Article

c-Type Cytochromes in Pelobacter carbinolicus

Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA.
Applied and Environmental Microbiology (Impact Factor: 3.67). 12/2006; 72(11):6980-5. DOI: 10.1128/AEM.01128-06
Source: PubMed

ABSTRACT

Previous studies failed to detect c-type cytochromes in Pelobacter species despite the fact that other close relatives in the Geobacteraceae, such as Geobacter and Desulfuromonas species, have abundant c-type cytochromes. Analysis of the recently completed genome sequence of Pelobacter carbinolicus revealed 14 open reading frames that could encode c-type cytochromes. Transcripts for all but one of these open reading frames were detected in acetoin-fermenting and/or Fe(III)-reducing
cells. Three putative c-type cytochrome genes were expressed specifically during Fe(III) reduction, suggesting that the encoded proteins may participate
in electron transfer to Fe(III). One of these proteins was a periplasmic triheme cytochrome with a high level of similarity
to PpcA, which has a role in Fe(III) reduction in Geobacter sulfurreducens. Genes for heme biosynthesis and system II cytochrome c biogenesis were identified in the genome and shown to be expressed. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
gels of protein extracted from acetoin-fermenting P. carbinolicus cells contained three heme-staining bands which were confirmed by mass spectrometry to be among the 14 predicted c-type cytochromes. The number of cytochrome genes, the predicted amount of heme c per protein, and the ratio of heme-stained protein to total protein were much smaller in P. carbinolicus than in G. sulfurreducens. Furthermore, many of the c-type cytochromes that genetic studies have indicated are required for optimal Fe(III) reduction in G. sulfurreducens were not present in the P. carbinolicus genome. These results suggest that further evaluation of the functions of c-type cytochromes in the Geobacteraceae is warranted.

Full-text

Available from: Dawn E Holmes, Dec 22, 2015
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2006, p. 6980–6985 Vol. 72, No. 11
0099-2240/06/$08.000 doi:10.1128/AEM.01128-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
c-Type Cytochromes in Pelobacter carbinolicus
Shelley A. Haveman,* Dawn E. Holmes, Yan-Huai R. Ding, Joy E. Ward,
Raymond J. DiDonato, Jr., and Derek R. Lovley
Department of Microbiology, University of Massachusetts, Amherst, Massachusetts 01003
Received 15 May 2006/Accepted 14 August 2006
Previous studies failed to detect c-type cytochromes in Pelobacter species despite the fact that other close relatives
in the Geobacteraceae, such as Geobacter and Desulfuromonas species, have abundant c-type cytochromes. Analysis
of the recently completed genome sequence of Pelobacter carbinolicus revealed 14 open reading frames that could
encode c-type cytochromes. Transcripts for all but one of these open reading frames were detected in acetoin-
fermenting and/or Fe(III)-reducing cells. Three putative c-type cytochrome genes were expressed specifically during
Fe(III) reduction, suggesting that the encoded proteins may participate in electron transfer to Fe(III). One of these
proteins was a periplasmic triheme cytochrome with a high level of similarity to PpcA, which has a role in Fe(III)
reduction in Geobacter sulfurreducens. Genes for heme biosynthesis and system II cytochrome c biogenesis were
identified in the genome and shown to be expressed. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels
of protein extracted from acetoin-fermenting P. carbinolicus cells contained three heme-staining bands which were
confirmed by mass spectrometry to be among the 14 predicted c-type cytochromes. The number of cytochrome genes,
the predicted amount of heme c per protein, and the ratio of heme-stained protein to total protein were much
smaller in P. carbinolicus than in G. sulfurreducens. Furthermore, many of the c-type cytochromes that genetic studies
have indicated are required for optimal Fe(III) reduction in G. sulfurreducens were not present in the P. carbinolicus
genome. These results suggest that further evaluation of the functions of c-type cytochromes in the Geobacteraceae
is warranted.
Pelobacter species seem to be an anomaly within the family
Geobacteraceae. They are phylogenetically intertwined with
Geobacter and Desulfuromonas species and have the capacity
to use Fe(III) as an electron acceptor (29, 34), yet they were
previously found to lack c-type cytochromes (34, 43–47), which
are abundant in Geobacter and Desulfuromonas species and are
thought to be important in electron transfer to Fe(III) in these
organisms (8, 25, 28, 30, 35, 41). This has led to questions about
the evolution of the different genera within the Geobacteraceae
and about the true role of c-type cytochromes in Fe(III) re-
duction in this family. In fact, the apparent lack of c-type
cytochromes in Pelobacter but conservation of the structural
gene for electrically conductive pilin is one line of evidence
suggesting that pili serve as the electrical conduit between the
outer surface of Geobacteraceae cells and Fe(III) oxides (40).
Pelobacter species are common in anaerobic subsurface en-
vironments (16, 22, 37, 50, 52). Pelobacter carbinolicus, which
grows by fermentation of butanediol, acetoin, and ethylene
glycol to ethanol and acetate, was isolated from marine mud
(43). P. carbinolicus can also grow by oxidizing ethanol and
other alcohols (i) in coculture with H
2
-oxidizing methanogens
or acetogens (43) or (ii) with Fe(III) or S
o
as an electron
acceptor (34). However, these organic electron donors are only
incompletely oxidized to acetate, in contrast to the ability of
Geobacter and Desulfuromonas species to completely oxidize
acetate and other organic electron donors to carbon dioxide
(32). Yet P. carbinolicus appears to be capable of conserving
energy from electron transfer to Fe(III) because it can grow via
Fe(III) reduction with H
2
as the electron donor (34), and the
cell yields per unit of Fe(III) reduced with both organic elec-
tron donors and H
2
are equivalent to those for Geobacter
species (E. S. Shelobolina, unpublished data).
Analysis of the recently completed genome sequence of P.
carbinolicus DSM2380 (www.jgi.doe.gov) led to the surprising
finding that this organism contains genes predicted to encode
c-type cytochromes, as well as genes for heme biosynthesis and
cytochrome c biogenesis. Here we report that most of these
c-type cytochrome genes are expressed under one or more
growth conditions and that low levels of c-type cytochromes
can be detected biochemically.
MATERIALS AND METHODS
Bioinformatics. The predicted protein-encoding sequences in the P. carbinolicus
genome sequence (www.jgi.doe.gov) were searched for CXXCH heme c binding
motifs using the FindPatterns algorithm of the Genetics Computer Group Wisconsin
Package, version 10.3 (Accelrys Inc., San Diego, CA). The subcellular location of the
CXXCH-containing putative proteins was predicted using several programs, includ-
ing PSORTb (12), SubLoc (19), TMPred (15), and SignalP (5). Conserved LXXC
lipoprotein binding motifs in signal sequences were used to predict outer membrane
cytochromes (14). Proteins that were predicted to be cytoplasmic membrane asso-
ciated, periplasmic, or outer membrane associated were further analyzed by
BLASTP (2) to predict the function and location based on similarity to other
proteins, with a cutoff E value of 10
5
. The predictions were based solely on
sequence analysis and were not confirmed experimentally. Proteins predicted to
catalyze heme biosynthesis and cytochrome c biogenesis were identified on the basis
of similarity to such proteins in other bacteria (4, 23, 26).
