Supervillin modulation of focal adhesions involving TRIP6/ZRP-1

Article (PDF Available)inThe Journal of Cell Biology 174(3):447-58 · August 2006with37 Reads
DOI: 10.1083/jcb.200512051 · Source: PubMed
Cell-substrate contacts, called focal adhesions (FAs), are dynamic in rapidly moving cells. We show that supervillin (SV)--a peripheral membrane protein that binds myosin II and F-actin in such cells--negatively regulates stress fibers, FAs, and cell-substrate adhesion. The major FA regulatory sequence within SV (SV342-571) binds to the LIM domains of two proteins in the zyxin family, thyroid receptor-interacting protein 6 (TRIP6) and lipoma-preferred partner (LPP), but not to zyxin itself. SV and TRIP6 colocalize within large FAs, where TRIP6 may help recruit SV. RNAi-mediated decreases in either protein increase cell adhesion to fibronectin. TRIP6 partially rescues SV effects on stress fibers and FAs, apparently by mislocating SV away from FAs. Thus, SV interactions with TRIP6 at FAs promote loss of FA structure and function. SV and TRIP6 binding partners suggest several specific mechanisms through which the SV-TRIP6 interaction may regulate FA maturation and/or disassembly.
© The Rockefeller University Press $8.00
The Journal of Cell Biology, Vol. 174, No. 3, July 31, 2006 447–458
JCB 447
Cell adhesion to the extracellular matrix plays an essential role
during cell migration. Transmembrane integrins at focal adhe-
sions (FAs) undergo cycles of matrix attachment, cytoskeletal
recruitment, induction of contractile forces, and disassembly
(Ridley et al., 2003). Nascent FAs form at or near anterior cell
margins and mature into larger FAs under the middle and rear
of the migrating cell. Some proteins, e.g., vinculin, are pre-
sent for nearly the lifetime of a FA, whereas other proteins
appear during maturation (Zaidel-Bar et al., 2004). Although
both nascent and mature FAs are associated with stress  bers
containing F-actin, α-actinin, and bipolar myosin II  laments
(Zaidel-Bar et al., 2004), nascent FAs are responsible for
most of the contractile forces (Beningo et al., 2001; Galbraith
et al., 2002). Mature FAs retard the rate of cell translocation
( Kaverina et al., 2002) and generate signals for cell survival
and transcriptional activation (Alahari et al., 2002; Wang and
Gilmore, 2003). FA disassembly/turnover is facilitated by Src
family tyrosine kinases, adaptor proteins such as Crk, extra-
cellular factor– regulated kinases (ERKs), selective proteoly-
sis, and/or microtubules (Ridley et al., 2003; Carragher and
Frame, 2004) and may be enhanced in fast-moving cells, such
as immune cells and many tumor cells, especially invasive
carcinomas (Kaverina et al., 2002; Carragher and Frame, 2004;
Hogg et al., 2004).
Reorganization of FAs stimulated by mechanical cues
involves zyxin and associated proteins (Yoshigi et al., 2005;
Lele et al., 2006). The appearance of zyxin at FAs coincides
with the loss of strong traction forces (Beningo et al., 2001),
which is consistent with a role during maturation (Zaidel-Bar
et al., 2004).
Other proteins related to zyxin found at mature FAs are
lipoma-preferred partner (LPP; Petit et al., 2003) and thyroid
receptor–interacting protein (TRIP6; Yi and Beckerle, 1998),
which is also called zyxin-related protein 1 (ZRP-1) and Opa-
interacting protein 1 (Zumbrunn and Trueb, 1996; Williams
et al., 1998). Each zyxin family member contains an N- terminal
domain that promotes local actin  lament assembly and a
C-terminal domain with three LIM domains, which are zinc
nger motifs found in many cytoplasmic and nuclear proteins
(Kadrmas and Beckerle, 2004).
The TRIP6 LIM domains bind to other proteins with LIM
domains (Cuppen et al., 2000), to endoglin/CD105, which is
a component of the TGF-β receptor complex (Sanz-Rodriguez
Supervillin modulation of focal adhesions involving
Norio Takizawa,
Tara C. Smith,
Thomas Nebl,
Jessica L. Crowley,
Stephen J. Palmieri,
Lawrence M. Lifshitz,
Anka G. Ehrhardt,
Laura M. Hoffman,
Mary C. Beckerle,
and Elizabeth J. Luna
Department of Cell Biology, and
Department of Physiology, University of Massachusetts Medical School, Worcester, MA 01605
Huntsman Cancer Institute, University of Utah, Salt Lake City, UT 84112
ell–substrate contacts, called focal adhesions (FAs),
are dynamic in rapidly moving cells. We show that
supervillin (SV)—a peripheral membrane protein
that binds myosin II and F-actin in such cells—negatively
regulates stress fi bers, FAs, and cell–substrate adhesion.
The major FA regulatory sequence within SV (SV342-571)
binds to the LIM domains of two proteins in the zyxin
family, thyroid receptor–interacting protein 6 (TRIP6) and
lipoma-preferred partner (LPP), but not to zyxin itself.
SV and TRIP6 colocalize within large FAs, where TRIP6 may
help recruit SV. RNAi-mediated decreases in either pro-
tein increase cell adhesion to fi bronectin. TRIP6 partially
rescues SV effects on stress fi bers and FAs, apparently by
mislocating SV away from FAs. Thus, SV interactions with
TRIP6 at FAs promote loss of FA structure and function.
SV and TRIP6 binding partners suggest several specifi c
mechanisms through which the SV–TRIP6 interaction may
regulate FA maturation and/or disassembly.
Correspondence to Elizabeth J. Luna:
T. Nebl’s present address is Department of Infection and Immunity, The Walter
and Eliza Hall Institute of Medical Research, VIC 3050, Australia.
S.J. Palmieri’s present address is Sensor Technologies, Shrewsbury,
MA 01545.
Abbreviations used in this paper: ATCC, American Type Culture Collection; AV,
archvillin; CAS, Crk-associated substrate; ERK, extracellular factor–regulated
kinase; ds, double-stranded; FA, focal adhesion; LPA, lysophosphatidic acid;
LPP, lipoma-preferred partner; PTP, protein tyrosine phosphatase; SmAV, smooth
muscle AV; SV, supervillin; TRIP, thyroid receptor–interacting protein; ZRP-1,
zyxin-related protein 1.
The online version of this article contains supplemental material.
JCB VOLUME 174 NUMBER 3 2006 448
et al., 2004), to the protein tyrosine phosphatase (PTP) nonre-
ceptor type 13 (PTPN13, PTP1E, FAP-1; Murthy et al., 1999;
Cuppen et al., 2000), to Crk and the Crk-associated substrates
(CAS) p130
and CASL/HEF1 (Yi et al., 2002), and to the
membrane-bound, G protein–coupled lysophosphatidic acid 2
) receptor (Xu et al., 2004). The latter two interactions are
potentiated by Src phosphorylation of Tyr-55 in TRIP6 (Lai
et al., 2005), suggesting regulatory interactions between the
TRIP6 N and C termini. The TRIP6 C terminus also binds to
class 1 PDZ motifs (Cuppen et al., 2000; Harris and Lim, 2001),
and the N terminus contains a nuclear export signal and trans-
activates gene expression (Wang and Gilmore, 2001; Kassel
et al., 2004; Li et al., 2005).
TRIP6 has been implicated in the organization of actin
laments and in the control of cell migration with con icting
results. Knockdown of TRIP6 in human endothelial cells re-
sults in the disruption of cytoskeletal actin  laments (Sanz-
Rodriguez et al., 2004). Overexpression of TRIP6 in mouse
broblasts slows cell movements (Yi et al., 2002), whereas
overexpression in SKOV3 ovarian carcinoma cells increases
LPA-mediated cell migration and ERK activation (Xu et al.,
2004; Lai et al., 2005). Nothing is known about the role of
TRIP6 in cell–substrate adhesion or FA dynamics, leaving open
questions about cell type–speci c factors and regulation of dif-
ferent steps during cell migration.
In our exploration of membrane domains in highly motile
cells, we have characterized a detergent-resistant plasma mem-
brane fraction from neutrophils (Pestonjamasp et al., 1997;
Nebl et al., 2002). This fraction contains F-actin, α-actinin,
myosin II, cholesterol-organizing proteins, heterotrimeric G
proteins, and the Src family kinase Lyn. The most tightly bound
peripheral membrane protein, called supervillin (SV), is also
relatively enriched in most carcinoma cell lines (Pestonjamasp
et al., 1997; Pope et al., 1998).
SV binds tightly to F-actin and the S2 regulatory domain
of myosin II, as well as to membranes (Pestonjamasp et al.,
1997; Chen et al., 2003), and is implicated in both nuclear and
membrane processes. Although SV contains functional NLS
(Wulfkuhle et al., 1999) and can transactivate androgen
receptor–mediated gene expression (Ting et al., 2002), 95%
of total SV localizes with membranes in differentiated cells
( Pestonjamasp et al., 1997; Oh et al., 2003). As the only mem-
brane protein known to bind both myosin II and F-actin, SV
may organize actin and myosin II  laments at the membrane
and/or mediate actin-independent binding of myosin II to mem-
branes (Nebl et al., 2002; Chen et al., 2003). SV sequences can
induce F-actin cross-linking and bundling, myosin II mislocal-
ization, and disruption of vinculin localization at ventral cell
surfaces (Wulfkuhle et al., 1999; Chen et al., 2003). Alternatively
spliced forms of SV, which are found in striated and smooth
muscle (archvillin [AV] and smooth muscle AV [SmAV], re-
spectively), are implicated in costamere organization, ERK sig-
naling, contractility, and myogenic differentiation (Oh et al.,
2003; Gangopadhyay et al., 2004).
We now show that SV promotes a process leading to the
loss of cell–substrate adhesion and large FA. We have also iden-
ti ed the region of SV responsible for this activity as aa 342–571
and characterized relevant SV342-571 binding partners. SV-
mediated down-regulation of FAs involves binding to TRIP6
and, possibly, also to LPP. SV and TRIP6 negatively regulate
large FAs, either by blocking maturation or by facilitating
disassembly. This interaction may regulate cell–substrate adhe-
sion through the recruitment of actin and/or myosin II to TRIP6-
associated signaling networks and could play a role in FA
signaling to the nucleus.
SV negatively regulates FA structure
and function
EGFP-SV at low levels overlaps with vinculin at or near FAs on
the basal surfaces of CV1 (Wulfkuhle et al., 1999) and COS7
(Fig. S1, available at
jcb.200512051/DC1) cells. This overlap is more pronounced at
large, mature FAs in the center and posterior of the cell than
at newly formed FAs at the cell periphery (Fig. S1, arrow).
SV also localizes along associated stress  bers; this signal in-
creases disproportionately with increasing amounts of EGFP-SV
( Wulfkuhle et al., 1999).
