The methylation of the C-terminal region of hnRNPQ (NSAP1) is important for its nuclear localization

ArticleinBiochemical and Biophysical Research Communications 346(2):517-25 · August 2006with28 Reads
Impact Factor: 2.30 · DOI: 10.1016/j.bbrc.2006.05.152 · Source: PubMed
Abstract

Protein arginine methylation is an irreversible post-translational protein modification catalyzed by a family of at least nine different enzymes entitled PRMTs (protein arginine methyl transferases). Although PRMT1 is responsible for 85% of the protein methylation in human cells, its substrate spectrum has not yet been fully characterized nor are the functional consequences of methylation for the protein substrates well understood. Therefore, we set out to employ the yeast two-hybrid system in order to identify new substrate proteins for human PRMT1. We were able to identify nine different PRMT1 interacting proteins involved in different aspects of RNA metabolism, five of which had been previously described either as substrates for PRMT1 or as functionally associated with PRMT1. Among the four new identified possible protein substrates was hnRNPQ3 (NSAP1), a protein whose function has been implicated in diverse steps of mRNA maturation, including splicing, editing, and degradation. By in vitro methylation assays we were able to show that hnRNPQ3 is a substrate for PRMT1 and that its C-terminal RGG box domain is the sole target for methylation. By further studies with the inhibitor of methylation Adox we provide evidence that hnRNPQ1-3 are methylated in vivo. Finally, we demonstrate by immunofluorescence analysis of HeLa cells that the methylation of hnRNPQ is important for its nuclear localization, since Adox treatment causes its re-distribution from the nucleus to the cytoplasm.

The methylation of the C-terminal region of hnRNPQ (NSAP1)
is important for its nuclear localization
q
Dario O. Passos
a,b
, Alexandre J.C. Quaresma
a,b
,Jo
¨
rg Kobarg
a,b,
*
a
Centro de Biologia Molecular Estrutural, Laborato
´
rio Nacional de Luz
´nc
rotron, Rua Giuseppe Ma
´
ximo Scolfaro 10.000,
C.P. 6192, 13084-971 Campinas, SP, Brazil
b
Departamento de Bioquı
´
mica, Universidade Estadual de Campinas, 13084-970 Campinas, SP, Brazil
Received 19 May 2006
Available online 5 June 2006
Abstract
Protein arginine methylation is an irreversible post-translational protein modification catalyzed by a family of at least nine different
enzymes entitled PRMTs (protein arginine methyl transferases). Although PRMT1 is responsible for 85% of the protein methylation in
human cells, its substrate spectrum has not yet been fully characterized nor are the functional consequences of methylation for the pro-
tein substrates well understood. Therefore, we set out to employ the yeast two-hybrid system in order to identify new substrate proteins
for human PRMT1. We were able to identify nine different PRMT1 interacting proteins involved in different aspects of RNA metabo-
lism, five of which had been previously described either as substrates for PRMT1 or as functionally associated with PRMT1. Among the
four new identified possible protein substrates was hnRNPQ3 (NSAP1), a protein whose function has been implicated in diverse steps of
mRNA maturation, including splicing, editing, and degradation. By in vitro methylation assays we were able to show that hnRNPQ3 is a
substrate for PRMT1 and that its C-terminal RGG box domain is the sole target for methylation. By further studies with the inhibitor of
methylation Adox we provide evidence that hnRNPQ1-3 are methylated in vivo. Finally, we demonstrate by immunofluorescence anal-
ysis of HeLa cells that the methylation of hnRNPQ is important for its nuclear localization, since Adox treatment causes its re-distri-
bution from the nucleus to the cytoplasm.
2006 Elsevier Inc. All rights reserved.
Keywords: Yeast two-hybrid system; Protein arginine methylation; Post-translational modification; Protein–protein interactions; Identification of met-
hylated substrates; Sub-cellular localization
The hnRNPQ proteins are members of the large family
of heterogeneous nuclear ribonucleoproteins (hnRNPs),
which is composed by over 20 different proteins [1].It
has also been termed as GRY-RBP [2,3] or NSAP1 (non
structural associated protein 1), since it has been described
to interact with a non-structural protein from the minute
virus of mice [4]. hnRNPQ appears in three protein iso-
forms called Q1–Q3, whic h are derived from alternative
splicing of a single gene. Its smallest proteic isoform Q1
has an apparent molecular mass of 62 kDa, whereas Q2
has a molecular mass of 65 kDa, and Q3 of 70 kDa.
The exact molecular functions of each of these three iso-
forms are still not well understood [1].
Most members of the family of hnRNP proteins are
known for their nuclear localization, nuclear-cytoplasmic
shuttling, and their interactio n with RNA or other RNA
binding proteins, and are predicted to be functionally
involved in diverse aspect of RNA metabolism [5–7]. Many
of the hnRNP members contain so-called RGG-boxes
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2006.05.152
q
Abbreviations: Ki-1/57, 57 kDa Ki-1 antigen; MM, minimal medium;
PRMT, protein arginine methyl transferase; hnRNPQ, heterogeneous
nuclear ribonucleoprotein type Q; SMN, survival of motor-neuron;
NSAP1, NS1-associated protein 1; GRY-RBD, glycine-arginine-tyro-
sine-rich RNA-binding protein; RRM, RNA recognition motif; RGG/
RXR-box, arginine-glycine rich box, where X is any amino acid; Act D,
actinomycin D; Adox, adenosine-2
0
,3
0
-dialdehyde; IP, immuno-precipita-
tion; SAM, S-Adenosyl-
L-methionine; WB, Western blot; AP, alkaline
phosphatase.
*
Corresponding author. Fax: +55 19 3512 1006.
E-mail address: jkobarg@lnls.br (J. Kobarg).
www.elsevier.com/locate/ybbrc
Biochemical and Biophysical Research Communications 346 (2006) 517–525
BBRC
Page 1
(Arg-Gly-rich regions ) and most of them one to several
RRMs (RNA recognition motifs) [1,8,9].
hnRNPQ has been functionally implicated in several dif-
ferent steps of mRNA maturation. One of the attributed
functions for this protein was its association with the edito-
some complex, through the identification of its interaction
with the mRNA editing cytidine deaminase Apobec1 [2,3].
The editing complex contains in addition to the catalytical-
ly active component Apobec1 also the essential cofactor
ACF (Apobec1 complementation factor) [2,10]. hnRNPQ
may be another regulatory component of the apoB RNA
editing-complex, acting through binding to Apobec1,
ACF, and the ApoB mRNA [2] .
Furthermore, hnRNPQ has been identified to be a
component of the SMN-complex (survival of motor neu-
rons) [1] interacting with the wild-type form of the pro-
tein SMN, although not with its truncated form, which is
found in spinal muscular atrophy [9]. Finally, hnRNPQ
has been functionally associated to a multiprotein com-
plex that regulates the translationally coupled process
of mRNA degradation of specific mRNAs such as that
of c-fos [11] or of mRNAs related to the circadian
rhythm [12]. The importance of the association to the
latter context is emphasized by the finding that hnRNPQ
has been described to interact with the protein AUF1
[13], which is a key element for the destabilization of
AU-rich mRNAs [14].