Media and culture conditions. P. carbinolicus DSM2380 was cultured at 30°C
under strictly anaerobic conditions in media containing (per liter) 9.0 g of NaCl,
2.7 g of MgCl
2
·6H
2
O, 2.5 g of NaHCO
3
,0.25gofNH
4
Cl, 0.6 g of NaH
2
PO
4
·
H
2
O, 0.1g of KCl, and 0.14 g of CaCl
2
·2H
2
O. Vitamins and minerals (10 ml
liter
1
each) were added from stock solutions (31). Media were dispensed into
anaerobic pressure tubes or bottles, and the tubes or bottles were gassed with
80% N
2
–20% CO
2
, sealed with butyl rubber stoppers, and autoclaved. Media
were reduced with sterile Na
2
S at a final concentration of 0.02 mM. Electron
* Corresponding author. Mailing address: Department of Microbi-
ology, University of Massachusetts, Amherst, MA 01003. Phone: (413)
577-0217. Fax: (413) 545-1578. E-mail: haveman@microbio.umass.edu.
Published ahead of print on 25 August 2006.
6980
Page 1
donors were added from sterile, anaerobic stock solutions at a final concentra-
tion of 10 mM (acetoin [3-hydroxy-2-butanone]) or 2 mM (ethanol). Fe(III) was
provided in ethanol-containing cultures in the form of Fe(III) nitrilotriacetic acid
(NTA) at a final concentration of 5 mM (41). Due to the salinity of the medium,
much of the Fe(III) was insoluble. Cell growth on acetoin was monitored by
measuring the optical density at 600 nm with a Genesys 2 spectrophotometer
(Spectronic Instruments, Rochester, NY). Fe(II) production in Fe(III) NTA
cultures was monitored with ferrozine (33).
Nucleic acid extraction. Cultures used for DNA or RNA extraction were
grown to mid-log phase, transferred to 50-ml conical tubes, and centrifuged at
3,150 g for 20 min at 4°C. Cell pellets used for RNA extraction were frozen in
liquid nitrogen and stored at 80°C. Chromosomal DNA was extracted from
acetoin-grown P. carbinolicus cells using a FastDNA Spin kit for soil (QBiogene,
Irvine, CA) or a MasterPure DNA purification kit (EPICENTRE Biotechnolo-
gies, Madison, WI). Total RNA was isolated using protocols described previously
(17, 18). For acetoin-grown cells, cell pellets from 50 ml of culture were resus-
pended in 4 ml of Tris-EDTA-sucrose buffer (18), and RNA was extracted by the
protocol used for RNA extraction from the surfaces of current-harvesting elec-
trodes (18). For Fe(III) NTA-ethanol-grown cells, cell pellets from 50 ml of
culture were resuspended in 8 ml TPE buffer (17), and RNA was extracted by
using the protocol for RNA extraction from sediments (17), except that yeast
tRNA was omitted. To confirm that RNA was not contaminated with DNA,
PCRs were performed using RNA as the template.
PCR. Specific primers were designed for the genes for the 14 putative c-type
cytochromes, as well as for cytochrome c biogenesis genes and selected heme
biosynthesis genes (Table 1). Each 50-l PCR mixture contained 10 lof5 Q
solution (QIAGEN), 1.5 mM MgCl
2
,5lof10 PCR buffer (QIAGEN), each
deoxynucleoside triphosphate (Sigma) at a concentration of 0.02 mM, 50 pmol of
each primer, 0.2 mg/ml bovine serum albumin (New England BioLabs),1Uof
Taq DNA polymerase (QIAGEN), and 50 ng of chromosomal DNA. PCR
amplification was carried out with a PTC-200 thermal cycler (MJ Research,
Waltham, MA) as follows: denaturation at 95°C for 5 min, followed by 35 cycles of
95°C for 45 s, 55 or 60°C for 1 min, and 72°C for 1 min and then a final extension step
at 72°C for 10 min. The annealing temperature used for each primer set is shown in
Table 1. PCR products were purified from agarose gels with a QIAquick gel extrac-
tion kit (QIAGEN) and were cloned with a TOPO TA cloning kit, version R
(Invitrogen). Plasmids were extracted from 8 to 12 colonies per PCR and sequenced
with the M13F primer to confirm that the correct gene was amplified.
RT-PCR. Reverse transcription (RT) was performed with an Enhanced Avian
First Strand synthesis kit (Sigma) as described previously (17). Two negative
controls lacking reverse transcriptase or RNA were included for each gene.
PCRs were performed as described above, using 5 l of the RT reaction mixture
as the template for PCR. As described above for PCR products, RT-PCR
products were gel purified, TOPO cloned, and sequenced.
Proteomics. Late-log-phase acetoin-grown P. carbinolicus cells or fumarate-
acetate-grown Geobacter sulfurreducens cells were harvested by centrifugation at
3,150 g for 20 min at 4°C, and the cell pellets were stored at 20°C. Cells were
washed in 50 mM Tris-HCl buffer (pH 8.0) containing 1 mM MgCl
2
and Com
-
plete protease inhibitor cocktail (Roche). Washed cells were suspended in the
same buffer at a concentration of 0.2 g (wet weight) of cells per ml of buffer. The
cells were lysed by sonication at 4°C. The cell debris was removed by centrifu-
gation at 9,000 g for 15 min, and the supernatant contained whole-cell protein.
Ten micrograms of protein from each organism was separated on a sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel, and c-type
cytochromes were heme stained as described previously (11, 51).
Heme-stained protein bands were excised from the gel and washed with 500 l
of MilliQ water for 30 min at 20°C to remove the chemical residue. The gel
pieces were dehydrated in 200 l of 50 mM ammonium bicarbonate in 50%
acetonitrile for 1 h, followed by acetonitrile for 30 min. Each gel piece was
digested in 20 to 40 l digestion buffer (20 mM ammonium bicarbonate con-
taining 75 ng trypsin) at 37°C overnight. The supernatant was recovered, and the
remaining peptides were extracted from the gel piece by washing it with 80%
acetonitrile–1% formic acid in water. The extracts were pooled, and the volume
was reduced to 5 to 10 l with a Speedvac (Vacufuge, Germany). The eluted
tryptic peptides were desalted and concentrated with a commercial ZipTip C
18
pipette tip (Millipore). Peptides were detected by matrix-assisted laser desorp-
tion ionization–time of flight mass spectrometry as previously described (20).