SV targeting to large FAs apparently reduces the number
of these structures (Fig. 1). Large vinculin-labeled FAs are
abundant in COS7 cells that overexpress EGFP (Fig. 1 A,
a and b), but most large vinculin spots are lost in cells that over-
express EGFP-SV (Fig. 1 A, c and d). We  nd an 1:1 ratio of
EGFP-SV to endogenous SV in lysates from preparations with
20% transfected cells (Fig. 1 B), indicating that the average
level of EGFP-SV in the transfected cells is approximately  ve
times greater than endogenous SV, for a total of approximately
six times more SV than in untransfected cells. We normalized
the amount of  uorescence in cells transfected with EGFP alone
or EGFP-SV so that cells with approximately sixfold over-
expression of SV exhibit 50% of maximal  uorescence intensity
(Fig. 1 C). The number of large FAs (10 μm
) in cells express-
ing EGFP-SV with 30–90% of maximal  uorescence are less
than half those observed in cells expressing equivalent amounts
of EGFP alone or in untransfected cells (Fig. 1, C and D). Thus,
even an approximately threefold increase in SV levels down-
regulates the number of large FAs.
Cell–substrate adhesion also correlates inversely with SV
levels (Fig. 1, E and F). After preparative FACS, COS7 cells
expressing EGFP-SV contain 6.3-fold more SV than cells ex-
pressing EGFP (Fig. 1 E, top) and are signi cantly less adherent
to  bronectin-coated coverslips (Fig. 1 E, bottom). Conversely,
cells with 10% of endogenous levels of SV adhere more
tightly to  bronectin (Fig. 1 F, bottom). Collectively, these re-
sults show an inverse correlation between SV levels and FA
function, although any increases in the number and/or size of
mature FAs after SV knockdown lack statistical signi cance
(unpublished data).
Identifi cation of FA regulatory sequences
To identify SV sequences responsible for loss of FA integ-
rity, we quanti ed the number of total and large FAs in COS7
cells expressing different EGFP-tagged SV constructs (Fig. 2).
Full-length SV (Fig. 2 A, SV1-1792) reduces the number of
large vinculin foci (Fig. 1 A–D and Fig. 2 E), but has relatively
little effect on the number of the more abundant, smaller foci
near cell peripheries (Fig. 2 B, b). The result is the absence of
a statistically signi cant effect on the number of total FAs per
cell (Fig. 2 C). The SV N terminus (SV1-830) decreases the
number of both total and large FAs, whereas the SV C terminus
(SV830-1792) exhibits effects similar to those of full-length SV
(Fig. 2, B, C, and E). Thus, a sequence with major impact on FA
stability resides within the SV N terminus.
Further dissection of N-terminal SV sequences identi es
SV1-174 and SV342-571 as FA disruption sequences (Fig. 2, B,
D, and F). Both of these sequences signi cantly reduce the num-
ber of large FAs (Fig. 2 F), but only SV342-571 signi cantly re-
duces the total number of vinculin foci per cell (Fig. 2 D).
COS-7 cells transfected with SV or SV N-terminal se-
quences also exhibit decreased numbers of large F-actin
Figure 1. Inverse correlation between SV levels and FA structure and
function. (A) Increasing levels of EGFP-SV (c and d), but not EGFP alone
(a and b), decrease the number of FAs that stain brightly with anti-vinculin
antibody (b and d). Bar, 10 μm. (B) Immunoblots of lysates from COS7
cells overexpressing EGFP-SV (lane 1) or EGFP (lane 2) stained with anti-
SV antibody and for β-actin, as a loading control. (C) Scatter plot of vinculin-
stained foci per cell versus relative intensity level of EGFP-SV (red) or EGFP
alone (blue). Cells expressing <5% of maximal fl uorescence were as-
sumed to be untransfected (black). (D) Box plot of the data in C, showing
medians (white lines), 95% confi dence intervals (red) between the fi rst and
third quartiles (green), and minimal and maximal points (brackets) for un-
transfected (1), EGFP-expressing (2), and EGFP-SV–expressing (3) COS-7
cells. Number of cells (n), as shown. Differences between cells expressing
EGFP-SV versus EGFP alone (P = 0.0038) or untransfected cells (P 0.001)
are statistically signifi cant (***). (E) Immunoblot of SV levels in cells
overexpressing EGFP-SV (lane 1) or EGFP (lane 2) and histogram of
bronectin-adhered cells after centrifugation (bottom). Mean ± the SEM.
n = 3. *, P < 0.05. (F) Immunoblot of endogenous SV and (bottom) histo-
gram of adherent cells showing that RNAi-mediated decreases in SV levels
correlate with increased cell adhesion to fi bronectin. Reagent alone (lane
1, Mock), dsRNAs 2,472 or 668 that target SV (lanes 2 and 4, SV1 and
SV2), or control 2,472 Rev or 668con dsRNAs (lanes 3 and 5, Con 1 and
Con 2). Endogenous SV (205 kD) was detected with anti-H340 antibody;
β-actin was the loading control. Mean ± the SEM. n = 4. *, P < 0.05;
**, P < 0.01.
Figure 2. Disruption of FA by SV sequences, especially SV1-174 and
SV342-571. (A) SV structure showing construct boundaries relative to bind-
ing sites for myosin II heavy chain (M), F-actin (A), androgen receptor (R),
and calponin (C) and muscle-specifi c exons (arrowheads), nuclear local-
ization sequences (NLS), and the villin/gelsolin homology region (villin
homology). (B) Fluorescence micrographs showing vinculin (red) and
EGFP-tagged chimeric proteins containing the designated SV amino acids
(green). Bar, 20 μm. (C–F) Quantifi cation of total (C and D) and large
(E and F) vinculin-stained foci in COS7 cells expressing moderate levels
of each EGFP chimera. Mean ± the SEM from 18–25 cells per construct.
**, P < 0.01; ***, P < 0.001.
JCB VOLUME 174 NUMBER 3 2006 450
bundles (Fig. 3). Although full-length SV with its three F-actin–
binding sites (Chen et al., 2003) increases the number of thin
actin structures (Wulfkuhle et al., 1999), SV overexpression
greatly decreases the number and size of large, straight ac-
tin bundles (Fig. 3 A, compare b with a). However, most SV-
expressing cells still contain at least one large basal F-actin bundle
(Fig. 3 B). Because most of these bundles exhibit periodic
staining for α-actinin (Wulfkuhle et al., 1999) and myosin II
(unpublished data), we refer to them here as “stress  bers,” al-
though they are smaller and less well organized than are stress
bers in  broblasts.
Consistent with their effects on FA structure (Fig. 2),
SV1-830 and SV342-571 signi cantly decrease the number of
COS7 cells containing at least one stress  ber, as compared
with cells expressing EGFP alone or other EGFP-SV fragments
(Fig. 3, A–C). SV1-830 and SV342-571 also decrease the num-
ber and thickness of stress  bers in CV1 cells (unpublished
data). Thus, SV342-571 contains a site that is primarily respon-
sible for the morphological effects of SV and SV1-830 on FAs
and stress  ber organization and function.
In support of this conclusion, SV342-571 reduces the con-
tractility of CV1 cells (Fig. 4 and Table I). Signi cant percentages
of cells expressing EGFP only or other EGFP-SV N-terminal se-
quences deform  exible silicon substrates, forming “ wrinkles”
(Fig. 4 and Table I). In contrast, wrinkles are absent from the
areas around most CV1 cells expressing SV342-571 (Table I),
even cells near untransfected cells that are actively wrinkling the
substrate, thus, demonstrating its local deformability (Fig. 4 C,
arrow vs. arrowhead). Thus, SV342-571 contains sequences ca-
pable of reducing FA structure and function.
Identifi cation of SV342-571
binding partners
We hypothesized that a previously unknown interaction medi-
ated the effects of SV342-571 on FAs. The only known binding
partner for SV342-571 is F-actin (Fig. 2 A), but F-actin also
binds to SV171-342 and SV570-830 (Chen et al., 2003), nei-
ther of which affects FA structure and function to the same ex-
tent (Figs. 2–4 and Table I). To identify candidate interactors
with SV342-571, we undertook an undirected yeast two-hybrid
screen. Because SV343-570, SV171-570, and SV343-830 all
self-activated reporter gene expression (unpublished data),
our bait plasmid encoded SV171-830. 11 prey proteins were
identi ed and con rmed by directed yeast two-hybrid assays
(Table II). These proteins were further screened using baits en-
coding either SV171-343 or SV570-830. Only the longer plas-
mid (SV171-830) containing SV343-570 sequences interacted
strongly with the prey proteins.
Two interactors, TRIP6/ZRP-1 and Tctex-1/DYNLT1, ac-
count for a majority of the clones identi ed in these screens
(Fig. 5). Ten independent clones encode all three C-terminal
LIM domains of TRIP6. Another clone encodes the  rst two
LIM domains of LPP, suggesting that two or more LIM domains
are required for binding. Six independent clones encode full-
length Tctex-1, which is a dynein light chain (DYNLT1).
We con rmed binding interactions with TRIP6 and
Tctex-1 using pull-down assays with GST fusion proteins con-
taining SV343-571 (Fig. 6). V5-tagged TRIP6 LIM domains
(Fig. 6 A) and V5-tagged full-length Tctex-1 (Fig. 6 B) copellet
Figure 3. Disruption of stress fi bers by SV and fragments, especially
SV342-571. (A) Fluorescence micrographs showing phalloidin-stained
F-actin (red) and EGFP-tagged chimeric proteins (green). Bar, 20 μm.
(B and C) Percentages of transfected COS-7 cells expressing moderate lev-
els of each EGFP chimera, and even one basal F-actin bundle. Mean ± the
SEM. n = 3, 100 cells/experiment. ***, P < 0.001.
Figure 4. SV342-571 reduces contractility of CV1 cells attached to gelatin-
coated fl exible silicon substrates. Cells transfected with EGFP-SV1-174
(A), EGFP-SV171-342 (B), EGFP-SV342-571 (C), EGFP-SV570-830 (D),
or EGFP alone (E) were scored for the presence of wrinkles (arrowheads;
Table I). In contrast to transfected (A, B, D, and E) and untransfected
(C, arrowhead) cells, CV1 cells expressing EGFP-SV342-571 (C, arrow)
were largely unable to generate wrinkles. Micrographs show merges of
differential interference contrast (gray scale) and EGFP (green) images.
Bar, 20 μm.
Table I. Quantifi cation of cell deformability
EGFP construct Wrinkled cell Total cells % No. expts
SV1-174 15 28 54% 5
SV171-342 10 28 36% 4
SV342-571 2 31 6% 5
SV570-830 18 61 30% 4
EGFP only 20 29 69% 4
Pooled number of wrinkled cells, total cells, and percentages of wrinkled cells
from 4–5 experiments with sparsely spread CV1 cells expressing the designated
EGFP chimeric proteins. No. expts, number of experiments.
with glutathione–Sepharose beads containing GST-tagged
SV171-830, SV343-571, SV171-571, and SV343-830 (Fig. 6,
A and B, lanes 2, 5, 7, and 8). Neither V5-tagged protein cosedi-
ments with beads containing GST only or SV171-342 (Fig. 6,
A and B, lanes 3 and 4). A low-af nity interaction with SV570-
830 is observed for Tctex-1 (Fig. 6 B, lane 6). No proteins re-
active with the anti-V5 antibody are detectable in control yeast
extracts (Fig. 6, A and B, lane 9), con rming the binding speci-
cities of TRIP6 and Tctex-1 for SV342-571.