Protein arginine methylation is an irreversible post-
translational modification found in eukaryote s. Only
recently the functional relevance of this post-translational
protein modificat ion is being explored [15–19]. Until now,
nine enzymes called PRM T1-9 were described [20–27],
that catalyze the arginine methylation of proteins.
PRMT1 seems to be responsible for ca. 85% of the total
protein methylation in the cell [28,29]. Among the charac-
terized protein substrates, the major group consists of the
hnRNPs [30], which are normally methylated in their argi-
nine- and glycine-rich regions (‘‘RGG-boxes’’) [31].
Protein arginine methylation has been implicat ed to be
necessary for RNA processing [32,33], transcriptional
regulation [34,35], signal trans duction [36,37], DNA repair
[17], and the regulation of the sub-cellular localization of
proteins [32].
Here, we report the results of a yeast two-hybrid screen,
where we used human PRMT1 as bait, in order to identify
possible new in vivo protein substr ates. Among the novel
identified putative protein substrates was hnRNPQ, which
interacts specifica lly with PRMT1 and is also its substrate
in vitro. We also demonstrate that hnRNPQ is methylated
on arginine residues in vivo. Its C-terminal region, which
contains an RGG-box, is absolutely required for its local-
ization to the nucleus. Furthermore, we report that the
methylation of hnRNPQ in vivo seems to be important
for its predominant nuclear localization, since the inhibi-
tion of protein methylation by treatment of HeLa cells with
Adox results in the partial re-distribution of hnRNPQ
from the nucleus to the cytoplasm.
Results and discussion
Yeast two-hybrid screen using PRMT1 as a bait
In order to identify new PRMT 1 interacting proteins,
the yeast two-hybrid system [38] was employed using the
PRMT1 as bait against a human fetal brain cDNA library
(Clontech). The 2.0 · 10
6
screened co-transformants yield-
ed 273 positive clones for both His3 and LacZ reporter
constructs. Among the 36 library plasmid DNA clones,
we identified 26 clones that encode nine different proteins
directly or indirectly involved in RNA metabolism. The
other clones encoded proteins that will be described
elsewhere.
Of the nine proteins involved in RNA metabolism five
had been previously described as direct protein substrates
or as functionally associated proteins for PRMT1. The lat-
ter consist of: CIRBP [39], ILF3 [40], b-tubulin [41],
EWSR1 [42], and ribosomal protein S29 [43]. On the other
hand, the screen resulted in the identification of four pro-
teins involved in RNA metabolism, that may represent
novel in vivo substrates for PRMT1: hnRNPQ (this study),
Ki-1/57 (or IHABP4) [44–46], hnRNPA3 [47], and SFR1
[48]. All nine identified proteins except ribosomal protein
S29 contain at least one (b-tubulin) or even up to 25
(EWSR1) RGG/RXR boxes, the typical target motif for
protein methylation by PRMTs. This already seems to
indicate that yeast two-hybrid screens, in general, can be
used with success in order to identify new PRMT candidate
substrate proteins. Here, we set out to test in more detail if
the identified PRMT1 inter acting protein hnRNPQ, which
contains 16 RGG/RXR boxes in its C-terminal region, is a
true substrate for PRM T1 and what are the possible func-
tional consequences for the methylation of hnRNPQ
in vivo.
PRMT1 interacts with the C-terminal region of hnRNP Q
and methylates it in vitro
To test if hnRNPQ is a substrate for PRMT1, we
performed an in vitro methylation assay (Fig. 1). The
full-length 6· His-hnRNPQ (lane 3) as well as the fusion
protein GST-hnRNPQ(389–623), whi ch comprises only
its C-terminal RGG/RXR-box region (lane 5), were both
methylated by PRMT1 in vitro. As control, we used the
RGG-box containing protein GST-Ki-1/57 [45–47], which
was also methylated by PRMT1 (lane 6). The reaction
was specific since neither the control protein GST nor the
fusion construction lacking the C-terminal region
GST-hnRNPQ(1–443) was methylated by PRMT1 in vitro
(lanes 2 and 4, respectively).
In agreement with this in vitro methylation mapping, the
prey-plasmid that showed interaction with lexA-PRMT1 in
the yeast two-hybrid screen encodes the residues 390–623
located at the C-terminus of hnRNPQ. The C-terminal
region of hnRNPQ 3 contains an extensive RGG/RXR-
box motif, which includes 11 RGG/RXR boxes, seems to
518 D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525
Page 2
mediate binding to PRMT1, and is also the target for
in vitro arginine methylation (Fig. 1 ).
hnRNPQ is methylated in vivo in HeLa cells
In order to test whether hnRNPQ is also methylated
in vivo, we performed immuno-precipitation of hnRNPQ
from whole cell lysates and then analyzed the immunopre-
cipitate by Western blot utilizing antibodi es that specifical-
ly detect mono- and di-methylarginine, the two types of
arginine methylation mediated by PRMT1 (Fig. 2). We
found three protein bands of approximately 70, 67, and
62 kDa molecular mass (lane 2) that were labeled by the
anti-mono/di-methylarginine antibodies. The bands likely
represent the different protein isoforms of hnRNPQ. The
labeling of the antibodies was specific since no such bands
were detected when the anti-hnRNPQ antibody was not
incubated with lysate (lane 1). Further confirmation, that
the detected bands represent the in vivo methylated
hnRNPQ proteins, co mes from the observation that these
bands disappeared, when the cells were pre-treated with
the inhibitor of methylation Adox (lane 3). Together, these
results demonstrate that the hnRNPQ proteins normal ly
occur in methylated form in vivo, in HeLa cells.
Fig. 1. hnRNPQ is a substrate for PRMT1 in vitro. (A) The indicated proteins were methylated by GST-PRMT1 in vitro. PRMT1 was expressed and
purified as a GST fusion protein and incubated with the indicated recombinant proteins, all expressed in and purified from E. coli. Full-length hnRNPQ
was expressed and purified from recombinant baculovirus-infected Sf9 insect cells. Its methylation reaction was carried out with whole cell lysate instead of
with purified protein. Selected molecular masses of the protein standard in lane 1 are indicated at the side. The asterisk (
*
) points out degraded hnRNPQ
protein. The arrows are indicating the protein bands that match with the predicted molecular masses. (B) Schematic representation of hnRNPQ3
constructs used in the in vitro methylation assay. The localization of the RGG/RXR boxes, three RRM domains, and the N-terminal acidic domain of
hnRNPQ is indicated.