Peptide mass fingerprints were analyzed by using the MS-FIT Protein Prospector
program (UCSF Mass Spectrometry Facility).
RESULTS AND DISCUSSION
c-Type cytochrome genes. The P. carbinolicus genome se-
quence contains 58 CXXCH motifs in 42 predicted proteins.
Individual predicted proteins contain between one and five
TABLE 1. Primers used for RT-PCR analysis of P. carbinolicus cytochromes and cytochrome c biosynthesis genes
Gene Description Forward primer (5–3) Reverse primer (5–3)
Annealing
temp for
PCR (
o
C)
Cytochromes
PCAR2944 Glutamate synthase, large subunit CAGCATGCCATCAAGTTCGT ATAATGCGTACATCGGCCG 60
PCAR2570 Cytochrome c family protein TTCGCTATCTCCCTCGTTCAA TGGCCAAAGTACGGACAATG 60
PCAR2549 Hypothetical protein CGGCTTGCTGTTTGGTACTGT TGAACGGCATCGAATGGTTAC 60
PCAR2529 caa
3
-type cytochrome c oxidase,
subunit II
GAGGCGGTGGACAAGGTTTT GGAAGGCCGGGATATAAAGG 60
PCAR0558 Cytochrome c family protein CTTGACGGTGATGGCATGC CGCAAGGATATGTTCAGCCAC 60
PCAR0192 Molybdopterin oxidoreductase/
precorrin-4 methylase
CTGGCGAAAATCCTTGAACAA AGGTAGGTGGCAAAGCGCT 60
PCAR2867 Cytochrome c nitrite reductase, nrfH ACTTCAGTACGGACCCGACG CCCGTTGTCATGAACTCTTCC 60
PCAR2866 Cytochrome c nitrite reductase nrfA TCGAGAAGACCTGGGATGAGA ACTTCAGTGCGGCAATTTCC 60
PCAR2550 Cytochrome c CACGGTTCCCAAAAATTCCA CCATCCCATTTTCAACGAGC 60
PCAR1628 Cytochrome c
7
, ppcA
CTGTTCCGACGCCATATCAA GCAACCACCGCAGTCTGTC 60
PCAR0152 Hypothetical protein GGTACCGGCATCGCTTTTC CATCAAACAACCGGGCATC 60
PCAR2984 Cytochrome c family protein ATGAAAAAATGCCTTTGGATGCT GCAACGGAAGCAGGGTTCT 60
PCAR2745 Hypothetical protein TGGTGGCGGATTTTCTTCA TGCAGAACATCTTCCCGGATA 60
PCAR2069 Protein-disulfide isomerase AACAGGCCGACAAGGTTTTG GCGGTTACAGACGATGCTCTT 60
Heme biosynthesis
PCAR3065 ccsA homolog GCGCTGGTGCTGATGATTTT TCCCGAAAGCAGCAGATTG 55
PCAR3064 Glutamyl tRNA synthetase, hemA GTCCTATGCGGCGGTGG AAACGCACGATTTCCTGCTC 55
PCAR0266 Glutamate 1-semialdehyde
aminotransferase, hemL
CAGCCCTGTTCGTGCATTTA ACCCTGCCCAGATCGTTGT 55
PCAR0770 Ferrochetalase, hemH GGCCGTGATTATGCGCTACT ACGCCCTCATCCACCAAG 55
Cytochrome c
biogenesis
PCAR2229 Heme transport and ligation, ccsB GCCTGCGTTCCCTGAAACT CGCCGAGCAATATGATCAAA 55
PCAR2228 Heme transport and ligation, ccsA GATTGCGTCGCGAAGGG AATTGACATCATCCAGCGTGG 55
PCAR1954 Thioredoxin, resA TTTCTGGTGCTGTCTGTCGG GCGCAATGCTCCGGC 55
PCAR1953 Thioredoxin, ccdA GCCCTGTGTATTGCCGCT GAGAGCAAAAACGGCAATCC 55
VOL. 72, 2006 c-TYPE CYTOCHROMES IN P. CARBINOLICUS 6981
Page 2
CXXCH motifs. Twenty-eight of the putative c-type cyto-
chromes are predicted to be cytoplasmic and therefore not
expected to bind heme c. Of the remaining 14 protein se-
quences, 4 are predicted to be associated with the cytoplasmic
membrane, 6 are predicted to be periplasmic, and the other 4
may be outer membrane associated (Table 2).
One gene (PCAR1628) is predicted to encode a cytochrome
c
7
that belongs to a family of well-conserved cytochromes in
the Geobacteraceae, which includes cytochrome c
7
in Desulfu
-
romonas acetoxidans (3, 6) and Geobacter metallireducens (1)
and PpcA in G. sulfurreducens (28). In G. sulfurreducens this
cytochrome appears to function as a periplasmic intermediary
electron carrier between cytoplasmic electron donors and
outer membrane-associated Fe(III) reductase (28).
PCAR2984 encodes a putative outer membrane diheme cy-
tochrome c and is conserved in Geobacteraceae genomes up-
stream of a gene for pyruvate kinase. A mutant lacking the
homolog in G. sulfurreducens (GSU3332) was incapable of
reducing poorly crystalline Fe(III) oxides and was deficient in
reduction of U(VI), suggesting that this cytochrome may play
a role in electron transfer to extracellular electron acceptors
(E. S. Shelobolina, unpublished data).
PCAR2867 and PCAR2866 encode proteins that are homol-
ogous to the two subunits of cytochrome c nitrite reductase,
which catalyze nitrite reduction to ammonia in many bacteria
(48) and are conserved in the Geobacteraceae.InP. carbinoli-
cus PCAR2866 the unique CXXCK heme binding motif (48) is
replaced by a CXXCH motif. The role of cytochrome c nitrite
reductase in P. carbinolicus, which is not known to use nitrite as
an electron acceptor, could be similar to that in Desulfovibrio
vulgaris, in which nitrite reduction is not coupled to growth and
cytochrome c nitrite reductase is used for nitrite detoxification
(13, 39).
The periplasmic pentaheme cytochrome c encoded by
PCAR2550 is part of a conserved operon (PCAR2550 to
PCAR2553) that is predicted to encode a cytoplasmic mem-
brane-bound quinol:cytochrome c oxidoreductase. A homolo-
gous complex was purified from Chloroflexus aurantiacus, and
homologous operons are found in individual members of seven
bacterial phyla, suggesting that the complex has been laterally
transferred (53). A similar but distinct complex has been found
in the genome sequences of G. metallireducens, D. vulgaris, and
Desulfovibrio desulfuricans but not in the G. sulfurreducens
sequence (53) or in the draft sequence of Desulfuromonas
acetoxidans (www.jgi.doe.gov). The gene encoding cytoplasmic
membrane-bound monoheme cytochrome c, PCAR2549, is im-
mediately upstream of PCAR2550, but this cytochrome has no
significant similarity to other proteins.