Binding of SV342-571 to TRIP6 or Tctex-1 is also ob-
served in doubly transfected COS7 cells. Myc-tagged TRIP6
LIM domains and Tctex-1 cosediment with GST-tagged EGFP-
SV342-571, but not with EGFP-GST alone (Fig. 6 C, lane 3
vs. 4). Notably, neither Myc-tagged LIM domains from zyxin
nor Flag-tagged, full-length TRIP6 cosediments with EGFP-
SV342-571-GST. Coimmunoprecipitation of full-length pro-
teins was precluded by the inextractability of full-length SV
(Pestonjamasp et al., 1997; Nebl et al., 2002).
The TRIP6 LIM domains and Tctex-1 bind directly
to overlapping sequences within SV343-571 (Fig. 6, D–F).
Puri ed, bacterially expressed hexahistidine (6×His)-tagged
TRIP6 LIM domains (Fig. 6 D) and 6×His-Tctex-1 (Fig. 6 E)
cosediment with glutathione–Sepharose beads containing pre-
bound, puri ed GST-SV343-571 (Fig. 6, D and E, lane 2), but
not with beads bound to GST alone (Fig. 6, D and E, lane 4).
Increasing amounts of 6×His-tagged Tctex-1 compete with
6×His-tagged TRIP6 LIM domains for binding to a  xed, lim-
iting amount of GST-SV343-571 (Fig. 6 F).
Point mutagenesis provides further support for competi-
tion between TRIP6 and Tctex-1 for binding to SV343-571.
Conversion of the highly conserved SV residues Arg-426 and
Tyr-427 to alanines (RY/AA) coordinately reduces binding
of GST-SV343-571-RY/AA to both TRIP6 and Tctex-1 by
70% (Fig. 6 G). Similarly, mutagenesis of these residues
in EGFP-SV343-571 reduces this protein’s effects on stress
ber and FA structure (Fig. S2, available at
org/cgi/content/full/jcb.200512051/DC1), demonstrating the
functional importance of the TRIP6/Tctex-1–binding site
within SV342-571.
Physiological relevance of the SV–TRIP6
To determine whether the SV interaction with TRIP6 and/or
with Tctex-1 is involved in SV-mediated changes in FA struc-
ture and function, we colocalized these proteins in A7r5 (Fig. 7)
and COS7 (Fig. 8) cells. Endogenous levels of the relatively
abundant SmAV (Gangopadhyay et al., 2004) partially colocal-
ize with endogenous vinculin (Fig. 7, b–d) and TRIP6 (Fig. 7,
j–l) in A7r5 cells on  bronectin (Fig. 7, a, e, and i). The SmAV
signal is a subset of that for vinculin and TRIP6 in FAs, but stops
short of the labeling for these two proteins at cell edges. This
result is consistent with a r ole for the SV– TRIP6 interaction in
regulating adhesion, but is uninformative about Tctex-1 because
we could not detect Tctex-1 in A7r5 cells ( unpublished data).
Figure 5. TRIP6/ZRP-1 and Tctex-1/DYNLT1 are the prey proteins ob-
tained most frequently in yeast two-hybrid screens with SV171-830 as
bait. Amino acid numbers of encoded prey proteins are shown, as are the
locations of proline-rich (P) and nuclear export sequences (NES; black
bars). Similarly sized independent clones are shown together with their
N-terminal amino acids, e.g., fi ve clones initiating at TRIP6 aa 212–216.
Table II. Potential binding partners for SV342-571
Interactor Number of clones Directed yeast two-hybrid assay results
(d1; d2; Ind) SV171-830 SV171-343 SV571-830
TRIP6 (NM_003302) 17; 7; 10 ++ ––
Tctex-1 (NM_006519) 7; 9; 6 ++ ––
CXXCF1 (NM_014593) 2; 0; 1 ++ +
GOLGA2 (NM_004486) 1; 0; 1 ++ +
AMOTL2 (NM_016201) 1; 0; 1 ++ ––
LPP (NM_005578) 0; 1; 1 ++ ––
CTBP2 (NM_022802) 0; 1; 1 ++ ––
MAD1 (NM_003550) 0; 1; 1 ++ +
AD023 (NM_020679) 0; 1; 1 ++ ––
GRP78 (NM_005347) 0; 1; 1 ++ +
KIF4A (NM_012310) 0; 1; 1 ++ +
Positive interactors for SV171-830 were identifi ed in an untargeted yeast two-hybrid assay and screened for interactions with SV171-343 and SV571-830 in directed
assays for leucine autotrophy and β-galactosidase. Names, nucleic acid accession numbers, the number of clones containing each interactor identifi ed on day 1 (d1)
or day 2 (d2), and the number of independent clones (Ind) are shown. ++, passed both requirements for positive interaction; +: passed β-galactosidase test only.
In addition to TRIP6, LPP, and Tctex-1 (Fig. 5), potential interactors include the following: CXXC fi nger 1 (CXXCF1); Golgi autoantigen, golgin subfamily a, 2
(GOLGA2, GM130); angiomotin-like 2 (AMOTL2); C-terminal binding protein 2 (CTBP2); mitotic arrest defi cient-like 1 (MAD1); glucose-regulated protein 78 kD
(GRP78); and kinesin family member 4 (KIF4A).
JCB VOLUME 174 NUMBER 3 2006 452
Figure 6. SV343-571 binds to both TRIP6
and Tctex-1 in GST pull-down assays. Immuno-
blots with anti-V5 antibody of extracts (A and
B, lane 1) from yeast expressing V5-tagged
TRIP6 LIM domains (A) or V5-tagged full-length
Tctex-1 (B). Specifi cally bound proteins were
eluted with glutathione from glutathione–
Sepharose columns with prebound GST-
tagged SV proteins (1.0 nmol), as shown.
V5- immunoreactive proteins were absent from
control (Con) extracts (A and B, lane 9). (C) Im-
munoblots with anti-tag antibodies, as shown
on the left, of COS-7 cell lysates (lanes 1 and 2)
or lysate proteins eluted from glutathione–
Sepharose (lanes 3 and 4). The COS-7 cells
coexpressed either EGFP-SV342-571-GST
(lanes 1 and 3, top) or EGFP-GST (lanes 2 and
4, top) and the tagged constructs indicated
on the right. Although Flag-tagged full-length
TRIP6 (second row) and Myc-tagged zyxin
LIM domains (fourth row) bound neither GST
protein, the Myc-tagged LIM domains of TRIP6
(third row) and Myc-tagged Tctex-1 (fi fth row)
each cosedimented with EGFP-SV342-571-
GST, but not with EGFP-GST. Direct binding
in vitro of 6×His-tagged TRIP6 LIM domains
(D) and Tctex-1 (E) to purifi ed GST-SV343-571
(D and E, lane 2). Supernatants (S; lanes 1,
3, and 5) and pellets (P; lanes 2, 4, and 6)
from incubations with GST-SV343-571 and
6×His-proteins (lanes 1 and 2); GST alone
and 6×His-proteins (lanes 3 and 4); or GST-
SV343-571 alone (lanes 5 and 6). (F) Compe-
tition assay showing that increasing amounts
of 6×His- Tctex-1 decreased binding of 6×His-
TRIP6 LIM domains to GST-SV343-571. Bound
proteins were detected with Coomassie blue
(CBB) or immunoblotting with anti-6×His an-
tibodies (His-Ab). (G) Binding of TRIP6 and
Tctex-1 to EGFP-SV342-571-GST are compa-
rably reduced by alanine replacement of SV
R-426/Y-427. The COS-7 cells coexpressed
either EGFP-GST (lanes 1 and 4, top), wild
type (Wt) EGFP-SV342-571-GST (lanes 2 and
5, top), or the R426A/Y427A point mutant
(RY/AA) in EGFP-SV342-571-GST (lanes 3
and 6, top). Affi nity is reduced, both for Myc-
tagged TRIP6 LIM domains (middle) and for
Myc-tagged Tctex-1 (bottom).
In doubly transfected COS7 cells, Flag-TRIP6, but not
Myc–Tctex-1, partially colocalizes with EGFP-SV and vinculin
(Fig. 8). Although COS7 cells contain endogenous TRIP6 and
Tctex-1 (Fig. S3, available at
jcb.200512051/DC1), the epitope-tagged versions of these pro-
teins are required for immuno uorescence. Full-length EGFP-
SV and Flag-TRIP6 colocalize in membrane surface extensions
that lack strong vinculin staining and along F-actin bundles, as
well as with vinculin at FAs (Fig. 8, A and B, a–d and a’–d’). In
contrast, little or no colocalization is seen between TRIP6 and
the primarily nuclear EGFP (Fig. 8 C, e–h) or between Tctex-1
and either EGFP-SV or vinculin (Fig. 8 D, i–l), suggesting that
TRIP6, rather than Tctex-1, mediates SV effects at FAs.
In fact, TRIP6 may help recruit SV to FAs. Although SV is
not required for the FA localization of TRIP6 (Fig. S4, available
full-length EGFP-SV lacking the TRIP6-binding site is largely
absent from FAs (Fig. 9, SV343-561). Unlike EGFP-SV
(Fig. 9, arrowheads, and Fig. S1), EGFP-SV343-561 is asso-
ciated with branched and curved actin  laments that appear to
associate with vinculin foci at only one end (Fig. 9 B, arrows).
Blind scoring of the percentage overlaps of EGFP signals with
vinculin at large FAs shows overlap at 49.7 ± 8.8% of the FAs
in cells expressing EGFP- SV343-561, compared with 74.2 ±
6.1% in cells expressing EGFP-SV (mean ± SEM; n = 220 and
238 FAs from 15 cells each; P < 0.03). This decreased overlap
with vinculin is probably an underestimate of TRIP6’s effect on
SV recruitment to FAs because the SV localization along  la-
ments favors false positives.
TRIP6 also modulates adhesion of human A549 lung car-
cinoma cells to  bronectin (Fig. 10, A and B). RNAi-mediated
knockdowns of TRIP6 (hTR1, hTR2), but not Tctex-1 (hTx),
signi cantly increase adhesion (Fig. 10, A and B). This effect is
comparable to that observed upon SV knockdown (hSV) and is
consistent with the reported inverse correlation between TRIP6
levels and the number of large FAs (Guryanova et al., 2005).