Fig. 2. hnRNPQ isolated from human cells shows methylation in vivo.
hnRNPQ was immunoprecipitated (IP) from the whole cell lysate of HeLa
cells treated (+) or non-treated () by methylation inhibitor Adox. Then
the immunoprecipitated proteins were run out on by SDS–PAGE and
transferred to a PVDF-membrane. Next we used a mixture of antibodies
anti-mono and—dimethylarginine to probe the membrane by Western
blotting. As a control anti-hnRNPQ antibody (A) (lane 1) was not
incubated with cell lysate in order to be able to identify antibody bands.
The asterisks (
*
) correspond to the heavy (above) and light (below) chains
of the antibody, which also served as protein molecular mass markers of
50 and 25 kDa, respectively. The bracket indicates the specific methylated
hnRNPQ 1–3 bands.
D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525 519
Page 3
hnRNPQ2 and 3 are the main isoforms found in HeLa cells
and are located predominantly in the nucleus
When we detected the three bands in Fig. 2, that likely
represent the methylated isoforms of hnRNPQ, we were
interested to confirm if they are indeed the three isofo rms
of hnRNPQ and how they may be distributed in the cyto-
plasmic and nuclear compartments. Therefor e, we per-
formed immuno-precipitations from both the nuclear and
cytoplasmic fractions of the lysate of HeLa cells with
anti-hnRNPQ antibody. We then tried to identify the pre-
dominantly observed protein band s by peptide sequencing
using mass spectrometry analysis (Fig. 3).
We were only able to observe two predominant protein
bands of ca. 67 and 70 kDa in the nuclear compartment of
the HeLa cells (Fig. 3B). These bands were cut out of the
gel and submitted to in gel tryptic digestion. After a mass
fingerprint analysis of the tryptic peptide fragments by
LC–MS/MS, it was possible to identify both protein bands
as hnRNPQ (Fig. 3C and D). The sequenced peptides rep-
resented ca. 13% or 15% of the amino acid sequence of the
corresponding 67 or 70 kDa proteins, respectively. It has
been previously described that the antibody used in the
immunoprecipitation can detect up to 4 bands that repre-
sent the four proteins [1]. These are: hnRNPR (80 kDa),
and the three isoforms 1–3 of hnRNPQ, with respective
molecular masses of ca. 62, 67, and 70 kDa. From the
apparent molecular masses of ca. 70 and 67 kDa as detect-
ed by the SDS–PAGE (Fig. 3A), we were able to assign the
two nuclear bands to the isoforms hnRNPQ3 and 2.
Although the peptides identified by mass spectrometry
did not represent regions that allow differentiating between
these isoforms, we could rule out that the upper band of
70 kDa may be hnRNPR. The residues that differ between
hnRNPR and hnRNPQ in the sequenced peptides are
underlined in Fig. 3C. Together these data suggest that
the two identified nuclear protein bands represent
hnRNPQ3 (70 kDa) and hnRNPQ2 (67 kDa). The bands
Fig. 3. Identification of the nuclear isoforms hnRNPQ2 and 3 by mass spectrometry. (A) Protein sequence alignment of the three hnRNPQ isoforms 1–3.
(B) HeLa cells’ nuclear and cytoplasmic fractions were separately immunoprecipitated with anti-hnRNPQ/R antibody and co-precipitated proteins were
run out by SDS–PAGE. The two predominant nuclear bands of ca. 67 and 70 kDa were excised from the SDS–PAGE gel and digested by trypsin. The
generated peptides were analyzed by Q-TOF mass spectrometry for the amino acid sequence determination. The asterisks (
*
) correspond to the heavy
chain of the antibody. () indicates a protein band that has also been excised and analyzed by mass spectrometry. Through amino acid sequences obtained
from sequencing tryptic peptides, it was possible to identify that this band consists of the proteins b-actin and b-tubulin. (C,D) The two bands that
corresponded to the molecular mass predicted for hnRNPQ2 (67 kDa) and Q3 (70 kDa) were confirmed by finger print peptides specific for hnRNPQ.
Bold labeled stretches of amino acids represent peptide sequences as identified by mass spectrometry in the NCBI data bank, using the Mascot Software.
The underlined amino acids are those that are different in hnRNPR, which has a verified molecular mass of 80 kDa. hnRNPQ1 would have a significantly
lower molecular mass of approximately 62 kDa.
520 D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525
Page 4
also cannot represent hnRNPQ1, which has a molecular
mass of 62 kDa. This conclusion can be drawn, since a
band of 62 kDa woul d have a higher electrophoretic mobil-
ity than that of the marker protein of 66 kDa, and both
observed bands had a lower electrophoretic mobility,
which corresponded to proteins of 70 and 67 kDa,
respectively.
In vitro methylation of endogenous cellular hnRNPQ by
PRMT1
Next, we wanted to analyze the in vitro methylation of
hnRNPQ, isolated from HeLa cells, as well as the impor-
tance of its methylation for its nuclear or cytoplasmic dis-
tribution. For this, HeLa cells were treat ed or not with the
inhibitor of methylation Adox, and its nuclear and cyto-
plasmic fractions prepared and analyzed separately. The
hnRNPQ proteins were immunoprecipitated using specific
antibody and protein A Sepharose beads. These beads were
then submitted to an in vitro methylation reaction in the
presence of recombinant GST-PRMT1 (Fig. 4).
We found two bands of ca. 67 and 70 kDa, correspond-
ing to hnRNPQ2 and 3, in nucleus and cytoplasm of
untreated HeLa cells (lanes 3 and 4). However, the nuclear
hnRNPQ bands (lane 3) present significantly more methyl-
H
3
incorporation than the cytoplasmic bands (lane 4). On
the other hand, we only were able to observe the band cor-
responding to hnRNPQ3 in the Adox-treated cells. In this
case the cytoplasmic protein fraction (lane 2) was methylat-
ed stronger in vitro by GST-PRMT1 than the nuclear frac-
tion (lane 1). This could reflect that hnRNPQ3 in presence
of inhibitor Adox is re-distributed to the cytoplasm. This
hypothesis obtains further support from the in vivo immu-
nofluorescence experiment reported below in Fig. 5. At this
point we do not yet understand why the hnRNPQ proteins
from the nucleus of Adox-treated cells are less well methyl-
ated in vitro than those of untreated cells, since the contrary
may be expected. We speculate that the inhibition of
hnRNPQ methylation by Adox may lead to an increase
in its association with other proteins, to conformational
change or even to a decrease in protein stability. So the
fraction corresponding to the nucleus of treated cells
showed a significant reduction in its in vitro methylation
by GST-PRMT1.