TABLE 2. Predicted c-type cytochromes in P. carbinolicus and mRNA expression determined by RT-PCR
Gene Annotation
No. of
CXXCH
motifs
Associated
gene(s)
Function
mRNA expression
Acetoin
Fe(III)
NTA-ethanol
Cytoplasmic membrane
associated
PCAR2944 Glutamate synthase, large subunit 1 None Unknown ⫺⫹
PCAR2570 Cytochrome c family protein 1 PCAR2571 In operon with another
membrane-bound
protein
⫺⫺
PCAR2549 Hypothetical protein 1 PCAR2550 to
PCAR2553
In operon with
quinol:cytochrome
c oxidoreductase
⫹⫹
PCAR2529 caa
3
-type cytochrome c oxidase,
subunit II
1 PCAR2526 to
PCAR2528
Terminal oxidase ⫹⫹
Soluble periplasmic
PCAR0558 Cytochrome c family protein 1 None Unknown ⫹⫹
PCAR0192 Molybdopterin oxidoreductase/
precorrin-4 methylase
1 PCAR0190 to
PCAR0195
Unknown ⫹⫹
PCAR2867 Cytochrome c nitrite reductase, nrfH 4 PCAR2866 Nitrite reduction,
electron transfer
⫹⫹
PCAR2866 Cytochrome c nitrite reductase, nrfA 5 PCAR2867 Nitrite reduction,
catalytic subunit
⫹⫹
PCAR2550 Cytochrome c 5 PCAR2549 to
PCAR2553
Electron transfer from
quinol:cytochrome
c oxidoreductase
⫺⫹
PCAR1628 Cytochrome c
7
, ppcA
3 None Periplasmic electron
carrier
⫺⫹
Outer membrane
associated
PCAR0152 Hypothetical protein 1 PCAR0153 to
PCAR0159
Associated with
Fe
3
-siderophore
ABC transporter
⫹⫺
PCAR2984 Cytochrome c family protein 2 PCAR2983 Associated with
pyruvate kinase
⫹⫹
PCAR2745 Hypothetical protein 3 None Unknown ⫹⫹
PCAR2069 Protein disulfide isomerase 1 None Unknown ⫹⫹
6982 HAVEMAN ET AL. A
PPL.ENVIRON.MICROBIOL.
Page 3
PCAR2529 encodes subunit II of a caa
3
-type cytochrome c
oxidase (encoded by PCAR2526 to PCAR2529), which is ho-
mologous to the oxidases in other members of the Geobacter-
aceae, as well as the characterized oxidase in Rhodothermus
marinus (42). G. sulfurreducens has a cytochrome c oxidase (36)
and has been shown to grow with low levels of oxygen as a
terminal electron acceptor (27).
PCAR0152 encodes a putative outer membrane cytochrome
with no significant similarity to other proteins. This gene is
located between the genes for an ABC-type transporter with
homology to the Escherichia coli Fep ferric enterobactin trans-
porter (7) and therefore may play a role in the uptake of
chelated Fe(III).
The functions of the remaining six putative cytochromes
cannot be predicted by sequence homology, either because
they have no significant BLASTP hits or because they are
similar to proteins that are not known to bind heme c. These
cytochromes include two that are predicted to be cytoplasmic
membrane bound, the cytochrome encoded by PCAR2570 and
the glutamate synthase homolog encoded by PCAR2944; two
periplasmic cytochromes, one encoded by PCAR0558 and one
encoded by PCAR0192, the latter of which is homologous to
molybdopterin oxidoreductase in the N terminus and pre-
corrin-4 methylase in the C terminus; and two that are pre-
dicted to be outer membrane bound, the triheme cytochrome
encoded by PCAR2745 and the protein disulfide isomerase
encoded by PCAR2069.
Heme biosynthesis and cytochrome c biogenesis genes. In
order for the putative cytochromes to be functional, heme c
must be covalently bound to the proteins in the periplasm.
Formation of c-type cytochromes requires heme biosynthesis,
transport of heme and apoprotein to the periplasm, and cova-
lent attachment of heme to CXXCH motifs. P. carbinolicus
possesses all of the genes required for heme biosynthesis in
four regions of the genome (Table 3). Consistent with its an-
aerobic physiology, P. carbinolicus contains a homolog of the
oxygen-independent protoporphyrinogen oxidase HemG (en-
coded by PCAR0772), which catalyzes the penultimate step in
heme biosynthesis, but not HemY, which catalyzes the same
reaction in an oxygen-dependent manner (10). Likewise, it
contains a homolog of the oxygen-independent coproporphy-
rinogen III oxidase HemN (encoded by PCAR0110), but it
lacks the oxygen-dependent form, HemF (10). hemACD are
located in an operon with genes encoding phosphoheptose
isomerase, siroheme synthase, and a cytochrome biogenesis
protein homolog (PCAR3062 to PCAR3067). hemB is located
downstream of this operon in a dicistronic operon containing a
gene encoding a conserved hypothetical protein (PCAR3060
and PCAR3061).
The steps after heme biosynthesis are collectively referred to
as the cytochrome c biogenesis pathway. There are three dif-
ferent systems for cytochrome c biogenesis, called systems I, II,
and III (24, 38). System II is found in gram-positive bacteria, -
and ε-Proteobacteria, and chloroplasts (23, 24). P. carbinolicus,
along with other members of the Geobacteraceae, has genes for
the system II cytochrome c biogenesis pathway (49). The four
genes fall into two operons (Table 3) encoding four integral
membrane proteins. PCAR2228 and PCAR2229 encode CcsA
and CcsB homologs, which transport heme to the periplasm
and may catalyze the covalent linkage of heme to apocyto-
chrome c (24). ResA (encoded by PCAR1954) is a thioredoxin
that reduces the cysteines of the apocytochrome c so that heme
can be attached, and CcdA (encoded by PCAR1953) rereduces
ResA (24).