TRIP6 sequences also partially reverse losses of stress
bers and large FAs induced by SV sequences capable of
binding to these proteins (Fig. 10, C and D). Exogenously co-
expressed TRIP6 LIM domains, but not zyxin LIM domains
or Tctex-1, reduce the effects of SV domains, EGFP-SV1-
830 and EGFP-SV342-571, on stress  bers in COS7 cells
(Fig. 10 C). Full-length TRIP6 partially rescues the effects
of full-length EGFP-SV (Fig. 10 D) and EGFP-SV1-830,
although not that of SV342-571 (Fig. 10 C). The basis for the
TRIP6-mediated rescue may be mislocalization of TRIP6–SV
complexes because cells with high expression levels of both
TRIP6 and EGFP-SV (Fig. 10 E) exhibit increased colo-
calization of TRIP6 and SV in protrusions lacking vinculin
(Fig. 10 E, a–d, arrows, vs. Fig. 8 A). Rescued FAs contain
TRIP6, but are largely devoid of EGFP-SV (Fig. 10 E, arrow-
heads). As expected, TRIP6 has no effect on the phenotype
of point (SV-RY/AA) and deletion (SV343-561) mutants of
full-length SV that have reduced or no binding to TRIP6, re-
spectively (Fig. 10, D and E [e–h]). Consistent with the obser-
vations that multiple SV sequences affect FA structure (Fig. 2,
E and F), full-length SV mutants de cient in binding to TRIP6
induce a loss of large FAs in both the presence and absence of
TRIP6 (Fig. 10 D). This result emphasizes the importance of
additional SV-binding partners.
We show that SV down-regulates FA structure and function,
and that the mechanism involves interactions with TRIP6.
Decreased levels of either protein increase cell adhesion to
bronectin. Increased SV levels decrease cell adhesion, as well
as the number of stress  bers and large, mature FAs. Although
more than one region of SV deleteriously affects FAs, the SV
sequence with the largest effect on FA structure and function is
SV342-571, which binds directly to Tctex-1 and the C-terminal
LIM domains of TRIP6. SV and TRIP6 colocalize at mature
FAs, and optimal SV recruitment to FAs requires binding to
TRIP6. TRIP6 and the TRIP6 LIM domains partially rescue
disruptive effects of SV sequences on FAs and stress  bers.
Speci city is indicated by the lack of effect of Tctex-1 or
the zyxin LIM domains on SV phenotypes. Thus, binding to
SV342-571 is necessary, but not suf cient, to reverse SV ef-
fects on FAs.
The TRIP6 N terminus may shield the C-terminal LIM
domains from SV342-571 in the absence of a regulatory signal,
as has been proposed for other LIM domain proteins (Kadrmas
and Beckerle, 2004; Lai et al., 2005). No direct interaction be-
tween SV sequences and the TRIP6 N terminus was detected
in either yeast two-hybrid or pull-down assays. Nevertheless,
full-length TRIP6 rescues the disruptive effects of longer SV
proteins, implying the possibility of regulatory cross-talk be-
tween the TRIP6 N terminus and SV sequences other than
Figure 7. Partial colocalization of endogenous TRIP6 and smooth
muscle SV. Immunofl uorescence micrographs of fi bronectin-plated, serum-
starved A7r5 cells stained for F-actin (a, e, and i; blue in d, h, and l),
vinculin (b and f; green in d and h), TRIP6 (j; green in l), and SmAV (c and
k; red in d and l) show partial colocalization of SV and TRIP6 at FAs near,
but not at, the cell periphery (arrows). No signal in the red channel was
observed in the absence of anti-SV antibody (g). Bar, 10 μm.
Figure 8. Epitope-tagged TRIP6, but not Tctex-1, colocalizes with SV at FAs.
(A, B, and D) Micrographs of full-length EGFP-SV (a and i; green in d and l)
or (C) EGFP alone (e; green in h) with Flag-TRIP6 (b and f; red in d and h)
or Myc-Tctex-1 (j; red in l) in COS-7 cells counterstained with anti-vinculin
(c, g, and k; blue in d, h, and l) and anti-Flag or anti-Myc antibodies. Bars,
20 μm. (B) Enlargement of a–d in A shows colocalization of EGFP-SV and
Flag-TRIP6 with (arrowheads) and without (arrows) vinculin staining.
JCB VOLUME 174 NUMBER 3 2006 454
Observations that zyxin in uences motility, adhesion, and
stress  ber formation (Golsteyn et al., 1997; Hoffman et al.,
2006) are reminiscent of those observed upon overexpression of
SV sequences. However, SV342-571 does not bind zyxin. In
conjunction with other recent observations (Petit et al., 2005),
these results suggest that the members of the zyxin protein fam-
ily have overlapping, but distinguishable, functions.
The loss of adhesion induced by SV overexpression ap-
parently represents a gain of function because this phenotype
is opposite that observed after SV knockdown. An SV-induced
negative effect on large FAs is supported by the localization of
SV with large FAs, which are structures that undergo dynamic
remodeling (Ballestrem et al., 2001; Carragher and Frame,
2004). SV-mediated loss of large FAs also  ts with the absence
or reduced prevalence of large FAs and stress  bers in cells that
contain relatively high amounts of endogenous SV, e.g., carci-
nomas and neutrophils (Pestonjamasp et al., 1997; Pope et al.,
1998). Carcinomas and hematopoietic cells also express TRIP6
and/or LPP (Daheron et al., 2001; Xu et al., 2004), which is
consistent with a physiological role for interactions with SV at
dynamic FAs. Neutrophil FAs must be highly dynamic because
they turn over rapidly during immune responses when little or
no integrin is synthesized (Zhang et al., 2004).
Although the rescue of the SV phenotype by the TRIP6
LIM domains may be attributable to a simple dominant– negative
effect on TRIP6 function (Kassel et al., 2004), the rescue by
full-length TRIP6 is more interesting. In cells that overexpress
both TRIP6 and wild-type SV, both proteins mislocalize into
cell protrusions, sequestering SV away from FAs. Full-length
SV proteins de cient in binding to TRIP6 still reduce the num-
ber of mature FAs, although these SV mutants are largely ab-
sent from FAs; TRIP6 localization at residual (or new) FAs is
essentially unaffected. Thus, the FA equilibrium is disturbed by
SV mutants that either contain the TRIP6-binding site out of
Figure 9. SV343-561 mediates SV localization at FAs. Reduced overlap
of EGFP signal with vinculin at FAs is reduced for EGFP-SV lacking the
TRIP6/Tctex-1–binding site (SV343-561, arrows), as compared with full-
length EGFP-SV (SV FL, arrowheads). Fluorescence micrographs of trans-
fected COS-7 cells showing low (A) and high (B) magnifi cation images of
EGFP signals (A and B, a and e; green in d and h); phalloidin-stained
F-actin (B, b and f), vinculin (B, c and g; red in d and h), and merged EGFP
and vinculin channels (d and h; overlap in orange-yellow). Representative
of three experiments. Bars, 5 μm.
Figure 10. TRIP6, but not Tctex-1, is involved in SV-mediated effects on
adhesion. Immunoblots of endogenous proteins in A549 cells (A) and his-
togram of adherent cells after centrifugation (B), showing that decreased
TRIP6 or SV levels correlate with increased cell adhesion to fi bronectin.
Cells were treated with dsRNAs against a control sequence (A and B,
lane 1; Con, hTR2 scrambled) TRIP6 (A and B, lanes 2 and 3; hTR1
and hTR2), Tctex-1 (A and B, lane 4; hTx), or SV (A and B, lane 6; hSV)
or with reagent alone (A and B, lane 5; Mock). (A) Endogenous TRIP6
(51 kD), Tctex-1 (12 kD), and SV (205 kD), with β-actin (45 kD) as the loading
control. (B) Adhesion assay. Mean ± the SEM. n = 7–8. *, P < 0.05.
(C) Full-length TRIP6 (TRIP6) and the TRIP6 LIM domains (TRIP6-LIM) par-
tially rescue the loss of stress fi bers induced by overexpression of SV1-
830; only TRIP6-LIM signifi cantly reverses the loss of stress fi bers induced
by SV342-571. Zyxin LIM domains (Zyxin-LIM) and Tctex-1 (Tctex-1) have
no signifi cant effects. Neither the pcDNA3.1 vector alone (Vector) nor
vectors encoding any of the candidate rescue proteins signifi cantly affect
the percentage of stress fi ber–-containing COS-7 cells (Control). Mean ±
the SEM. n = 3. **, P < 0.01; ***, P < 0.001, as compared with vec-
tor only. (D) Flag-TRIP6, but not Myc-Tctex-1, partially rescues the number
of large vinculin foci induced by overexpression of full-length SV (SV FL).
Flag-TRIP6 has no effect on the loss of FAs induced by full-length SV mutants
that lack the TRIP6- binding site (SV 343-561) or exhibit reduced TRIP6
binding (SV RY/AA). Mean ± the SEM. n = 21–25 cells per construct.
*, P < 0.05. (E) Flag-TRIP6 (a and e; red in d and h) and full-length
EGFP-SV (b; green in d) or EGFP-SV343-561 (f; green in h) in COS-7
cells counterstained with anti- vinculin (c and g; blue in d and h). Bar,
20 μm. (d) Colocalization of EGFP-SV and Flag-TRIP6 with (arrowheads)
and without (arrow) vinculin staining.
context or contain the other SV FA-targeting sequences in the
absence of high-af nity binding to TRIP6.
The simplest interpretation of these results is that TRIP6
and SV, together with other associated proteins, act during a FA
assembly/disassembly cycle to control the rate of FA turnover.
In this working model, TRIP6 helps recruit SV to FAs; SV then,
directly or indirectly, either blocks later stages in FA maturation
and/or increases the rate of FA turnover. When SV or TRIP6
levels are limiting, cell–substrate adhesion increases because
FAs are locked “on.” Increasing amounts of the limiting protein
decrease cell adhesion by increasing the rate of maturation of
adhesive nascent FAs into less adhesive mature FAs and/or by
increasing the rate of FA disassembly. In this model, TRIP6
overexpression helps restore the balance between FA assembly
and disassembly in SV-overexpressing cells by (a) accelerating
the formation of new FAs, (b) sequestering SV and proteins re-
quired for FA disassembly away from FAs, and/or (c) promot-
ing the recycling of SV-associated proteins that are required for
FA assembly. Overexpressed full-length SV that is de cient for
binding to TRIP6 may disrupt FAs by interacting with other
proteins involved in FA turnover in such a way that they become
rate limiting for FA reassembly.
This model is consistent with the con icting observations
about the role of TRIP6 during cell migration. The prediction is
that cellular responses to exogenous changes in TRIP6 are de-
pendent on endogenous TRIP6 levels, relative to the levels of
SV and other interactors in the proposed FA dis/assembly path-
way, and on cell type–speci c regulation.