Inhibition of the methylation leads to a re-distribution of
hnRNPQ to the cytoplasm
Our immunoprecipitation assays of hnRNPQ protein
had revealed that the isoforms hnRNPQ2 and 3 seem to
be localized predominantly in the nuclear compartment
(Fig. 3A). When we performed immunofluorescence local-
ization studies in HeLa cells (Fig. 5A–F), we were able to
confirm the almost exclusive nuclear localization of
hnRNPQ-specific immunofluorescence (A–C). However,
we observed in a reproducible manner that a significant
fraction of hnRNPQ immunofluorescence has been re-dis-
tributed to the cytoplasm after 16 h of treatment with Adox
(D–F). This may suggest that methylation of these proteins
is required for their nuclear localization and is in agreement
with the findings reported in Fig. 4 (lanes 1 and 2), where
we also observed a possible re-distribution of hnRNPQ3
from the nucleus to the cytoplasm.
The C-terminal RGG/RXR-box containing region of NSAP1
is essential for its nuclear localization
Since, hnRNPQ seems to be methylated on arginine res-
idues and our results suggest that its methylation may be
important for the regulation of its nuclear/cytoplasmic dis-
tribution, we wanted lastly to address the importance of the
predicted target region of arginine methylation, the C-ter-
minally located RGG/RXR-box (residues 444–559).
We therefore generated a hnRNPQ construction span-
ning the amino acid residues 1–443 fused C-terminally to
GFP and transfected it transiently into HeLa cells. We
observed a strictly cytoplasmic localization of this con-
struction (Fig. 5 G–I), indicating the importance of the
RGG/RXR box region of hnRNPQ for its localization.
In conclusion, our data show that hnRNPQ is a sub-
strate for PRMT1 and a target of arginine methylation
in vivo. Furthermore, hnRNPQ is essentially methylated
in its RGG/RXR box containing C-terminal region, which
is required for its nuclear localization. Finally, the inhibi-
tion of its in vivo methylation by Adox causes a change
of its localization from strictly nuclear to partially cyto-
plasmic. This suggests that hnRNPQ methylation in its
C-terminal region is important for its nuclear localization.
By demonstrating that hnRNPQ is a PRMT1 substrate
Fig. 4. In vitro methylation assay. HeLa cells were (+) or were not ()
incubated with the inhibitor of endogenous protein methylation, Adox.
Next nuclear (N) and cytoplasmic (C) fractions of these cells were
prepared and submitted to immunoprecipitation (IP) with anti-hnRNPQ
antibody. Immunoprecipitated proteins were then methylated by GST-
PRMT1 in vitro. Proteins were run out on SDS–PAGE and methylation
assessed by autoradiography. The arrows in the autoradiography indicate
the two isoforms hnRNPQ2 and 3 that could be identified due to their
approximate molecular masses. Molecular masses of selected ladder
proteins have been indicated on the right.
D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525 521
Page 5
and that its methylation has functional consequences we
can further conclude that the yeast two-hybrid system is
an efficient method for identifying new substrates for
PRMTs, that may be applied in a larger scale to all PRMTs
in order to understand the differences in the target protein
spectra of these enzymes. In the future we may hopefully
understand the specific functions of the intriguingly com-
plex machinery of protein arginine methylation for each
sub-set of protein substrates.
Materials and methods
Plasmid constructions. The full-length PRMT1 (1–344) and NSAP1 (1–
623) cDNAs were obtained from human fetal brain cDNA library
(Clontech), using the following forward and reverse primers, respectively;
PRMT1: 5
0
-GGGAATTCATGGAGGTGTCCTGTGGCCAG-3
0
and 5
0
-
GCGGATCCTCGAGTCAGCGCATCCGGTAGTCGGTGG. PRMT1
cDNA was cloned via BamHI and EcoRI sites into PBTM116 [38] and via
EcoRI and XhoI sites into pGEX5X2 (Amersham Biosciences); hnRNPQ:
5
0
-CAGCGGCCGCATGGCTACAGAACATGTTAATGG-3
0
and 5
0
-
CGATCTCGAGCTACTTCCACTTGGGCCCAAAAG-3
0
, hnRNPQ
was cloned via NotI into pFastBac-HTC (Invitrogen). Next, the following
deletion mutant constructs were derived: hnRNPQ(1–443): 5
0
-GATT
GGTACCGCATGGCTACAGAACATGTTAATG-3
0
and 5
0
-GATCTC
TAGAGTCGACTTACCTTTTCTGATCTGGTGGCTTGGC-3
0
, KpnI
and XbaI sites were used to sub-clone the fragment into pEGFP-N2
vector; hnRNPQ(1–443): 5
0
-CGATCTCGAGATGGCTACAGAACA
TGTTAATGGAAATGG-3
0
,5
0
-CTTTGCGGCCGCCTACTTCCACTG
TTGCCCAAAAGTATC-3
0
, XhoI and NotI sites were used to sub-clone
the fragment into pGEX5X1 (Amersham Biosciences) vector;
hnRNPQ(389–623), 5
0
GATCTCTAGAGTCGACTTACCTTTTCTGAT
CTGGTGGCTTGG-3
0
,5
0
-GATTGGTACCGCATGGCTACAGAACA
TGTTAATG-3
0
, XbaI and KpnI sites were used to sub-clone this fragment
into pGEX4T2.
Yeast two-hybrid assay. The yeast two-hybrid system (Y2H) screen was
performed in the yeast strain L40 (Clontech), using a construction with the
full-length cDNA of PRMT1 as bait. The cDNA of PRMT1 was cloned
into the plasmid PBTM116 in-frame with the DNA-binding domain of
LexA. After the co-transformation of the bait construction and a human
fetal brain library (Clontech), cloned in vector pACT2, in-frame with the
Gal4-activation domain, approximately 2 · 10
6
co-transformants were
plated on synthetic minimal medium (MM) lacking tryptophan, leucine,
and histidine but supplemented with adenine. The selected transformants,
which expressed LexA-PRMT1 protein and its interaction partner fused to
the activation domain Gal4, were re-streaked on MM plates and re-tested
by a b-galactosidase filter-assay [13]. From 273 positive blue clones, 36
were sequenced, identifying 9 different proteins involved in RNA
metabolism.
Expression and purification of recombinant proteins. To generate the
proteins GST, GST-hnRNPQ(1–443), GST-hnRNPQ(389–623), GST-
PRMT1, and GST-Ki-1/57, the cDNAs were amplified by PCR and
Fig. 5. Inhibition of the methylation of hnRNPQ leads to its re-distribution to the cytoplasm, and hnRNPQ requires its C-terminal region for nuclear
localization. HeLa cells were grown on glass coverslips and incubated for 16 h with (D–F) or without Adox (A–C) at 37 C. Cells were fixed with 100%
methanol and endogenous hnRNPQ was detected by immunofluorescence using the monoclonal antibody anti-hnRNPQ and FITC-coupled anti-mouse
(green) antibody as the secondary antibody (A,D). DAPI counter-staining (blue) was used to localize the position of the nucleus (B,E). MERGE shows the
fusion of the images from the left two columns (C,F). GFP-hnRNPQ(1–443) lacks the C-terminal RGG box-containing region and shows a strictly
cytoplasmic localization (G–I). A construction lacking the C-terminal (residues 444–623) of hnRNPQ(1–443) was fused to the C-terminal of GFP. After
transfection of HeLa with this recombinant construct, the sub-cellular distribution of GFP fusion protein was analyzed by fluorescence microscopy. (G)
Cell shows the restricted cytoplasmic localization for the mutant protein (GFP-NSAP1 (1–443)). (H) DAPI counter-staining of the nucleus. (I) MERGE:
superimposition of the nucleus colored by DAPI (blue) and the cytoplasm with GFP-protein (green). (For interpretation of the references to colours in this
figure legend, the reader is referred to the web version of this paper.)