mRNA expression. Most of the putative c-type cytochrome
genes were expressed during fermentation and/or during
Fe(III) reduction; the only exception was PCAR2570 (Table
2). PCAR0152, encoding the cytochrome associated with genes
for the Fe
3
-siderophore ABC transporter, was expressed dur
-
ing fermentation but not during Fe(III) reduction, supporting
the hypothesis that this cytochrome has a role in iron uptake
during iron limitation. Three cytochrome genes were expressed
during Fe(III) reduction but not during fermentation, includ-
ing PCAR1628 encoding the periplasmic cytochrome c
7
and
PCAR2550 encoding the periplasmic pentaheme cytochrome
in the quinol:cytochrome c oxidoreductase. Together, these
two cytochromes could transport electrons from the quinone
pool to the outer membrane. The gene encoding a cytoplasmic
TABLE 3. Predicted P. carbinolicus heme biosynthesis and cytochrome c biogenesis genes and mRNA expression determined by RT-PCR
Gene Designation Description
mRNA expression
(acetoin)
Heme biosynthesis
PCAR3065 CcsA homolog
PCAR3064 hemA Glutamyl tRNA synthase
PCAR3063 hemC Porphobilinogen deaminase ND
a
PCAR3062 hemD Uroporphyrinogen-III synthase/methyltransferase ND
PCAR3061 hemB ALA dehydratase ND
PCAR0266 hemL Glutamate 1-semialdehyde aminotransferase
PCAR0769 hemE Uroporphyrinogen-III decarboxylase ND
PCAR0770 hemH Ferrochetalase
PCAR0110 hemN Coporphyrinogen-III oxidase ND
PCAR0772 hemG Protoporphyrinogen-IX oxidase ND
Cytochrome c biogenesis
PCAR2229 ccsB Heme transport and ligation
PCAR2228 ccsA Heme transport and ligation
PCAR1954 resA Thioredoxin for reduction of CXXCH cysteines
PCAR1953 ccdA Thioredoxin for reduction of ResA
a
ND, not determined.
VOL. 72, 2006 c-TYPE CYTOCHROMES IN P. CARBINOLICUS 6983
Page 4
membrane-bound cytochrome related to glutamate synthase
was also expressed only during Fe(III) reduction, but the role
of this cytochrome is not clear.
Expression of selected genes in the heme biosynthesis path-
way was determined by RT-PCR. These genes included the
genes encoding the enzymes for first two steps in the pathway
(hemA and hemL) and the final step (hemH), all of which were
expressed during fermentation (Table 3). A ccsA homolog in
the same operon as hemA was also expressed. The four cyto-
chrome c biogenesis genes were expressed as well (Table 3).
Therefore, all of the genes necessary for heme biosynthesis and
cytochrome c biogenesis are present and expressed in P.
carbinolicus, which allows functional c-type cytochromes to be
produced.
Protein expression. Previous attempts to detect cytochromes
in P. carbinolicus by difference spectroscopy of crude cell ex-
tracts and membrane fractions of fermentatively grown cells
(43) or of intact washed cells (34) were unsuccessful. Likewise,
no cytochromes were detected by difference spectroscopy of
fermentatively grown cells, but when whole-cell protein from
these cells was electrophoresed on SDS-PAGE gels and heme
stained, three bands were detected (Fig. 1). The same amount
of protein from G. sulfurreducens produced many more bands
and contained much more heme-containing protein (Fig. 1).
Proteins in the three heme-stained P. carbinolicus bands were
identified by matrix-assisted laser desorption ionization–time
of flight mass spectrometry, and the results were in agreement
with the RT-PCR results. The following three identified cyto-
chromes were all predicted to be soluble: cytochrome c nitrite
reductase encoded by PCAR2866, molybdopterin oxidoreduc-
tase/precorrin-4 methylase encoded by PCAR0192, and the
cytochrome c family protein encoded by PCAR0558.
Implications for Pelobacter physiology. Our results demon-
strate for the first time that P. carbinolicus contains c-type
cytochromes. As noted above, the functions of some of these
cytochromes can be inferred from homology with cytochrome
genes encoding known functions in other organisms. However,
definitive elucidation of the functions of the genes in P. carbi-
nolicus with genetic approaches has not been possible yet
because techniques for generating specific mutations via ho-
mologous recombination that have been successful in G.
sulfurreducens (8, 9, 20, 25, 28, 35) have not worked well in P.
carbinolicus.
The detection of transcripts for three c-type cytochrome
genes during growth on Fe(III) but not under fermentative
conditions suggests that the cytochromes may be specifically
involved in Fe(III) reduction. It is notable that one of these
differentially expressed cytochrome genes encodes a triheme,
periplasmic cytochrome that is highly conserved in the
Geobacteraceae and is essential for optimal Fe(III) reduction
in G. sulfurreducens (28). However, the triheme cytochrome is
much less abundant in P. carbinolicus than in G. sulfurreducens,
and G. sulfurreducens contains five homologs of this protein
(36) compared to just one homolog in P. carbinolicus. Further-
more, P. carbinolicus lacks genes for many c-type cytochromes
that have been found to be required for optimal Fe(III) re-
duction in G. sulfurreducens. These cytochromes include the
inner membrane cytochrome MacA (8) and the outer mem-
brane cytochromes OmcB (25), OmcS (35), and OmcE (35)
that are thought to be involved in electron transfer to Fe(III).
Also missing are OmcF, OmcG, and OmcH, which are outer
membrane cytochromes that may play a regulatory role during
Fe(III) reduction (20, 21). Not only is the overall number of
c-type cytochrome genes in P. carbinolicus much lower than
that in G. sulfurreducens, 14 versus 111 (36), but also the
number of hemes in P. carbinolicus cytochromes, 5 or less, is
generally lower than the number found in many G. sulfurredu-
cens cytochromes, which can have as many as 27 hemes.
The differences between the c-type cytochrome contents of
P. carbinolicus and G. sulfurreducens could conceivably be
linked to factors related to metabolism of acetate, which G.
sulfurreducens can use as a sole electron donor for Fe(III)
reduction but P. carbinolicus cannot use (32). Alternatively,
they could be related to differences in the environmental con-
ditions in the preferred habitats of the organisms. However,
further studies to definitively determine the functions of the
c-type cytochromes in both organisms are necessary before
substantive conclusions can be made.
ACKNOWLEDGMENT
This research was supported by grant DE-FC02-02ER63446 from
the Genomics: GTL Program of the Office of Science (BER), U.S.
Department of Energy.
REFERENCES
1. Afkar, E., and Y. Fukumori. 1999. Purification and characterization of
triheme cytochrome c
7
from the metal-reducing bacterium, Geobacter
metallireducens. FEMS Microbiol. Lett. 175:205–210.
2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
Basic local alignment search tool. J. Mol. Biol. 215:403–410.
3. Aubert, C., E. Lojou, P. Bianco, M. Rousset, M.-C. Durand, M. Bruschi, and
A. Dolla. 1998. The Desulfuromonas acetoxidans triheme cytochrome c
7
pro
-
duced in Desulfovibrio desulfuricans retains its metal reductase activity. Appl.
Environ. Microbiol. 64:1308–1312.