We suggest that the SV–TRIP6 interaction demarcates a
FA subdomain, perhaps a signaling scaffold, which controls FA
integrity and/or turnover. One possibility is that the SV–TRIP6
interaction brings other SV-binding proteins into proximity with
other TRIP6 partners. In addition to TRIP6, the SV N terminus
(SV1-830) binds to the S2 subdomain of nonmuscle myosin II,
to F-actin, and to the plasma membrane (Wulfkuhle et al., 1999;
Chen et al., 2003). SV binding to TRIP6 may recruit myosin II
in stress  bers into the vicinity of TRIP6-binding proteins that
destabilize FAs. Candidate TRIP6 interactors include CAS/
CasL (Yi et al., 2002), c-Src (Xu et al., 2004), Crk (Lai et al.,
2005), the LPA
receptor (Xu et al., 2004), the tyrosine phos-
phatase PTPN13/PTP-BL/FAP-1, and the adaptor protein RIL/
PDLIM4 (Cuppen et al., 2000), which is known to increase
stress  ber dynamics (Vallenius et al., 2004). In agreement with
this hypothesis, both SV and the LPA–TRIP6–CAS pathway
positively regulate ERK signaling (Gangopadhyay et al., 2004;
Lai et al., 2005), a process implicated in FA turnover (Webb
et al., 2004).
Alternatively, SV binding to TRIP6 may displace a posi-
tive regulator of FA stability through steric hindrance or bind-
ing to a shared site on the TRIP6 C terminus. For instance, SV
may disrupt the interaction of TRIP6 with endoglin/CD105,
which is a transmembrane component of the TGF-β complex
that promotes stress  ber formation and the localization of
TRIP6 and zyxin to FAs (Conley et al., 2004; Sanz-Rodriguez
et al., 2004).
Finally, we cannot exclude the possibility that SV in directly
in uences FA structure through potentiation of TRIP6 effects in
the nucleus. Despite its lack of a canonical NLS, TRIP6 can
accumulate in the nucleus and modulate transcription (Kassel
et al., 2004; Li et al., 2005). The TRIP6 LIM domains are suf-
cient for both SV binding (Fig. 6) and nuclear transport (Wang
and Gilmore, 2001). SV contains functional NLS ( Wulfkuhle
et al., 1999) and, like TRIP6, is implicated in steroid hormone
signaling (Ting et al., 2002). Thus, some of the effects reported
here might be caused by changes in transcriptional activity in-
duced by an SV–TRIP6 complex.
In summary, we show that the myosin II– and actin- binding
protein SV regulates FA function through binding to TRIP6, a
LIM domain–containing protein associated with signaling scaf-
folds that control cell motility. This is the  rst evidence for a
myosin II–binding protein at FAs and for an explicit role for
TRIP6 in adhesion. The direct binding of SV and TRIP6 suggest
several speci c, testable hypotheses by which TRIP6-associated
scaffolds may control FA function. The SV–TRIP6 interaction
may provide a “missing link” for actin-independent attachment
of myosin II to the membrane at FAs and insight into molecular
mechanisms for FA disassembly and/or recycling.
Materials and methods
Chemicals, proteins, and expression vectors
Chemicals were obtained from Sigma-Aldrich, Calbiochem-Novabiochem,
Fisher Scientifi c, or VWR International, Inc., unless otherwise noted. EGFP-
tagged SV constructs, purifi ed GST-tagged SV proteins, and Flag-tagged
murine TRIP6 were previously described (Wulfkuhle et al., 1999; Yi et al.,
2002; Chen et al., 2003). Vectors encoding His-tagged TRIP6 LIM do-
mains or Tctex-1 were generated by excising the insert from the pYESTrp
prey vector using the vector KpnI and XhoI sites and ligating in-frame into
the corresponding sites of the pET30a bacterial expression vector. The
TRIP6 insert encoded amino acids 265–476, and the Tctex-1 insert was full
length. Proteins tagged with 6×His were expressed and purifi ed as previ-
ously described (Takizawa et al., 2003).
The mammalian expression vector pCMV-Myc (BD Biosciences and
CLONTECH Laboratories, Inc.) was modifi ed by inserting a HindIII restric-
tion site into the EcoRI site in the multiple cloning sites and used to create
vectors encoding N-terminal Myc-tagged proteins. Full-length Tctex-1
(aa 1–113), the TRIP6-LIM domains (aa 265–476), and zyxin-LIM domains
(aa 361–562) were ligated in frame between the introduced HindIII and
the endogenous XhoI restriction sites. Sequences encoding full-length
Tctex-1 or the TRIP6 LIM domains were excised from isolated pYESTrp li-
brary prey vectors. The sequence encoding the zyxin LIM domains was ob-
tained by PCR using a murine zyxin cDNA in pBluescriptII-SK(+) vector as
template. All vectors were confi rmed by end sequencing.
EGFP-SV lacking the TRIP6/Tctex-1–binding site (EGFP-SV343-561)
was created by deleting the coding sequence for aa 343–561, converting
Ser 343 to a tyrosine. PCR was used to introduce an AgeI site upstream of
the codon for Gly 562 in double-stranded DNA (dsDNA) that included the
unique endogenous EcoRV restriction site after the codon for Asp 830
(Wulfkuhle et al., 1999). The PCR product was digested with AgeI and
EcoRV and ligated into similarly cut, full-length SV in pBluescript II SK (–)
(Wulfkuhle et al., 1999), replacing the codons for 343–830 with those for
562–830. SV343-561 was then transferred into the mammalian expres-
sion vector EGFP-C1 (BD Biosciences and CLONTECH Laboratories, Inc.)
with KpnI and XbaI.
Bovine SV sequences with reduced TRIP6/Tctex-1 binding were
created by alanine replacement mutagenesis using the QuikChange Site-
Directed Mutagenesis kit (Stratagene), following the manufacturer’s instruc-
tions and using the following PAGE-purifi ed primers: sense: 5-ATGAAT
G C T G C T G C T C A A A C C C A G C C G -3, and antisense: 5-C G G C T G G G T T T-
G A G C A G C A G C A T T CAT-3. Modifi ed DNA segments were sequenced
in full.
Cell culture
COS7-2 cells (Wulfkuhle et al., 1999), an SV40-transformed derivative of
monkey kidney epithelial CV-1 cells, and rat A7r5 aorta cells (American
JCB VOLUME 174 NUMBER 3 2006 456
Type Culture Collection [ATCC]) were grown in DME with 10% FCS. CV-1
cells (ATCC) were maintained in MEM Alpha (Invitrogen) with 10% FCS.
A549 human lung carcinoma cells (ATCC) were grown in Ham’s F12K me-
dium, 2 mM L-glutamine, and 10% FCS. Cells were transfected using Effec-
tene Transfection Reagent (QIAGEN). Populations of 100% transfected
cells were obtained by FACS 48 h after transfection with plasmids encod-
ing EGFP or EGFP-SV.
Immunofl uorescence microscopy
Methods for indirect immunofl uorescence microscopy have been previ-
ously described (Chen et al., 2003). In brief, cells transfected for 24 h
were fi xed with 4% paraformaldehyde in PBS in the presence of 1 mM
and 1 mM EGTA for 10 min and permeabilized with 0.1% Triton
X-100 in PBS for 5 (COS7-2) or 10 min (A7r5) before immunostaining.
Cells were stained for vinculin (mouse clone hVIN1; 1:200; Sigma- Aldrich),
Flag (rabbit polyclonal; 1:100; Sigma-Aldrich), Myc (mouse clone 9E10;
1:1,000; ATCC), Myc (rabbit monoclonal clone 71D10; Cell Signaling
Technology, Inc.), TRIP6 (rabbit polyclonal B65; 1:100; Hoffman et al.,
2003; or mouse anti-TRIP6, clone 16; 1:100; BD Biosciences), zyxin (rab-
bit polyclonal B71; 1:100; Hoffman et al., 2003), and/or SV (affi nity-
purifi ed rabbit polyclonal H340; 1:100; Nebl et al., 2002; Oh et al., 2003).
Cross-adsorbed secondary antibodies, conjugated with Alexa Fluor 350,
488, 568, 594, or 633 were obtained from Invitrogen. F-actin was visual-
ized with phalloidin conjugated to Texas red or Alexa Fluor 350 (Invitro-
gen). Slides were analyzed at room temperature with a 100× Plan-NeoFluar
oil immersion objective (NA 1.3) on a fl uorescence microscope (Axioskop;
both Carl Zeiss MicroImaging, Inc.) with a charge-coupled device camera
(RETIGA 1300; QImaging Corp.) and OpenLab software (Improvision), or
with a 100× Plan Apo oil objective, NA 1.35, on a confocal SP2 micro-
scope (both from Leica) running Leica acquisition software. Each channel
of the epifl uorescence micrographs was scaled automatically using the
Auto Level submenu in Photoshop 7.0 (Adobe). In Fig. 7 (c and g), the im-
ages were treated identically to show antibody specifi city. Because of the
high background noise in Alexa Fluor 350 images (Fig. 7, a, e, and i;
Fig. 8 c, c’, g, and k; and Fig. 10 E, c and g), background noise had to
be subtracted after Auto Level manipulation. This operation may also re-
move weak Alexa Fluor 350 signals.
Confocal single-channel optical sections were collected at excitation
wavelengths of 488 nm with 12% laser power and at 633 nm with 31%
laser power. Confocal images were averaged from four consecutive scans
with the pinhole set to include the Airy disc 1. Within each experiment, im-
ages were collected at fi xed exposures, stored in TIFF format, and manipu-
lated identically during quantitative analyses and assembly into fi gures
with Photoshop.
Quantifi cation
Mean fl uorescence intensities of EGFP or EGFP-SV were determined using
Photoshop. Outlines of individual cells were traced manually with the lasso
tool, using phase images as a reference. Mean luminosities of selected ar-
eas were determined with the histogram submenu. Estimated expression
levels of EGFP-SV, relative to endogenous SV, were determined from the
amounts of EGFP-SV and endogenous SV on immunoblots probed with
affi nity-purifi ed H340 antibody. The ratio of EGFP-SV to endogenous SV
was then compared with transfection effi ciency. Typically, approximately
equal amounts of EGFP-SV and endogenous SV on immunoblots were ob-
served in cell populations with transfection effi ciencies of 20%, for an
average overexpression level of approximately sixfold in transfected cells.
The number of total and large FAs per cell were counted manually
in Photoshop from images obtained at room temperature with a 25× Plan-
Neofl uar air objective lens (NA 0.8; Carl Zeiss MicroImaging, Inc.) on an
Axioskop fl uorescence microscope. FA sizes were determined by quantify-
ing pixels in cells stained with antibody against vinculin. Because periph-
eral focal complexes were too numerous and/or too small to quantify,
vinculin foci within 20 pixels (1.6 μm) of the cell border were excluded.
FAs were defi ned as vinculin foci 30 pixels (3.75 μm
); large FAs were
those with 80 pixels (10 μm
), and with pixels × mean luminosities
6,000 arbitrary units. Pixel sizes were calibrated with a micrometer.
Overlaps of EGFP signals with vinculin at FAs were assessed after
the autoscaling and alignment of coded epifl uorescence images in Photo-
shop by an author blinded to the sample identities. Images were aligned
using predetermined registration shifts and checked by colocalizations of
the red and green channels with blue F-actin signals. FAs were identifi ed as
vinculin foci in the red channel associated with the ends of actin fi laments.
Overlap of vinculin with EGFP-SV343-561 or EGFP-SV in the green chan-
nel was scored on a +/ basis, with partial overlaps scored as positives.