522 D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525
Page 6
inserted into pGEX bacterial expression vector as described above. The
recombinant plasmids were transformed into Escherichia coli strain BL21
(Stratagene), except the recombinant pGEX-plasmids encoding GST-
hnRNPQ(1–443) and GST-hnRNPQ(389–623), which were co-trans-
formed with pRARE vector into the BL21 strain. The protein expression
was induced by 1 mM IPTG for 4 h at 37 C. Protein affinity purification
was performed using glutathione–Sepharose 4B (Amersham) using either a
column or the batch technique, in the case of GST-PRMT1. cDNA
encoding 6· His-hnRNPQ was sub-cloned into the baculovirus transfer
vector pFastBac-HTC. After in vitro recombination and generation of a
recombinant baculovirus DNA, in agreement with the manufacturer’s
instructions (Invitrogen), Sf9 cells were transfected to express full-length
of 6· His-hnRNPQ in Sf9 insect cells.
In vitro methylation assays. The lysate of recombinant full-length 6·
His-hnRNPQ protein and its purified deletion mutants as well as the
controls, GST and GST-Ki-1/57, were incubated in PBS buffer
containing 1 mM EDTA, 1 mM PMSF, and 2 ll of radiolabeled SAM
[(methyl-
3
H) S-adenosyl-L-methionine (2 lCi) (Amersham Pharmacia
Biotech)] in the presence of recombinant GST-PRMT1 (bound to
glutathione beads) for 1 h at 37 C in a final volume of 50 ll. The
reactions were stopped by heating to 100 C for 5 min in SDS–PAGE
sample loading buffer and then run out by 10% polyacrylamide
SDS–PAGE. After fixing the gel for 20 min in water containing 10%
methanol and 10% acetic acid, it was washed with water, and then
incubated in amplifying solution (Amersham Pharmacia Biotech) for 1 h
30 min. After further washes, the gel was dried and exposed to Hyperfilm
MP (Amersham Pharmacia Biotech) for 2 days.
For the analysis of the methylation of endogenous hnRNPQ in vivo,
hnRNPQ was immunoprecipitated from HeLa cell fractions as described
below. Then the immunoprecipitates were submitted in vitro to methyla-
tion by adding recombinant GST-PRMT1 as described above.
Cell culture and preparation of the cytoplasmic and nuclear extracts.
5 · 10
7
HeLa cells were incubated or not with methylation inhibitor
adenosine-2
0
,3
0
-dialdehyde (Adox) (20 lM) for 16 h and lysed for 1 h at
4 C in 1 ml modified cytoplasmic buffer (20 mM Tris, pH 8.0, 10 mM
KCl, 0.1 mM EDTA, 1.5 mM MgCl
2
, 0.5 mM DTT, 2 mM PMSF, and
protease inhibitors) [49]. After centrifugation at 14,000g, the nuclear
fraction was separated and then lysed in 1 ml of nuclear extraction buffer
(20 mM Tris, pH 8.0, 0.4 M NaCl, 0.1 mM EDTA, 1.5 mM MgCl
2
, 0.5
mM DTT, and 25% v/v glycerol) at 4 C for 1 h.
Mass spectrometry analysis. The hnRNPQ protein was immunopre-
cipitated from 5 · 10
7
HeLa cells after cytoplasmic and nuclear separation
and run out by SDS–PAGE. The gel was stained with Coomassie brilliant-
blue R-250 in 50% (v/v) ethanol and 10% (v/v) acetic acid for 1 h and
destained by over night incubation with 1 ml of 50 mM ammonium
bicarbonate-50% methanol at 37 C. Protein bands were excised and the
gel sections were incubated in 100 ll of a solution containing 50 mM
iodoacetamide/50 mM ammonium bicarbonate for 30 min in the dark at
room temperature. After washing with water, the gel bands were sub-
mitted to digestion in a final volume of 50 ll in a solution of 1 pmol of
trypsin (Sigma) in 50 mM ammonium bicarbonate buffer containing 10%
acetonitrile, for 24 h at 37 C. The resulting peptides were eluted in a
solution containing 50% acetonitrile, 50 mM ammonium bicarbonate, and
0.1% TFA. Liquid chromatography–tandem mass spectrometry (LC–MS/
MS) analysis was performed on a Q-Tof ultima API mass spectrometer
(Micromass, Manchester, UK) coupled to a capillary liquid chromatog-
raphy system (CapLC, Waters, Milford). A nanoflow ESI source was used
with a lockspray source for mass measurement during the entire chro-
matographic run. The digested protein was desalted online using a waters
Opti-Pak C18 trap column. The mixture of trapped peptides was then
separated by elution with an gradient of 20%–50% (water/acetonitrile)
0.1% formic acid gradient through a Nanoease C18 capillary column.
Data were acquired in data-dependent mode (DDA), and multiple charged
peptide ions (+2 and +3) were automatically mass selected and dissociated
in the MS/MS experiments. Typical LC and ESI conditions were: a 200 nl/
min flow, a nanoflow capillary voltage of 3 kV, a block temperature of
100 C, and 100 V cone voltage. The MS/MS spectra were processed using
Proteinlynx 2.0 software (Waters, Milford) and the PKL file generated was
used to perform database searches using the Mascot Software (Matrix
Science, London, UK).
Immunoprecipitation and immunoblotting. The cytoplasmic (C) and
nuclear (N) fractions were incubated for 4 h at 4 C with 4 ll (1 mg/ml) of
anti-hnRNPQ monoclonal antibody (Abcam-18E4). Then 20 ll of protein
A Sepharose beads (Pharmacia) was added for a further incubation of 1 h
and the beads were washed three times in the cytoplasmic buffer. Samples
were heated to 100 C for 5 min in the presence of SDS–PAGE sample
buffer and proteins were separated on a 10% polyacrylamide SDS-gel.
After SDS–PAGE, proteins were transferred to a nitrocellulose mem-
brane. The membrane was blocked for 1 h with 5% non-fat milk in Tris-
buffered saline (TBS) containing 0.1% Tween 20, washed, and incubated
for 1 h with a solution of 1:5000 of both mouse monoclonal antibody anti-
mono- and di-methylarginine (Abcam). The membranes were washed and
bound primary antibody was detected by alkaline phosphatase-conjugated
anti-mouse IgG antibody using the chromogenic substrates BCIP/NBT
(Sigma) for visualization.