4. Beckett, C. S., J. A. Loughman, K. A. Karberg, G. M. Donato, W. E. Goldman,
and R. G. Kranz. 2000. Four genes are required for the system II cytochrome
c biogenesis pathway in Bordetella pertussis, a unique bacterial model. Mol.
Microbiol. 38:465–481.
5. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved
prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783–795.
6. Bruschi, M., M. Woudstra, B. Guigliarelli, M. Asso, E. Lojou, Y. Petillot, and
C. Abergel. 1997. Biochemical and spectroscopic characterization of two new
cytochromes isolated from Desulfuromonas acetoxidans. Biochemistry 36:
10601–10608.
7. Buchanan, S. K., B. S. Smith, L. Venkatramani, D. Xia, L. Esser, M. Palnitkar,
R. Chakraborty, D. van der Helm, and J. Deisenhofer. 1999. Crystal structure of
the outer membrane active transporter FepA from Escherichia coli. Nat. Struct.
Biol. 6:56–63.
FIG. 1. Heme-stained SDS-PAGE of whole-cell protein extracted
from P. carbinolicus (lane PC) and G. sulfurreducens (lane GS). Each
lane contained 10 g of protein. The bands indicated by arrows were
excised for identification by mass spectrometry.
6984 HAVEMAN ET AL. A
PPL.ENVIRON.MICROBIOL.
Page 5
8. Butler, J. E., F. Kaufmann, M. V. Coppi, C. Nunez, and D. R. Lovley. 2004.
MacA, a diheme c-type cytochrome involved in Fe(III) reduction by
Geobacter sulfurreducens. J. Bacteriol. 186:4042–4045.
9. Coppi, M. V., C. Leang, S. J. Sandler, and D. R. Lovley. 2001. Development
of a genetic system for Geobacter sulfurreducens. Appl. Environ Microbiol.
67:3180–3187.
10. Dailey, H. A. 2002. Terminal steps of haem biosynthesis. Biochem. Soc.
Trans. 30:590–595.
11. Francis, R. T., Jr., and R. R. Becker. 1984. Specific indication of hemopro-
teins in polyacrylamide gels using a double-staining process. Anal. Biochem.
136:509–514.
12. Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M. Ester, and F. S. L.
Brinkman. 2005. PSORTb v. 2.0: expanded prediction of bacterial protein
subcellular localization and insights gained from comparative proteome
analysis. Bioinformatics 21:617–623.
13. Haveman, S. A., E. A. Greene, C. P. Stilwell, J. K. Voordouw, and G.
Voordouw. 2004. Physiological and gene expression analysis of inhibition of
Desulfovibrio vulgaris Hildenborough by nitrite. J. Bacteriol. 186:7944–7950.
14. Hayashi, S., and H. C. Wu. 1990. Lipoproteins in bacteria. J. Bioenerg.
Biomembr. 22:451–471.
15. Hofmann, K., and W. Stoffel. 1993. TMbase—a database of membrane
spanning proteins segments. Biol. Chem. Hoppe-Seyler 374:166.
16. Holmes, D. E., D. R. Bond, R. A. O’Neil, C. E. Reimers, L. R. Tender, and
D. R. Lovley. 2004. Microbial communities associated with electrodes har-
vesting electricity from a variety of aquatic sediments. Microb. Ecol. 48:178–
190.
17. Holmes, D. E., K. P. Nevin, and D. R. Lovley. 2004. In situ expression of nifD
in Geobacteraceae in subsurface sediments. Appl. Environ. Microbiol. 70:
7251–7259.
18. Holmes, D. E., K. P. Nevin, R. A. O’Neil, J. E. Ward, L. A. Adams, T. L.
Woodard, H. A. Vrionis, and D. R. Lovley. 2005. Potential for quantifying
expression of the Geobacteraceae citrate synthase gene to assess the activity
of Geobacteraceae in the subsurface and on current-harvesting electrodes.
Appl. Environ. Microbiol. 71:6870–6877.
19. Hua, S., and Z. Sun. 2001. Support vector machine approach for protein
subcellular localization prediction. Bioinformatics 17:721–728.
20. Kim, B. C., C. Leang, Y. H. Ding, R. H. Glaven, M. V. Coppi, and D. R.
Lovley. 2005. OmcF, a putative c-type monoheme outer membrane cyto-
chrome required for the expression of other outer membrane cytochromes in
Geobacter sulfurreducens. J. Bacteriol. 187:4505–4513.
21. Kim, B. C., X. Qian, C. Leang, M. V. Coppi, and D. R. Lovley. 2006. Two
putative c-type multiheme cytochromes required for the expression of
OmcB, an outer membrane protein essential for optimal Fe(III) reduction in
Geobacter sulfurreducens. J. Bacteriol. 188:3138–3142.
22. Kovacik, W. P., Jr., K. Takai, M. R. Mormile, J. P. McKinley, F. J. Brockman,
J. K. Fredrickson, and W. E. Holben. 2006. Molecular analysis of deep
subsurface Cretaceous rock indicates abundant Fe(III)- and S
o
-reducing
bacteria in a sulfate-rich environment. Environ. Microbiol. 8:141–155.
23. Kranz, R. G., C. S. Beckett, and B. S. Goldman. 2002. Genomic analyses of
bacterial respiratory and cytochrome c assembly systems: Bordetella as a
model for the system II cytochrome c biogenesis pathway. Res. Microbiol.
153:1–6.
24. Kranz, R. G., R. Lill, B. S. Goldman, G. Bonnard, and S. Merchant. 1998.
Molecular mechanisms of cytochrome c biogenesis: three distinct systems.
Mol. Microbiol. 29:383–396.
25. Leang, C., M. V. Coppi, and D. R. Lovley. 2003. OmcB, a c-type polyheme
cytochrome, involved in Fe(III) reduction in Geobacter sulfurreducens.J.
Bacteriol. 185:2096–2103.
26. Le Brun, N. E., J. Bengtsson, and L. Hederstedt. 2000. Genes required for
cytochrome c synthesis in Bacillus subtilis. Mol. Microbiol. 36:638–650.
27. Lin, W. C., M. V. Coppi, and D. R. Lovley. 2004. Geobacter sulfurreducens can
grow with oxygen as a terminal electron acceptor. Appl. Environ. Microbiol.
70:2525–2528.
28. Lloyd, J. R., C. Leang, A. L. Hodges Myerson, M. V. Coppi, S. Cuifo, B.
Methe, S. J. Sandler, and D. R. Lovley. 2003. Biochemical and genetic
characterization of PpcA, a periplasmic c-type cytochrome in Geobacter
sulfurreducens. Biochem. J. 369:153–161.
29. Lonergan, D. J., H. L. Jenter, J. D. Coates, E. J. Phillips, T. M. Schmidt, and
D. R. Lovley. 1996. Phylogenetic analysis of dissimilatory Fe(III)-reducing
bacteria. J. Bacteriol. 178:2402–2408.