Because of signifi cant cytosolic distributions, colocalization of
TRIP6 with vinculin at FAs was quantifi ed as a percentage of the total
lamellipodial signal. The vinculin signal between the cell periphery and
the juxtanuclear region of each cell was thresholded to produce a binary
mask. The percentage of the TRIP6 signal that colocalized with vinculin
was calculated as a percentage of the total signal in the area under analy-
sis divided by the percentage of total voxels under the vinculin mask.
Random distributions yield ratios of 1.0, and colocalizations are indi-
cated by ratios >1.0.
COS7 and human dsRNA
A 3.5-kb sequence encoding the 5 end of monkey kidney SV cDNA
(GenBank/EMBL/DDBJ accession no. DQ178178) was cloned by nested
PCR using Herculase polymerase blend (Stratagene) and primers corre-
sponding to SV sequences conserved in human, mouse, ferret, and bovine
SV. The initial template was oligo-dT–primed, and fi rst-strand cDNA was
prepared from COS7 cell RNA using commercial kits (RNAqueous 4-PCR
and Message Sensor RT-PCR; Ambion, Inc.). The fi rst round of PCR used the
primers MSV-F1 and CRATY-R (Oh et al., 2003) and a touch-down proto-
col, as follows: (1) 92°C, 2 min, 1×; (2) 92°C, 30 s; 55°C, 45 s; 72°C,
8 min; 5×; (3) 92°C, 30 s; 50°C, 45 s; 72°C, 8 min; 5×; (4) 92°C, 30 s;
45°C, 45 s; 72°C, 8 min; 30×; and (5) 72°C, 10 min, 1×. The reaction
mixture was diluted 1:100, and 5 μl was reamplifi ed using MSV-F1 and
T C C A G A A G T C T T T -3) in a second
touch-down reaction: (1) 95°C, 2 min, 1×; (2) 92°C, 30 s; 58°C, 45 s;
72°C, 8 min; 5×; (3) 92°C, 30 s; 55°C, 45 s; 72°C, 8 min; 5×; (4) 92°C,
30 s; 50°C, 45 s; 72°C, 8 min; 30×; and (5) 72°C, 10 min, 1×. Two
clones encoding 3,524 bp of COS7 SV were sequenced and used to iden-
tify fi ve candidate RNAi sequences (;
Reynolds et al., 2004).
The two most effective dsRNAs were resynthesized as Stealth
duplexes (Invitrogen) and used to deplete COS7 cell SV. These dsRNAs
corresponded to coding nucleotides 666–690 (dsRNA 668 sense: 5-A G C-
A G C A G A G A G U U C C U C A A C C U U C -3) and 2,467–2,491 (dsRNA 2472
sense: 5-C C C C U G G A A G A U A U C G A A G C C A G A C -3). Control dsRNAs
contained scrambled or reverse sequences, 5-A G C G A C A G A U U G U C C-
A A C C C A G U U C -3 (dsRNA control 668) or 5-C C C C U G C A G A C C G A A-
G C U A U A G A A G -3 (dsRNA 2,472 rev, Con1). SV depletion required two
dsRNA treatments over 4 d. Cells at 60% confl uence were transfected
with 10 nM dsRNA and Lipofectamine 2000 as recommended ( Invitrogen),
split 1:3 after 2 d, retransfected 8–10 h after splitting, and used in experi-
ments after another 36–40 h of growth.
The same procedure was used to target human TRIP6, Tctex-1, and
SV in A549 cells. hTR1(5-A G G U C A G G A G G A G A C U G U G A G A A U U -3,
coding nt 1,230–1,254) and hTR2 (5-C G A A G A A G C U G G U U C A C G A C-
A U G A A -3, coding nt 779–803) targeted TRIP6; hTx (5-C A A A G U G A A C-
C A G U G G A C C A C A A A U -3, coding nt 23–47) targeted Tctex-1; and hSV
(5-G C G A U G U U U G C U G C U G G A G A G A U C A -3, coding nt 2,026–2,050)
targeted SV. Control dsRNA (Con) contained the scrambled hTR2 sequence
5-C G A C G A A U G G U C A C U A C A G U G A G A A -3.
Cell adhesion and contractility
Cell–substrate adhesion was assayed by a modifi cation of the method
of Lotz et al. (1989). In brief, FACS-sorted cells expressing increased levels
of EGFP-SV or EGFP, or dsRNA-treated cells (1.0 × 10
cells/ml, 3.7 ml
serum-free media), were transferred into the center four wells of 24-well
plates. Each well was covered with an 18-mm round coverslip (18 Circle,
#1.5; VWR Scientifi c) coated with 10 μg/ml fi bronectin. The plate was
inverted and incubated for 60 min at 37°C to permit cell spreading. The
plate was inverted again and centrifuged at 300 g for 5 min to remove un-
bound cells. Cells remaining on the coverslips were fi xed with 4% parafor-
maldehyde and counted.
Cell contractility was assayed using substrate deformation assays.
Flexible substrates were prepared by coating 22 × 22-mm coverslips with
0.1% gelatin (Type A; Sigma-Aldrich) on top of 5 μl silicon (30,000 CS;
Dow Corning; William F. Nye Inc.). Sparsely seeded CV1 cells (<100
cells/coverslip) were allowed to attach for 30 min, transfected with plas-
mids encoding EGFP or EGFP-SV fragments, and grown for an additional
20 h before counting the number of fl uorescent cells that were or were not
associated with wrinkles, indicating the production of contractile forces
(Hinz et al., 2001). The living cells were imaged at 37°C in a temperature-
controlled Plexiglass chamber on an inverted microscope (DMIRE2; Leica)
with a 20× air objective lens (20 DL, NA 0.4; Nikon) and a cooled charge-
coupled device camera (RETIGA EXi; QImaging Corp.). Other methods
were as described in the Immunofl uorescence Microscopy section.
Yeast two-hybrid screens
A bait plasmid encoding bovine SV residues 171–830 was constructed in
pHybLex/Zeo, transformed into the EGY48/pSH18-34 strain of S. cerevi-
siae, and used to screen a HeLa cell library in the prey vector pYESTrp
( Hybrid Hunter Premade cDNA Library and Two-Hybrid System; Invitrogen)
as previously described (Chen et al., 2003). In brief, a library of 1.03 × 10
primary transformants was screened approximately four times on selection
medium (-ura, -trp, +Z200). Large colonies grown on induction medium
(-ura, -trp, -leu, Raff/GAL,+Z200) were picked after 24 or 48 h and tested
for β-galactosidase activity on modifi ed induction medium (-ura, -trp, Raff/
GAL,+Z200). Out of 506 initial colonies, 172 passed both the leucine au-
totrophy and β-galactosidase expression tests. Interacting prey vectors
were segregated by growth for three generations on –Trp medium, recov-
ered, electroporated into XL1 Blue cells (Stratagene), and sequenced using
the pYESTrp forward primer. Sequences with an open reading frame were
verifi ed by retransformation into yeast containing the pHybLex/BSV171-
830 bait vector. Nonspecifi c interactions were eliminated by control trans-
formations into yeast with pHybLex/Zeo (empty bait). To localize potential
binding sites, confi rmed clones were transformed into yeast strains contain-
ing either pHybLexA+BSV171-342 or pHybLexA+BSV570-830, and as-
sayed for leucine autotrophy and β-galactosidase activity.
Pull-down assays
Yeast cells (300 μl packed cell vol) expressing V5-tagged bait proteins af-
ter a 6-h induction were washed with ice-cold SLB (25 mM Tris-Cl, pH 7.5,
1 mM DTT, 2 mM EDTA, 150 mM NaCl, 30% glycerol), and protease
inhibitors (1 μM aprotinin, 2 μM ALL-M, 1 mM benzamidine, 10 μM E64,
1 μM leupeptin, 1 μM pepstatin A, 1 mM PMSF). Yeast were lysed with
400 μl 0.2% Triton X-100 and SLB by vortexing three times at maximum speed
for 30 s with 0.5 mm glass beads (Biospec Products Inc., Bartlesville, OK).
For GST pull-down assays, COS7-2 cells (10
cells) were lysed with 1 ml
lysis buffer (1% NP-40, 25 mM TrisCl, pH 7.5, 50 mM NaCl, 25 mM NaF,
1 mM sodium pervanadate, 50 mM sodium pyrophosphate, and the same
protease inhibitors).
Lysates were centrifuged at 8,000 g for 7 min, and the resulting
supernatants were incubated for 3 h at 0–4°C with 25 μl glutathione–
Sepharose (GE Healthcare). The beads were washed once with lysis buffer
and three times with washing buffer (50 mM sodium phosphate, pH 7.5,
300 mM NaCl, and 10% glycerol and 2-mercaptoethanol). Bound pro-
teins were eluted with 20 mM glutathione in washing buffer, resolved by
SDS-PAGE, and transferred to nitrocellulose membranes (Protran BA85;
Schleicher & Schuell BioScience, Inc.).
Glutathione-eluted proteins blotted to nitrocellulose were stained for Flag-
tag (rabbit polyclonal; 1:1,000; Sigma), Myc-tag (mouse clone 9E10;
1:10,000; ATCC), V5-tag (mouse monoclonal; 1:200; Invitrogen), 6×His-
tag (mouse clone 27E8; 1:1,000; Cell Signaling Technology), GST (goat
polyclonal; 1:1,000; GE Healthcare) or GFP (mouse clones 7.1 and 13.1;
1:3,000; Roche). Immuno–cross-adsorbed secondary antibodies conju-
gated to HRP were obtained from Jackson ImmunoResearch. Signals were
detected by ECL (Pierce Chemical Co.).
Endogenous proteins in mammalian cell lysates were analyzed after
extraction and precipitation with 10% TCA (Takizawa et al., 2003). Blot
strips were stained with antibodies against SV (rabbit polyclonal H340;
1:10,000), β-actin (mouse clone AC-74; 1:3,000; Sigma- Aldrich), zyxin
(rabbit polyclonal B71; 1:5,000), TRIP6/ZRP-1 (rabbit polyclonal B65;
1:2,000; and mouse monoclonal C.16; 1:2,000), or Tctex-1 (rabbit
polyclonal R5205;, 1:25; King et al., 1996). R5205 was provided by
S.M. King (University of Connecticut Health Center, Farmington, CT).
Binding and competition assays
Purifi ed (100 μg) 6×His-tagged TRIP6 LIM domains or 6×His-tagged, full-
length Tctex-1 protein were incubated with 0.6 nmol GST-SV343-571
(30 μg) or GST (15 μg) on glutathione–Sepharose (25 μl). Bound pro-
teins were sedimented, washed, eluted, and analyzed by SDS-PAGE and
staining with Coomassie brilliant blue or anti-6×His antibody. In competi-
tion assays, 6×His-TRIP6 LIM domains (100 μg; 5 nmol) were incubated
with GST-SV343-571 (30 μg; 0.6 nmol) on glutathione–Sepharose (25 μl)
in the presence of increasing amounts of premixed 6×His-Tctex-1: 0, 10
(0.8 nmol), 20 (1.5 nmol), and 100 μg (7.7 nmol).