Immunofluorescence analysis. HeLa cells grown on glass coverslips
were incubated or not with Adox (100 lg/ml) for 16 h at 37 C. To inhibit
de novo protein synthesis, we also added cycloheximide (100 lg/ml) and
chloramphenicol (40 lg/ml) during the last 4 h of the experiment. Next,
cells were fixed with 100% methanol and immunostained with primary
monoclonal mouse antibody anti-hnRNPQ (1:1000) and secondary FITC-
coupled anti-mouse antibody (1:100). DAPI staining was used for
counterstaining nuclei. Cells were examined with a Nikon fluorescence
microscope.
Transfection of HeLa cells. A construct of hnRNPQ was generated that
lacks the C-terminal region spanning amino acids 444–623. In this con-
struct, the cDNA encoding the N-terminal region of hnRNPQ(1–443) was
fused to the 3
0
-region of the DNA encoding Green fluorescent protein
(GFP) in vector pEGFP/C2 (Clontech). The recombinant vector con-
struct, encoding the fusion protein GFP-hnRNPQ(1–443), was then
transiently transfected in HeLa cells by lipid transfection using DOTAP
(Sigma), following the manufacturer’s instructions. Cells were counter-
stained with DAPI and analyzed 12 h post-transfection.
Acknowledgments
This work is financially supported by the Fundac¸a
˜
ode
Amparo a Pesquisa do Estado Sa
˜
o Paulo (FAPESP), the
Conselho Nacional de Pesquisa e Desenvolvimento
(CNPq), and the LNLS. We thank Maria Eugenia R. Cam-
argo for technical assistance, Dr. Carlos H.I. Ramos and
Luciana R. Camillo for DNA-sequencing. We also like to
acknowledge access to MAS-LNLS facilities and thank
Dr. Fabio Gozzo and Luciana R. Camillo for assistance
with mass spectrometry data acquisi tion and interpretation.
References
[1] Z. Mourelatos, L. Abel, J. Yong, N. Kataoka, G. Dreyfuss, SMN
interacts with a novel family of hnRNP and spliceosomal proteins,
EMBO J. 20 (2001) 5443–5452.
[2] V. Blanc, N. Navaratnam, J.O. Henderson, S. Anant, S. Kennedy, A.
Jarmuz, J. Scott, N.O. Davidson, Identification of GRY-RBP as an
apolipoprotein B RNA-binding protein that interacts with both
apobec-1 and apobec-1 complementation factor to modulate C to U
editing, J. Biol. Chem. 276 (2001) 10272–10283.
[3] P.P. Lau, B.H. Chang, L. Chan, Two-hybrid cloning identifies
an RNA-binding protein, GRY-RBP, as a component of apobec-
1 editosome, Biochem. Biophys. Res. Commun. 289 (2001) 977–
983.
[4] C.E. Harris, R.A. Boden, C.R. Astell, A novel heterogeneous nuclear
ribonucleoprotein-like protein interacts with NS1 of the minute virus
of mice, J. Virol. 73 (1999) 72–80.
D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525 523
Page 7
[5] G.C. Burd, G. Dreyfuss, RNA-binding specificity of hnRNP A1:
significance of hnRNP A1 high-affinity binding sites in pre-mRNA
splicing, EMBO J. 13 (1994) 1197–1204.
[6] C. Gamberi, E. Izaurralde, C. Beisel, I.W. Mattaj, Interaction
between the human nuclear cap-binding protein complex and hnRNP
F, Mol. Cell. Biol. 17 (1997) 2587–2597.
[7] A.B. Shyu, M.F. Wilkinson, The double lives of shuttling mRNA
binding proteins, Cell 102 (2000) 135–138.
[8] C.T. DeMaria, G. Brewer, AUF1 binding affinity to A+U-rich
elements correlates with rapid mRNA degradation, J. Biol. Chem.
271 (1996) 12179–12184.
[9] W. Rossoll, A.K. Kroning, U.M. Ohndorf, C. Steegborn, S.
Jablonka, M. Sendtner, Specific interaction of SMN, the spinal
muscular atrophy determining gene product, with hnRNP-R and gry-
rbp/hnRNP-Q: a role for SMN in RNA processing in motor axons?
Hum. Mol. Genet. 11 (2002) 93–105.
[10] L. Chan, B.H. Chang, W. Liao, K. Oka, P.P. Lau, Apolipoprotein B:
from editosome to proteasome, Recent Prog. Horm. Res. 125 (2000)
55–93.
[11] C. Grosset, C.Y. Chen, N. Xu, N. Sonenberg, H. Jacquemin-Sablon,
A.B. Shyu, A mechanism for translationally coupled mRNA
turnover: interaction between the poly(A) tail and a c-fos RNA
coding determinant via a protein complex, Cell 103 (2000) 29–40.
[12] T.D. Kim, J.S. Kim, J.H. Kim, J. Myung, H.D. Chae, K.C. Woo,
S.K. Jang, D.S. Koh, K.T. Kim, Rhythmic serotonin N-acetyltrans-
ferase mRNA degradation is essential for the maintenance of its
circadian oscillation, Mol. Cell. Biol. 25 (2005) 3232–3246.
[13] K.C.M. Moraes, A.J.C. Quaresma, F. Maehnss, J. Kobarg, Identi-
fication and characterization of proteins that selectively interact with
isoforms of the mRNA binding protein AUF1 (hnRNP D), Biol.
Chem. 384 (2003) 25–37.
[14] G.M. Wilson, Y. Sun, H. Lu, G. Brewer, Assembly of AUF1
oligomers on U-rich RNA targets by sequential dimer association, J.
Biol. Chem. 274 (1999) 33374–33381.
[15] M. Covic, P.O. Hassa, S. Saccani, C. Buerki, N.I. Meier, C.
Lombardi, R. Imhof, M.T. Bedford, G. Natoli, M.O. Hottiger,
Arginine methyltransferase CARM1 is a promoter-specific regulator
of NF-jB-dependent gene expression, EMBO J. 24 (2004) 85–96.
[16] K.A. Mowen, B.T. Schurter, J.W. Fathman, M. David, L.H.
Glimcher, Arginine methylation of NIP45 modulates cytokine gene
expression in effector T lymphocytes, Mol. Cell. 15 (2004) 559–
571.
[17] F.M. Boisvert, U. De
´
ry, J.Y. Masson, S. Richard, Arginine methyl-
ation of MRE11 by PRMT1 is required for the intra-S-phase DNA
damage checkpoint, Genes Dev. 19 (2005) 671–676.
[18] M.C. Boulanger, C. Liang, R.S. Russell, R. Lin, M.T. Bedford, M.A.