30. Lovley, D. R., S. J. Giovannoni, D. C. White, J. E. Champine, E. J. Phillips,
Y. A. Gorby, and S. Goodwin. 1993. Geobacter metallireducens gen. nov. sp.
nov., a microorganism capable of coupling the complete oxidation of organic
compounds to the reduction of iron and other metals. Arch. Microbiol.
159:336–344.
31. Lovley, D. R., R. C. Greening, and J. G. Ferry. 1984. Rapidly growing rumen
methanogenic organism that synthesizes coenzyme M and has a high affinity
for formate. Appl. Environ. Microbiol. 48:81–87.
32. Lovley, D. R., D. E. Holmes, and K. P. Nevin. 2004. Dissimilatory Fe(III) and
Mn(IV) reduction. Adv. Microb. Physiol. 49:219–286.
33. Lovley, D. R., and E. J. Phillips. 1988. Novel mode of microbial energy
metabolism: organic carbon oxidation coupled to dissimilatory reduction of
iron or manganese. Appl. Environ. Microbiol. 54:1472–1480.
34. Lovley, D. R., E. J. Phillips, D. J. Lonergan, and P. K. Widman. 1995. Fe(III)
and S
0
reduction by Pelobacter carbinolicus. Appl. Environ. Microbiol. 61:
2132–2138.
35. Mehta, T., M. V. Coppi, S. E. Childers, and D. R. Lovley. 2005. Outer
membrane c-type cytochromes required for Fe(III) and Mn(IV) oxide re-
duction in Geobacter sulfurreducens. Appl. Environ. Microbiol. 71:8634–
8641.
36. Methe, B. A., K. E. Nelson, J. A. Eisen, I. T. Paulsen, W. Nelson, J. F.
Heidelberg, D. Wu, M. Wu, N. Ward, M. J. Beanan, R. J. Dodson, R.
Madupu, L. M. Brinkac, S. C. Daugherty, R. T. DeBoy, A. S. Durkin, M.
Gwinn, J. F. Kolonay, S. A. Sullivan, D. H. Haft, J. Selengut, T. M. Davidsen,
N. Zafar, O. White, B. Tran, C. Romero, H. A. Forberger, J. Weidman, H.
Khouri, T. V. Feldblyum, T. R. Utterback, S. E. Van Aken, D. R. Lovley, and
C. M. Fraser. 2003. Genome of Geobacter sulfurreducens: metal reduction in
subsurface environments. Science 302:1967–1969.
37. Mussmann, M., K. Ishii, R. Rabus, and R. Amann. 2005. Diversity and
vertical distribution of cultured and uncultured Deltaproteobacteria in an
intertidal mud flat of the Wadden Sea. Environ. Microbiol. 7:405–418.
38. Page, M. D., Y. Sambongi, and S. J. Ferguson. 1998. Contrasting routes of
c-type cytochrome assembly in mitochondria, chloroplasts and bacteria.
Trends Biochem. Sci. 23:103–108.
39. Pereira, I. A., J. LeGall, A. V. Xavier, and M. Teixeira. 2000. Characteriza-
tion of a heme c nitrite reductase from a non-ammonifying microorganism,
Desulfovibrio vulgaris Hildenborough. Biochim. Biophys. Acta 1481:119–130.
40. Reguera, G., K. D. McCarthy, T. Mehta, J. S. Nicoll, M. T. Tuominen, and
D. R. Lovley. 2005. Extracellular electron transfer via microbial nanowires.
Nature 435:1098–1101.
41. Roden, E. E., and D. R. Lovley. 1993. Dissimilatory Fe(III) reduction by the
marine microorganism Desulfuromonas acetoxidans. Appl. Environ. Micro-
biol. 59:734–742.
42. Santana, M., M. M. Pereira, N. P. Elias, C. M. Soares, and M. Teixeira.
2001. Gene cluster of Rhodothermus marinus high-potential iron-sulfur pro-
tein: oxygen oxidoreductase, a caa
3
-type oxidase belonging to the superfam
-
ily of heme-copper oxidases. J. Bacteriol. 183:687–699.
43. Schink, B. 1984. Fermentation of 2,3-butanediol by Pelobacter carbinolicus
sp. nov. and Pelobacter propionicus sp. nov., and evidence for propionate
formation from C
2
compounds. Arch. Microbiol. 137:33–41.
44. Schink, B. 1985. Fermentation of acetylene by an obligate anaerobe,
Pelobacter acetylenicus sp. nov. Arch. Microbiol. 142:295–301.
45. Schink, B., and N. Pfennig. 1982. Fermentation of trihydroxybenzenes by
Pelobacter acidigallici gen. nov. sp. nov., a new strictly anaerobic, non-spore-
forming bacterium. Arch. Microbiol. 133:195–201.
46. Schink, B., and M. Stieb. 1983. Fermentative degradation of polyethylene
glycol by a strictly anaerobic, gram-negative, nonsporeforming bacterium,
Pelobacter venetianus sp. nov. Appl. Environ. Microbiol. 45:1905–1913.
47. Schnell, S., A. Brune, and B. Schink. 1991. Degradation of hydroxyhydro-
quinone by the strictly anaerobic fermenting bacterium Pelobacter massilien-
sis sp. nov. Arch. Microbiol. 155:511–516.
48. Simon, J. 2002. Enzymology and bioenergetics of respiratory nitrite ammoni-
fication. FEMS Microbiol. Rev. 26:285–309.
49. Stevens, J. M., O. Daltrop, J. W. A. Allen, and S. J. Ferguson. 2004. c-type
cytochrome formation: chemical and biological enigmas. Acc. Chem. Res.
37:999–1007.
50. Thamdrup, B., R. Rossello-Mora, and R. Amann. 2000. Microbial manga-
nese and sulfate reduction in Black Sea shelf sediments. Appl. Environ.
Microbiol. 66:2888–2897.
51. Thomas, P. E., D. Ryan, and W. Levin. 1976. An improved staining proce-
dure for the detection of the peroxidase activity of cytochrome P-450 on
sodium dodecyl sulfate polyacrylamide gels. Anal. Biochem. 75:168–176.
52. Vrionis, H. A., R. T. Anderson, I. Ortiz-Bernad, K. R. O’Neill, C. T. Resch,
A. D. Peacock, R. Dayvault, D. C. White, P. E. Long, and D. R. Lovley. 2005.
Microbiological and geochemical heterogeneity in an in situ uranium biore-
mediation field site. Appl. Environ. Microbiol. 71:6308–6318.
53. Yanyushin, M. F., M. C. del Rosario, D. C. Brune, and R. E. Blankenship.
2005. New class of bacterial membrane oxidoreductases. Biochemistry 44:
10037–10045.