Online supplemental material
Fig. S1 shows EGFP-SV overlap with vinculin-stained FAs at the basal
surface of a COS-7 cell. Fig. S2 shows that the RY/AA mutant of EGFP-
SV342-571 exhibits a less deleterious phenotype than EGFP-SV342-571
on stress fi bers and large FAs. Fig. S3 shows the specifi cities of the anti-
bodies used in this study on COS7 and A7r5 cells. Fig. S4 shows that
TRIP6 remains at FAs after SV knockdown. Online supplemental material is
available at
We gratefully acknowledge Dr. Peter Pryciak for advice and assistance with
the yeast two-hybrid assays, Dr. Roger Davis for access to the confocal micro-
scope, Dr. Stephen King for the gift of the Tctex-1 antibody, and the UMMS
FACS core facility. We also thank Louise Ohrn for solution preparation and
Donna Castellanos for expert glassware preparation.
This publication was supported by National Institutes of Health (NIH) grants
GM33048 (E.J. Luna) and GM50877 (M.C. Beckerle) and benefi ted from
NIH grant DK060564 to the University of Massachusetts Medical School
Biomedical Imaging Group (L.M. Lifshitz).
The contents of this work are solely the responsibility of the authors and do not
necessarily represent the offi cial views of the NIH.
Submitted: 9 December 2005
Accepted: 25 June 2006
Alahari, S.K., P.J. Reddig, and R.L. Juliano. 2002. Biological aspects of signal
transduction by cell adhesion receptors. Int. Rev. Cytol. 220:145–184.
Ballestrem, C., B. Hinz, B.A. Imhof, and B. Wehrle-Haller. 2001. Marching at
the front and dragging behind: differential αVβ3-integrin turnover regu-
lates focal adhesion behavior. J. Cell Biol. 155:1319–1332.
Beningo, K.A., M. Dembo, I. Kaverina, J.V. Small, and Y.L. Wang. 2001. Nascent
focal adhesions are responsible for the generation of strong propulsive
forces in migrating  broblasts. J. Cell Biol. 153:881–888.
Carragher, N.O., and M.C. Frame. 2004. Focal adhesion and actin dynamics:
a place where kinases and proteases meet to promote invasion. Trends
Cell Biol. 14:241–249.
Chen, Y., N. Takizawa, J.L. Crowley, S.W. Oh, C.L. Gatto, T. Kambara, O. Sato,
X. Li, M. Ikebe, and E.J. Luna. 2003. F-actin and myosin II binding
domains in supervillin. J. Biol. Chem. 278:46094–46106.
Conley, B.A., R. Koleva, J.D. Smith, D. Kacer, D. Zhang, C. Bernabeu, and
C.P. Vary. 2004. Endoglin controls cell migration and composition
of focal adhesions: function of the cytosolic domain. J. Biol. Chem.
Cuppen, E., M. van Ham, D.G. Wansink, A. de Leeuw, B. Wieringa, and W.
Hendriks. 2000. The zyxin-related protein TRIP6 interacts with PDZ
motifs in the adaptor protein RIL and the protein tyrosine phosphatase
PTP-BL. Eur. J. Cell Biol. 79:283–293.
Daheron, L., A. Veinstein, F. Brizard, H. Drabkin, L. Lacotte, F. Guilhot, C.J.
Larsen, A. Brizard, and J. Roche. 2001. Human LPP gene is fused to
MLL in a secondary acute leukemia with a t(3;11) (q28;q23). Genes
Chromosomes Cancer. 31:382–389.
Galbraith, C.G., K.M. Yamada, and M.P. Sheetz. 2002. The relationship between
force and focal complex development. J. Cell Biol. 159:695–705.
Gangopadhyay, S.S., N. Takizawa, C. Gallant, A.L. Barber, H.D. Je, T.C. Smith,
E.J. Luna, and K.G. Morgan. 2004. Smooth muscle archvillin: A novel
regulator of signaling and contractility in vascular smooth muscle. J. Cell
Sci. 117:5043–5057.
Golsteyn, R.M., M.C. Beckerle, T. Koay, and E. Friederich. 1997. Structural
and functional similarities between the human cytoskeletal protein
zyxin and the ActA protein of Listeria monocytogenes. J. Cell Sci.
Guryanova, O.A., A.A. Sablina, P.M. Chumakov, and E.I. Frolova. 2005. Down-
regulation of TRIP6 gene expression induces actin cytoskeleton rear-
rangements in human carcinoma cell lines. Mol. Biol. 39:792–795.
Harris, B.Z., and W.A. Lim. 2001. Mechanism and role of PDZ domains in sig-
naling complex assembly. J. Cell Sci. 114:3219–3231.
Hinz, B., G. Celetta, J.J. Tomasek, G. Gabbiani, and C. Chaponnier. 2001.
Alpha-smooth muscle actin expression upregulates  broblast contractile
activity. Mol. Biol. Cell. 12:2730–2741.
Hoffman, L.M., C.C. Jensen, S. Kloeker, C.L. Wang, M. Yoshigi, and M.C.
Beckerle. 2006. Genetic ablation of zyxin causes Mena/VASP mislocal-
ization, increased motility, and de cits in actin remodeling. J. Cell Biol.
Hoffman, L.M., D.A. Nix, B. Benson, R. Boot-Hanford, E. Gustafsson, C.
Jamora, A.S. Menzies, K.L. Goh, C.C. Jensen, F.B. Gertler, et al. 2003.
Targeted disruption of the murine zyxin gene. Mol. Cell. Biol. 23:70–79.
JCB VOLUME 174 NUMBER 3 2006 458
Hogg, N., A. Smith, A. McDowall, K. Giles, P. Stanley, M. Laschinger, and R.
Henderson. 2004. How T cells use LFA-1 to attach and migrate. Immunol.
Lett. 92:51–54.
Kadrmas, J.L., and M.C. Beckerle. 2004. The LIM domain: from the cytoskele-
ton to the nucleus. Nat. Rev. Mol. Cell Biol. 5:920–931.
Kassel, O., S. Schneider, C. Heilbock, M. Lit n, M. Gottlicher, and P. Herrlich.
2004. A nuclear isoform of the focal adhesion LIM-domain protein Trip6
integrates activating and repressing signals at AP-1- and NF-kappaB-
regulated promoters. Genes Dev. 18:2518–2528.
Kaverina, I., O. Krylyshkina, and J.V. Small. 2002. Regulation of substrate
adhesion dynamics during cell motility. Int. J. Biochem. Cell Biol.
King, S.M., J.F. Dillman III, S.E. Benashski, R.J. Lye, R.S. Patel-King, and K.K.
P ster. 1996. The mouse t-complex-encoded protein Tctex-1 is a light
chain of brain cytoplasmic dynein. J. Biol. Chem. 271:32281–32287.
Lai, Y.J., C.S. Chen, W.C. Lin, and F.T. Lin. 2005. c-Src-mediated phosphoryla-
tion of TRIP6 regulates its function in lysophosphatidic acid-induced cell
migration. Mol. Cell. Biol. 25:5859–5868.
Lele, T.P., J. Pendse, S. Kumar, M. Salanga, J. Karavitis, and D.E. Ingber. 2006.
Mechanical forces alter zyxin unbinding kinetics within focal adhesions
of living cells. J. Cell. Physiol. 207:187–194.
Li, L., L.H. Bin, F. Li, Y. Liu, D. Chen, Z. Zhai, and H.B. Shu. 2005. TRIP6 is
a RIP2-associated common signaling component of multiple NF-kappaB
activation pathways. J. Cell Sci. 118:555–563.
Lotz, M.M., C.A. Burdsal, H.P. Erickson, and D.R. McClay. 1989. Cell adhesion
to  bronectin and tenascin: quantitative measurements of initial binding
and subsequent strengthening response. J. Cell Biol. 109:1795– 1805.
Murthy, K.K., K. Clark, Y. Fortin, S.H. Shen, and D. Banville. 1999. ZRP-1,
a zyxin-related protein, interacts with the second PDZ domain of
the cytosolic protein tyrosine phosphatase hPTP1E. J. Biol. Chem.
274:20679– 20687.
Nebl, T., K.N. Pestonjamasp, J.D. Leszyk, J.L. Crowley, S.W. Oh, and E.J. Luna.
2002. Proteomic analysis of a detergent-resistant membrane skeleton
from neutrophil plasma membranes. J. Biol. Chem. 277:43399–43409.
Oh, S.W., R.K. Pope, K.P. Smith, J.L. Crowley, T. Nebl, J.B. Lawrence, and E.J.
Luna. 2003. Archvillin, a muscle-speci c isoform of supervillin, is an
early expressed component of the costameric membrane skeleton. J. Cell
Sci. 116:2261–2275.
Pestonjamasp, K.N., R.K. Pope, J.D. Wulfkuhle, and E.J. Luna. 1997. Supervillin
(p205): A novel membrane-associated, F-actin–binding protein in the
villin/gelsolin superfamily. J. Cell Biol. 139:1255–1269.
Petit, M.M., S.M. Meulemans, and W.J. Van de Ven. 2003. The focal adhesion
and nuclear targeting capacity of the LIM-containing lipoma-preferred
partner (LPP) protein. J. Biol. Chem. 278:2157–2168.
Petit, M.M., K.R. Crombez, H.B. Vervenne, N. Weyns, and W.J. Van de Ven.
2005. The tumor suppressor Scrib selectively interacts with speci c
members of the zyxin family of proteins. FEBS Lett. 579:5061–5068.
Pope, R.K., K.N. Pestonjamasp, K.P. Smith, J.D. Wulfkuhle, C.P. Strassel, J.B.
Lawrence, and E.J. Luna. 1998. Cloning, characterization, and chromo-
somal localization of human supervillin (SVIL). Genomics. 52:342–351.
Reynolds, A., D. Leake, Q. Boese, S. Scaringe, W.S. Marshall, and A. Khvorova.
2004. Rational siRNA design for RNA interference. Nat. Biotechnol.
Ridley, A.J., M.A. Schwartz, K. Burridge, R.A. Firtel, M.H. Ginsberg, G. Borisy,
J.T. Parsons, and A.R. Horwitz. 2003. Cell migration: integrating signals
from front to back. Science. 302:1704–1709.
Sanz-Rodriguez, F., M. Guerrero-Esteo, L.M. Botella, D. Banville, C.P. Vary,
and C. Bernabeu. 2004. Endoglin regulates cytoskeletal organization
through binding to ZRP-1, a member of the Lim family of proteins.
J. Biol. Chem. 279:32858–32868.
Takizawa, N., D.J. Schmidt, K. Mabuchi, E. Villa-Moruzzi, R.A. Tuft, and
M. Ikebe. 2003. M20, the small subunit of PP1M, binds to microtubules.
Am. J. Physiol. Cell Physiol. 284:C250–C262.