Wainberg, S. Richard, Methylation of Tat by PRMT6 regulates
human immunodeficiency virus type 1 gene expression, J. Virol. 79
(2005) 124–131.
[19] M.C. Yu, F. Bachand, A.E. McBride, S. Komili, J.M. Casolari, P.A.
Silver, Arginine methyltransferase affects interactions and recruitment
of mRNA processing and export factors, Genes Dev. 18 (2004) 2024–
2035.
[20] H.S. Scott, S.E. Antonarakis, M.D. Lalioti, C. Rossier, P.A. Silver,
M.F. Henry, Identification and characterization of two putative
human arginine methyltransferases (HRMT1L1 and HRMT1L2),
Genomics 48 (1998) 330–340.
[21] J. Tang, J.D. Gary, S. Clarke, H.R. Herschman, PRMT 3, a type I
protein arginine N-methyltransferase that differs from PRMT1 in its
oligomerization, subcellular localization, substrate specificity, and
regulation, J. Biol. Chem. 273 (1998) 16935–16945.
[22] D. Chen, H. Ma, H. Hong, S.S. Koh, S.M. Huang, B.T. Schurter,
D.W. Aswad, M.R. Stallcup, Regulation of transcription by a protein
methyltransferase, Science 284 (1999) 2174–2177.
[23] R. Jaerang, C. Seeyoung, S.Y. Rim, C. Won-Kyung, K.S. Hyeun, I.
Dong-Soo, PRMT5, which forms distinct homo-oligomers, is a
Member of the protein-arginine methyltransferase family, J. Biol.
Chem. 276 (2001) 11393–11401.
[24] A. Frankel, N. Yadav, J. Lee, T.L. Branscombe, S. Clarke, M.T.
Bedford, The novel human protein arginine N-methyltransferase
PRMT6 is a nuclear enzyme displaying unique substrate specificity, J.
Biol. Chem. 277 (2002) 3537–3543.
[25] T.B. Miranda, M. Miranda, A. Frankel, S. Clarke, PRMT7 is a
member of the protein arginine methyltransferase family with a
distinct substrate specificity, J. Biol. Chem. 279 (2004) 22902–
22907.
[26] L. Jaeho, S. Joyce, D. Jeremy, S. Clarke, M.T. Bedford, PRMT8 a
new membrane-bound tissue-specific member of the protein arginine
methyltransferase family, J. Biol. Chem. 280 (2005) 32890–32896.
[27] J.R. Cook, L. Jin-Hyung, Y. Zhi-Hong, C.D. Krause, N. Herth, R.
Hoffmann, S. Pestka, FBXO11/PRMT9, a new protein arginine
methyltransferase, symmetrically dimethylates arginine residues, Bio-
chem. Biophys. Res. Commun. 342 (2006) 472–481.
[28] J.D. Gary, W.J. Lin, M.C. Yang, H.R. Herschman, S. Clarke, The
predominant protein-arginine methyltransferase from Saccharomyces
cerevisiae, J. Biol. Chem. 271 (1996) 12585–12594.
[29] M.R. Pawlak, C.A. Scherer, J. Chen, M.J. Roshon, H.E. Ruley,
Arginine N-methyltransferase 1 is required for early postimplantation
mouse development, but cells deficient in the enzyme are viable, Mol.
Cell. Biol. 20 (2000) 4859–4869.
[30] Q. Liu, G. Dreyfuss, In vivo and in vitro arginine methylation of
RNA-binding proteins, Mol. Cell. Biol. 15 (1995) 2800–2808.
[31] J. Najbauer, B.A. Johnson, A.L. Young, D.W. Aswad, Peptides with
sequences similar to glycine, arginine-rich motifs in proteins inter-
acting with RNA are efficiently recognized by methyltransferase(s)
modifying arginine in numerous proteins, J. Biol. Chem. 268 (1993)
10501–10509.
[32] A.E. McBride, V.H. Weiss, H.K. Kim, J.M. Hogle, P.A. Silver,
Analysis of the yeast arginine methyltransferase Hmt1p/Rmt1p and
its in vivo function. Cofactor binding and substrate interactions, J.
Biol. Chem. 275 (2000) 3128–3136.
[33] W.J. Friesen, S. Paushkin, A. Wyce, S. Massenet, G.S. Pesiridis, G.V.
Duyne, J. Rappsilber, M. Mann, G. Dreyfuss, The methylosome, a
20S complex containing JBP1 and pICln, produces dimethylarginine-
modified Sm proteins, Mol. Cell. Biol. 21 (2001) 8289–8300.
[34] N. Yadav, J. Lee, J. Kim, J. Shen, M.C-T. Hu, C.M. Aldaz, M.T.
Bedford, Specific protein methylation defects and gene expression
perturbations in coactivator-associated arginine methyltransferase
1-deficient mice, Proc. Natl. Acad. Sci. USA 100 (2003) 6464–
6468.
[35] W. An, J. Kim, R.G. Roeder, Ordered cooperative functions of
PRMT1, p300, and CARM1 in transcriptional activation by p53, Cell
117 (2004) 735–748.
[36] W. Zhu, T. Mustelin, M. David, Arginine methylation of STAT1
regulates its dephosphorylation by T cell protein tyrosine phospha-
tase, J. Biol. Chem. 277 (2002) 35787–35790.
[37] W. Chen, M.O. Daines, G.K. Hershey, Methylation of STAT6
modulates STAT6 phosphorylation, nuclear translocation, and
DNA-binding activity, J. Immunol. 172 (2004) 6744–6750.
[38] P.L. Bartel, S. Fields, Analyzing protein-protein interactions using
the two-hybrid system, Methods Enzymol. 254 (1995) 241–263.
[39] K. Matsumoto, K. Aoki, N. Dohmae, K. Takio, M. Tsujimoto,
CIRP2, a major cytoplasmic RNA-binding protein in Xenopus
oocytes, Nucleic Acids Res. 28 (2002) 4689–4697.
[40] T. Jie, N.K. Peter, R.H. Harvey, Protein-arginine methyltransferase I,
the predominant protein-arginine methyltransferase in cells, interacts
with and is regulated by interleukin enhancer-binding fsactor 3, J.
Biol. Chem. 275 (2000) 19866–19876.
[41] M. Yangida, T. Hayano, Y. Yamauchi, T. Shinkawa, T. Natsume, T.
Isobe, N. Takahasi, Human fibrillarin forms a sub-complex with
splicing factor 2-associated p32, protein arginine methyltransferases,
and tubulins a3 and b1 that is independent of its association with
preribosomal ribonucleoprotein complexes, J. Biol. Chem. 279 (2004)
1607–1614.
[42] N. Araya, H. Hiraga, K. Kayo, Y. Arao, S. Kato, A. Fukamizu,
Transcriptional down-regulation through nuclear exclusion of EWS
524 D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525
Page 8
methylated by PRMT1, Biochem. Biophys. Res. Commun. 329 (2004)
653–660.
