hyphae, than the two other fungi. The higher specific radioactivity in the hyphae of S. calospora than of A. laevis and Glomus sp. indicated a retarded translocation of 32P in its hyphae or retarded transfer of 32P across its interface with the host. However, the poor phosphorus transport by S. calospora might also have resulted from its reaction to root trimming at transplanting; percentage root colonization by S. calospora decreased markedly after transplanting to the labelling system.
Article
Accelerated biodegradation of organic contaminants in planted soil is frequently reported yet our current understanding of plant–microbe interactions does not allow us to predict which plant species can encourage the development of rhizosphere communities with enhanced degradation capacity. In a companion study, five grass species (Sudan grass, ryegrass, tall fescue, crested wheatgrass, and switch grass) were grown in a Matapeake silt loam soil to study the degradation of atrazine and phenanthrene by rhizosphere microorganisms (see Fang et al., 2000, this vol., Fang, C., Radosevich, M., Fuhrmann, J. J., 2000. Atrizine and phenanthrene degradation in grass rhizosphere soil. Soil Biology & Biochemistry, in press). In the present paper substrate utilization patterns (BIOLOG®), and fatty acid methyl ester (FAME) profiles of the same rhizosphere microbial communities were determined. Both FAME and BIOLOG® analyses detected changes in soil microbial community structure among treatments. However, community structure did not directly correlate to either ATR or PHE degradation rates.
Article
The bioremediation of soil contaminated with polycyclic aromatic hydrocarbons (PAH) is often limited by a low bioavailability of the contaminants. Non-ionic surfactants, such as Tween 80, when above their critical micelle concentration (CMC), can efficiently enhance the bioavailability of PAHs in contaminated soil by increasing solubility and dissolution rates. However, disposing of this micelle-contaminated spent washwater can be a major problem. The aim of this study was to combine surfactant soil washing techniques using Tween 80 with the versatile lignin-degrading system of the white rot fungus, Phanerochaete chrysosporium, to bioremediate PAH-contaminated soil. Approximately 85% (w/w) of a total of nine PAHs in an aged (1 month) contaminated soil (total PAH concentration = 403.61 µg g−1) could be solubilized in a 2.5% (w/v) Tween 80 solution at a soil/water ratio of 1:10. The washwater was then catabolized by a 3-day-old culture of P chrysosporium under a stationary condition. The disappearance of most PAHs tested (molecular weight ≥ 178) correlated well with their ionization potentials and 66.4% (w/w) of the total PAHs in washwater with 2.5% (w/v) Tween 80 was catabolized after 11 days of culture. The catabolism was enhanced to 86% (w/w) using a lower concentration of 0.5% (w/v) Tween 80. The initial oxidation rate of total PAHs based on the first 4 days of culture remained almost constant at approximately 1.88 µg cm−3day−1 when the Tween 80 concentration in washwater was increased from 0.5% to 2.5% (w/v). The combination of soil washing and white rot fungus catabolization of PAH using 2.5% (w/v) Tween 80 eliminated the total PAH concentration in the contaminated soil by 56.4% (w/w) after 11 days. The results suggest that PAH-contaminated soil may be cleansed by using a combination of surfactant soil washing and white rot fungus catabolism.© 2000 Society of Chemical Industry
Article
Rhizosphere processes play a key role in nutrient cycling in terrestrial ecosystems. Plant rhizodeposits supply low-molecular weight carbon substrates to the soil microbial community, resulting in elevated levels of activity surrounding the root. Mechanistic compartmental models that aim to model carbon flux through the rhizosphere have been reviewed and areas of future research necessary to better calibrate model parameters have been identified. Incorporating the effect of variation in bacterial biomass physiology on carbon flux presents a considerable challenge to experimentalists and modellers alike due to the difficulties associated with differentiating dead from dormant cells. A number of molecular techniques that may help to distinguish between metabolic states of bacterial cells are presented. The calibration of growth, death and maintenance parameters in rhizosphere models is also discussed. A simple model of rhizosphere carbon flow has been constructed and a sensitivity analysis was carried out on the model to highlight which parameters were most influential when simulating carbon flux. It was observed that the parameters that most heavily influenced long-term carbon compartmentalisation in the rhizosphere were exudation rate and biomass yield. It was concluded that future efforts to simulate carbon flow in the rhizosphere should aim to increase ecological realism in model structure.