Ting, H.J., S. Yeh, K. Nishimura, and C. Chang. 2002. Supervillin associates
with androgen receptor and modulates its transcriptional activity. Proc.
Natl. Acad. Sci. USA. 99:661–666.
Vallenius, T., B. Scharm, A. Vesikansa, K. Luukko, R. Schafer, and T.P. Makela.
2004. The PDZ-LIM protein RIL modulates actin stress  ber turnover
and enhances the association of alpha-actinin with F-actin.
Exp. Cell
Res. 293:117–128.
Wang, Y., and T.D. Gilmore. 2001. LIM domain protein Trip6 has a conserved
nuclear export signal, nuclear targeting sequences, and multiple transacti-
vation domains. Biochim. Biophys. Acta. 1538:260–272.
Wang, Y., and T.D. Gilmore. 2003. Zyxin and paxillin proteins: focal adhe-
sion plaque LIM domain proteins go nuclear. Biochim. Biophys. Acta.
Webb, D.J., K. Donais, L.A. Whitmore, S.M. Thomas, C.E. Turner, J.T. Parsons,
and A.F. Horwitz. 2004. FAK-Src signalling through paxillin, ERK and
MLCK regulates adhesion disassembly. Nat. Cell Biol. 6:154–161.
Williams, J.M., G.C. Chen, L. Zhu, and R.F. Rest. 1998. Using the yeast two-
hybrid system to identify human epithelial cell proteins that bind gono-
coccal Opa proteins: intracellular gonococci bind pyruvate kinase via
their Opa proteins and require host pyruvate for growth. Mol. Microbiol.
Wulfkuhle, J.D., I.E. Donina, N.H. Stark, R.K. Pope, K.N. Pestonjamasp,
M.L. Niswonger, and E.J. Luna. 1999. Domain analysis of supervillin,
an F-actin bundling plasma membrane protein with functional nuclear
localization signals. J. Cell Sci. 112:2125–2136.
Xu, J., Y.J. Lai, W.C. Lin, and F.T. Lin. 2004. TRIP6 enhances lysophosphatidic
acid-induced cell migration by interacting with the lysophosphatidic acid
2 receptor. J. Biol. Chem. 279:10459–10468.
Yi, J., and M.C. Beckerle. 1998. The human TRIP6 gene encodes a LIM domain
protein and maps to chromosome 7q22, a region associated with tumori-
genesis. Genomics. 49:314–316.
Yi, J., S. Kloeker, C.C. Jensen, S. Bockholt, H. Honda, H. Hirai, and M.C.
Beckerle. 2002. Members of the Zyxin family of LIM proteins interact
with members of the p130Cas family of signal transducers. J. Biol. Chem.
Yoshigi, M., L.M. Hoffman, C.C. Jensen, H.J. Yost, and M.C. Beckerle. 2005.
Mechanical force mobilizes zyxin from focal adhesions to actin  laments
and regulates cytoskeletal reinforcement. J. Cell Biol. 171:209–215.
Zaidel-Bar, R., M. Cohen, L. Addadi, and B. Geiger. 2004. Hierarchical assembly
of cell-matrix adhesion complexes. Biochem. Soc. Trans. 32:416–420.
Zhang, X., Y. Kluger, Y. Nakayama, R. Poddar, C. Whitney, A. DeTora, S.M.
Weissman, and P.E. Newburger. 2004. Gene expression in mature neu-
trophils: early responses to in ammatory stimuli. J. Leukoc. Biol.
Zumbrunn, J., and B. Trueb. 1996. A zyxin-related protein whose synthesis is re-
duced in virally transformed  broblasts. Eur. J. Biochem. 241:657–663.
    • "SV associates with F-actin as well as myosin II filaments at the membrane and mediates myosin II activation during cell spreading and cytokinesis [4][5][6]. SV directly binds LIM domain protein, TRIP6 and LIMA1, regulates focal adhesion disassembly and promotes rapid recycling of integrin during cell migration, also increases podosome turnover and extracellular matrix degradation [7][8][9]. In addition to membrane processes, SV contains a functional nuclear localization sequence and can enhance androgen receptor mediated transactivation [10][11][12]. "
    [Show abstract] [Hide abstract] ABSTRACT: Human Supervillin isoform 4 (SV4), a bigger splicing isoform of Supervillin, contains extra coding exons 3, 4 and 5 (E345), compared to Supervillin isoform 1. Although previous studies have shown that SV4 associated with membrane and cytoskeleton, regulated cell migration and cell survival, its functions are still largely unknown. To broaden our understanding, SV4 specific antibody is important for further study in signaling pathway. The His-SV4 (E345) and GST-SV4 (E345) fusion proteins, which contained SV4 specific domain E345, were purified from bacteria. The His-SV4 (E345) proteins were injected in rabbits as immunogen to produce anti-SV4 serum, and SV4 antibodies were purified by GST-SV4 (E345) proteins cross-linked to affinity resins. SV4 antibodies exclusively recognized SV4 protein both in vitro and in vivo through multi-step testing by ELISA, western blot, immunoprecipitation, and immunofluorescence. Taken together, our data demonstrate a novel SV4-specific polyclonal antibody which will provide a useful tool for further characterization of SV4 function.
    Full-text · Article · Mar 2016
    • "Supervillin binds to the focal adhesion proteins TRIP6 and LPP (Takizawa et al., 2006) and is recruited to podosomes and focal adhesions by myosin II activation (Kuo et al., 2011; Bhuwania et al., 2012). Increased myosin II activation promoted by supervillin leads to disassembly of cell-substrate adhesions (Takizawa et al., 2006; Bhuwania et al., 2012), and Trio-mediated increases in Rac1 activity drive invadopodia disassembly (Moshfegh et al., 2014 Author Manuscript stimulation of Trio GEF-D1 activity and locally high Rac1-GTP levels that could facilitate local actin reorganization. To complete Rho/Rac cycling during oscillatory force generation (van den Dries et al., 2013; Labernadie et al., 2014), it has recently been shown that Abl tyrosine kinase in dorsal ruffles phosphorylates Trio and activates RhoA-GTP loading by the Trio GEF-D2 (Jin and Wang, 2007; Sonoshita et al., 2014). "
    [Show abstract] [Hide abstract] ABSTRACT: We investigated cross-talk between the membrane-associated, myosin II-regulatory protein supervillin and the actin-regulatory small GTPases Rac1, RhoA, and Cdc42. Supervillin knockdown reduced Rac1-GTP loading, but not the GTP loading of RhoA or Cdc42, in HeLa cells with normal levels of the Rac1-activating protein Trio. No reduction in Rac1-GTP loading was observed when supervillin levels were reduced in Trio-depleted cells. Conversely, overexpression of supervillin isoform 1 (SV1) or, especially, isoform 4 (SV4) increased Rac1 activation. Inhibition of the Trio-mediated Rac1 guanine nucleotide exchange (GEF) activity with ITX3 partially blocked the SV4-mediated increase in Rac1-GTP. Both SV4 and SV1 co-localized with Trio at or near the plasma membrane in ruffles and cell surface projections. Two sequences within supervillin bound directly to Trio spectrin repeats 4-7: SV1-171, which contains N-terminal residues found in both SV1 and SV4 and the SV4-specific differentially spliced coding exons 3, 4, and 5 within SV4 (SV4-E345; SV4 amino acids 276 – 669). In addition, SV4-E345 interacted with the homologous sequence in rat kalirin (repeats 4-7, amino acids 531 - 1101). Overexpressed SV1-174 and SV4-E345 affected Rac1-GTP loading, but only in cells with endogenous levels of Trio. Trio residues 771 – 1057, which contain both supervillin-interaction sites, exerted a dominant-negative effect on cell spreading. Supervillin and Trio knockdowns, separately or together, inhibited cell spreading, suggesting that supervillin regulates the Rac1 guanine nucleotide exchange activity of Trio, and potentially also kalirin, during cell spreading and lamellipodia extension. This article is protected by copyright. All rights reserved.
    Full-text · Article · Feb 2015
    • "An intein-tagged plasmid encoding dystrophin spectrin repeats (aa 1361-1686; pTYB1-DMD-10-12), a kind gift from Dr. Elisabeth Le Rumeur (Université de Rennes), was used as template for PCR using the following primers: sense: 5'- GAATTCATGAGGCAAAAGTTGCTTGAACAGAGCATC; antisense: 5'- CTCGAGACTGGTCAAAAGTTTCCATGTGTTTCTGGTA. The resulting fragment was cloned into the pET30a+ vector using the EcoRI and XhoI restriction sites as described previously (Takizawa et al., 2006). The vector was verified by sequencing. "
    [Show abstract] [Hide abstract] ABSTRACT: Loss of gamma-sarcoglycan (g-SG) is common to both Duchenne and Limb Girdle muscular dystrophies, and is sufficient to induce severe muscle degeneration and signaling defects in response to mechanical load without causing susceptibility to contractile damage. This suggests that disease occurs not by structural deficits, but through aberrant signaling, namely, disruption of normal mechanotransduction signaling through the SG complex. However, the mechanisms of g-SG-mediated mechanical signaling are poorly understood. Here, we identified the muscle-specific protein archvillin as a g-SG and dystrophic interacting protein. Archvillin expression is dependent on g-SG, where levels are significantly unregulated in human LGMD2C patient muscle and at the sarcolemma of murine g-SG-null (gsg-/-) muscle. However, archvillin is delocalized in mdx muscle, indicating dystrophin-dependent sarcolemmal localization. In situ eccentric contraction (ECC) of C57 mouse tibialis anterior (TA) muscles causes ERK1/2 phosphorylation, nuclear activation of P-ERK1/2, and stimulus-dependent archvillin association with P-ERK1/2, whereas TA muscles from gsg-/- and mdx mice exhibit heightened P-ERK1/2 and increased nuclear P-ERK1/2 localization following ECCs, but the archvillin-P-ERK1/2 association is completely ablated. These results position archvillin as a mechanically sensitive component of the dystrophin complex, and demonstrate that signaling defects caused by loss of g-SG occur both at the sarcolemma and in the nucleus. We also extended our previous studies on mechanosensitive, g-SG dependent ERK1/2 phosphorylation to determine whether additional pathways are altered with loss of g-SG. Using a passive stretching protocol to isolate the effects of externally applied tension, we found that in isolated EDL muscles, Akt, S6RP, and p70S6K activation increases with stretch in both C57 and gsg-/- isolated muscles. Treatment of muscles with or without rapamycin during stretch blocks p70S6K activation in stretched C57 muscles, and reduces downstream S6RP phosphorylation, indicating mTOR dependence. However, even though rapamycin treatment decreases p70S6K activation in stretched gsg-/- muscles, S6RP phosphorylation remains elevated. These results suggest that p70S6K is an important component of g-SG-dependent mechanotransduction in skeletal muscle, where loss of g-SG uncouples the response of p70S6K to stretch and implies that g-SG is important for inactivation of this pathway. In sum, this study demonstrates altered load-sensing mechanisms in muscular dystrophies where the sarcoglycans are absent.
    Article · Jan 2015 · Cytoskeleton
Show more