[43] G. Mangiarotti, Two Dictyostelium ribosomal proteins act as Rnases
for specific classes of mRNAs, Biochem J. 370 (2003) 713–717.
[44] T.A. Lemos, D.O. Passos, F.C. Nery, J. Kobarg, Characterization of a
new family of proteins that interact with the C-terminal region of the
chromatin-remodeling factor CHD-3, FEBS Lett. 533 (2003) 14–20.
[45] F.C. Nery, D.O. Passos, V.S. Garcia, J. Kobarg, Ki-1/57 interacts
with RACK1 and is a substrate for the phosphorylation by phorbol
12-myristate 13-acetate activated protein kinase C, J. Biol. Chem. 279
(2004) 11444–11455.
[46] F.C. Nery, E. Rui, T.M. Kuniyoshi, J. Kobarg, Evidence for the
interaction of the regulatory protein Ki-1/57 with p53 and its
interacting proteins, Biochem. Biophys. Res. Commun. 341 (2006)
847–855.
[47] S.W. Alice, M.J. Kim, S. Jianguo, P.M. Trent, J.S. Mark, S.H. Keith,
S. Ross, Heterogeneous nuclear ribonucleoprotein A3, a novel RNA
trafficking response element-binding protein, J. Biol. Chem. 277
(2002) 18010–18020.
[48] A.M. Zahler, W.S. Lane, J.A. Stolk, M.B. Roth, SR proteins: a
conserved family of pre-mRNA splicing factors, Genes Dev. 6 (1992)
837–847.
[49] M. Baumann, O. Gires, W. Kolch, H. Mischak, R. Zeidler, D. Pich,
W. Hammerschmidt, The PKC targeting protein RACK1 interacts
with the Epstein-Barr virus activator protein BZLF, Eur. J. Biochem.
267 (2000) 3891–3901.
D.O. Passos et al. / Biochemical and Biophysical Research Communications 346 (2006) 517–525 525
Page 9
    • "hnRNP Q has been previously shown to be methylated in vitro by PRMT1 and its in vivo methylation is important for its nuclear localization [26] and for insulin receptor trafficking and insulin signalling [27]. The small nuclear ribonucleoprotein B and B1 (snRNPB), which is involved in several steps of the biogenesis of the snRNPs, has also been found methylated on arginine residues but the PRMT responsible for this modification has not been identified yet [28]. "
    [Show abstract] [Hide abstract] ABSTRACT: PRMT6 is a protein arginine methyltransferase that has been implicated in transcriptional regulation, DNA repair, and human immunodeficiency virus pathogenesis. Only few substrates of this enzyme are known and therefore its cellular role is not well understood. To identify in an unbiased manner substrates and potential regulators of PRMT6 we have used a yeast two-hybrid approach. We identified 36 new putative partners for PRMT6 and we validated the interaction in vivo for 7 of them. In addition, using in vitro methylation assay we identified 4 new substrates for PRMT6, extending the involvement of this enzyme to other cellular processes beyond its well-established role in gene expression regulation. Holistic approaches create molecular connections that allow to test functional hypotheses. The assembly of PRMT6 protein network allowed us to formulate functional hypotheses which led to the discovery of new molecular partners for the architectural transcription factor HMGA1a, a known substrate for PRMT6, and to provide evidences for a modulatory role of HMGA1a on the methyltransferase activity of PRMT6.
    No preview · Article · Nov 2013 · PLoS ONE
    • "Multiple hnRNP-Q isoforms (seven in humans and two in mouse) are derived from alternative splicing of a single gene [37]. Posttranslational modifications of hnRNP-Q, which include phosphorylation and methylation, may determine its subcellular localization and RNAbinding properties [46,47]. In mouse, the small (562 amino acid long) splicing variant of hnRNP-Q, referred to as SYNaptotagminbinding Cytoplasmic RNA-Interacting Protein (SYNCRIP) or hnRNP-Q isoform 2 (hnRNP-Q2; accession number NP_062770.1), "
    [Show abstract] [Hide abstract] ABSTRACT: Author Summary The regulation of mRNA translation and stability is of paramount importance for almost every cellular function. In eukaryotes, the poly(A) binding protein (PABP) is a central regulator of both global and mRNA-specific translation. PABP simultaneously interacts with the 3′ poly(A) tail of the mRNA and the eukaryotic translation initiation factor 4G (eIF4G). These interactions circularize the mRNA and stimulate translation. PABP also regulates specific mRNAs by promoting miRNA-dependent deadenylation and translational repression. A key step in understanding PABP's functions is to identify factors that affect its association with the poly(A) tail. Here we show that the cytoplasmic isoform of the mouse heterogeneous nuclear ribonucleoprotein Q (hnRNP-Q2/SYNCRIP), which exhibits binding preference to poly(A), interacts with the poly(A) tail by default when PABP binding is inhibited. In addition, hnRNP-Q2 competes with PABP for binding to the poly(A) tail. Depleting hnRNP-Q2 stimulates translation in cell-free extracts and in cultured cells, in agreement with its function as translational repressor. In addition, hnRNP-Q2 impeded miRNA-mediated deadenylation and repression of target mRNAs, which requires PABP. Thus, competition from hnRNP-Q2 provides a novel mechanism by which multiple functions of PABP are regulated. This regulation could play important roles in various biological processes, such as development, viral infection, and human disease.
    Full-text · Article · May 2013 · PLoS Biology
    • "In mammalian cells, arginine methylation facilitates nuclear import or slowing of nuclear export of these hnRNPs. This role is supported by the observation that the suppression, in the cases of hnRNP A2 and Q, of arginine methylation leads to a shift from predominately nuclear localization to predominately cytoplasmic localization [46] [47] [53]. Treatment with the methyltransferase inhibitor adenosine dialdehyde (AdOx) resulted in increased cytoplasmic localization of Src substrate-associated during mitosis (Sam68), an RNA-binding protein that belongs to the hnRNP K homology (KH) domain family [54]. "
    [Show abstract] [Hide abstract] ABSTRACT: In eukaryotes, messenger RNA biogenesis depends on the ordered and precise assembly of a nuclear messenger ribonucleoprotein particle (mRNP) during transcription. This process requires a well-orchestrated and dynamic sequence of molecular recognition events by specific RNA-binding proteins. Arginine methylation is a posttranslational modification found in a plethora of RNA-binding proteins responsible for mRNP biogenesis. These RNA-binding proteins include both heterogeneous nuclear ribonucleoproteins (hnRNPs) and serine/arginine-rich (SR) proteins. In this paper, I discuss the mechanisms of action by which arginine methylation modulates various facets of mRNP biogenesis, and how the collective consequences of this modification impart the specificity required to generate a mature, translational- and export-competent mRNP.
    Full-text · Article · Apr 2011
Show more

Similar publications

Discover more