VOL. 72, 2006 c-TYPE CYTOCHROMES IN P. CARBINOLICUS 6985
Page 6
  • Source
    • "P. carbinolicus belongs to the family Desulfuromonadaceae[4-7] and Pelobacter propionicus to Geobacteraceae. The complete genome sequence of P. carbinolicus has led to the discoveries that it expresses c-type cytochromes [8] and that it utilizes Fe(III) as a terminal electron acceptor indirectly via reduction of S° [9]. In silico metabolic models have been constructed for P. carbinolicus and P. propionicus[10], their genomes have been compared to those of acetate-oxidizing, non-fermentative Geobacteraceae[11], and a shortage of histidyl-tRNA caused by the CRISPR locus has been proposed to account for the loss of some ancestral genes such as multiheme c-type cytochromes by the P. carbinolicus genome [12]. "
    [Show abstract] [Hide abstract] ABSTRACT: Background The bacterium Pelobacter carbinolicus is able to grow by fermentation, syntrophic hydrogen/formate transfer, or electron transfer to sulfur from short-chain alcohols, hydrogen or formate; it does not oxidize acetate and is not known to ferment any sugars or grow autotrophically. The genome of P. carbinolicus was sequenced in order to understand its metabolic capabilities and physiological features in comparison with its relatives, acetate-oxidizing Geobacter species. Results Pathways were predicted for catabolism of known substrates: 2,3-butanediol, acetoin, glycerol, 1,2-ethanediol, ethanolamine, choline and ethanol. Multiple isozymes of 2,3-butanediol dehydrogenase, ATP synthase and [FeFe]-hydrogenase were differentiated and assigned roles according to their structural properties and genomic contexts. The absence of asparagine synthetase and the presence of a mutant tRNA for asparagine encoded among RNA-active enzymes suggest that P. carbinolicus may make asparaginyl-tRNA in a novel way. Catabolic glutamate dehydrogenases were discovered, implying that the tricarboxylic acid (TCA) cycle can function catabolically. A phosphotransferase system for uptake of sugars was discovered, along with enzymes that function in 2,3-butanediol production. Pyruvate:ferredoxin/flavodoxin oxidoreductase was identified as a potential bottleneck in both the supply of oxaloacetate for oxidation of acetate by the TCA cycle and the connection of glycolysis to production of ethanol. The P. carbinolicus genome was found to encode autotransporters and various appendages, including three proteins with similarity to the geopilin of electroconductive nanowires. Conclusions Several surprising metabolic capabilities and physiological features were predicted from the genome of P. carbinolicus, suggesting that it is more versatile than anticipated.
    Full-text · Article · Dec 2012 · BMC Genomics
  • Source
    • "Unlike Geobacter and Desulfuromonas species, P. carbinolicus lacks most of the c-type cytochromes [12], which are essential for optimal electron transfer to Fe(III) in Geobacter sulfurreducens [13-16]. P. carbinolicus reduces Fe(III) via an indirect mechanism in which elemental sulfur is reduced to sulfide and the sulfide reduces Fe(III) with the regeneration of elemental sulfur, contrasting with the direct reduction of Fe(III) for Geobacter species [17]. "
    [Show abstract] [Hide abstract] ABSTRACT: Pelobacter species are commonly found in a number of subsurface environments, and are unique members of the Geobacteraceae family. They are phylogenetically intertwined with both Geobacter and Desulfuromonas species. Pelobacter species likely play important roles in the fermentative degradation of unusual organic matters and syntrophic metabolism in the natural environments, and are of interest for applications in bioremediation and microbial fuel cells. In order to better understand the physiology of Pelobacter species, genome-scale metabolic models for Pelobacter carbinolicus and Pelobacter propionicus were developed. Model development was greatly aided by the availability of models of the closely related Geobacter sulfurreducens and G. metallireducens. The reconstructed P. carbinolicus model contains 741 genes and 708 reactions, whereas the reconstructed P. propionicus model contains 661 genes and 650 reactions. A total of 470 reactions are shared among the two Pelobacter models and the two Geobacter models. The different reactions between the Pelobacter and Geobacter models reflect some unique metabolic capabilities such as fermentative growth for both Pelobacter species. The reconstructed Pelobacter models were validated by simulating published growth conditions including fermentations, hydrogen production in syntrophic co-culture conditions, hydrogen utilization, and Fe(III) reduction. Simulation results matched well with experimental data and indicated the accuracy of the models. We have developed genome-scale metabolic models of P. carbinolicus and P. propionicus. These models of Pelobacter metabolism can now be incorporated into the growing repertoire of genome scale models of the Geobacteraceae family to aid in describing the growth and activity of these organisms in anoxic environments and in the study of their roles and interactions in the subsurface microbial community.
    Preview · Article · Dec 2010 · BMC Systems Biology
  • Source
    • "Heme-containing proteins were then visualized by staining (Francis and Becker, 1984). The bands were excised and digested with tryspin according to a previously published procedure (Haveman et al., 2006) predicted N terminus based on the sequences for Cyt 572 in the reconstructed LeptoII and LeptoIII genomes, and also identical to the previously purified preparations of Cyt 572 (Jeans et al., 2008). Analysis of the reconstructed LeptoII and LeptoIII genomes has indicated a substantial number of sequence variants for the gene encoding for Cyt 572 (Jeans et al., 2008). "
    [Show abstract] [Hide abstract] ABSTRACT: Characterizing proteins recovered from natural microbial communities affords the opportunity to correlate protein expression and modification with environmental factors, including species composition and successional stage. Proteogenomic and biochemical studies of pellicle biofilms from subsurface acid mine drainage streams have shown abundant cytochromes from the dominant organism, Leptospirillum Group II. These cytochromes are proposed to be key proteins in aerobic Fe(II) oxidation, the dominant mode of cellular energy generation by the biofilms. In this study, we determined that posttranslational modification and expression of amino-acid sequence variants change as a function of biofilm maturation. For Cytochrome₅₇₉ (Cyt₅₇₉), the most abundant cytochrome in the biofilms, late developmental-stage biofilms differed from early-stage biofilms in N-terminal truncations and decreased redox potentials. Expression of sequence variants of two monoheme c-type cytochromes also depended on biofilm development. For Cyt(572), an abundant membrane-bound cytochrome, the expression of multiple sequence variants was observed in both early and late developmental-stage biofilms; however, redox potentials of Cyt₅₇₂ from these different sources did not vary significantly. These cytochrome analyses show a complex response of the Leptospirillum Group II electron transport chain to growth within a microbial community and illustrate the power of multiple proteomics techniques to define biochemistry in natural systems.
    Full-text · Article · Nov 2010 · The ISME Journal
Show more