Proteomic Analysis of the Kaposi's Sarcoma-Associated Herpesvirus Terminal Repeat Element Binding Proteins

Abstract

Terminal repeat (TR) elements of Kaposi's sarcoma-associated herpesvirus (KSHV), the potential origin sites of KSHV replication, have been demonstrated to play important roles in viral replication and transcription and are most likely also critical for the segregation of the KSHV genome to daughter cells. To search for the cellular proteins potentially involved in KSHV genome maintenance, we performed affinity chromatography analysis, using KSHV TR DNA as the affinity ligand. Proteomic analysis was then carried out to identify the TR-interacting proteins. We identified a total of 123 proteins from both KSHV-positive and -negative cells, among which most were identified exclusively from KSHV-positive cells. These proteins were categorized as proliferation/cell cycle regulatory proteins, proteins involved in spliceosome components, such as heterogeneous nuclear ribonuclear proteins, the DEAD/H family, the switch/sucrose nonfermenting protein family, splicing factors, RNA binding proteins, transcription regulation proteins, replication factors, modifying enzymes, and a number of proteins that could not be broadly categorized. To support the proteomic results, the presence of four candidate proteins, ATR, BRG1, NPM1 and PARP-1, in the elutions was further characterized in this study. The binding and colocalization of these proteins with the TR were verified using chromatin immunoprecipitation and immunofluorescence in situ hybridization analysis. These newly identified TR binding proteins provide a number of clues and potential links to understanding the mechanisms regulating the replication, transcription, and genome maintenance of KSHV. This study will facilitate the generation and testing of new hypotheses to further our understanding of the mechanisms involved in KSHV persistence and its associated pathogenesis.

Full text

JOURNAL OF VIROLOGY, Sept. 2006, p. 9017–9030 Vol. 80, No. 18
0022-538X/06/$08.00⫹0 doi:10.1128/JVI.00297-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Proteomic Analysis of the Kaposi’s Sarcoma-Associated Herpesvirus
Terminal Repeat Element Binding Proteins
Huaxin Si, Subhash C. Verma, and Erle S. Robertson*
Department of Microbiology and the Tumor Virology Program of the Abramson Comprehensive Cancer Center,
University of Pennsylvania, School of Medicine, Philadelphia, Pennsylvania
Received 9 February 2006/Accepted 23 June 2006
Terminal repeat (TR) elements of Kaposi’s sarcoma-associated herpesvirus (KSHV), the potential origin
sites of KSHV replication, have been demonstrated to play important roles in viral replication and transcrip-
tion and are most likely also critical for the segregation of the KSHV genome to daughter cells. To search for
the cellular proteins potentially involved in KSHV genome maintenance, we performed affinity chromatography
analysis, using KSHV TR DNA as the affinity ligand. Proteomic analysis was then carried out to identify the
TR-interacting proteins. We identified a total of 123 proteins from both KSHV-positive and -negative cells,
among which most were identified exclusively from KSHV-positive cells. These proteins were categorized as
proliferation/cell cycle regulatory proteins, proteins involved in spliceosome components, such as heteroge-
neous nuclear ribonuclear proteins, the DEAD/H family, the switch/sucrose nonfermenting protein family,
splicing factors, RNA binding proteins, transcription regulation proteins, replication factors, modifying en-
zymes, and a number of proteins that could not be broadly categorized. To support the proteomic results, the
presence of four candidate proteins, ATR, BRG1, NPM1 and PARP-1, in the elutions was further characterized
in this study. The binding and colocalization of these proteins with the TR were verified using chromatin
immunoprecipitation and immunofluorescence in situ hybridization analysis. These newly identified TR bind-
ing proteins provide a number of clues and potential links to understanding the mechanisms regulating the
replication, transcription, and genome maintenance of KSHV. This study will facilitate the generation and
testing of new hypotheses to further our understanding of the mechanisms involved in KSHV persistence and
its associated pathogenesis.
Kaposi’s sarcoma-associated herpesvirus (KSHV), also called
human herpesvirus 8, is a human gammaherpesvirus family mem-
ber associated with Kaposi’s sarcoma, body cavity-based lym-
phomas, and multicentric Castleman’s disease (36). Typically,
KSHV displays two modes of infection: latent infection, during
which the viral genome persists in the host cell and no viral
progeny are released, and lytic infection, during which the host
cell is destroyed and viral progeny is produced (for a review,
see reference 51). In the latent state, KSHV genomic DNA,
which exists as a closed circular plasmid, appears to behave like
host chromosomal DNA and is packaged onto nucleosomes
with cellular histones (37, 42). During S phase, KSHV ge-
nomes are replicated once and are partitioned faithfully into
daughter cells during the mitotic phase (20).
KSHV terminal repeat (TR) elements are multiple GC-rich,
801-bp DNA fragments at the terminus of the KSHV genome
(25, 43). The viral TR is important for the tethering of viral
genome to the host chromosomes and thus ensures efficient
segregation of viral DNA upon mitosis (2, 9). Two latency-
associated nuclear antigen (LANA) protein binding sites
(LBS1 and LBS2) were located between nucleotides 571 and
610 in each TR sequence, and both binding sites contribute to
ori activity, as determined by short-term replication assays (14,
15). An 89-bp highly GC-rich element is located upstream of
LBS1/2, along with a 101-bp AT-rich stretch that is often found
in origins of replication and believed to function in DNA
unwinding. Both the GC-rich element and the LBS1/2 se-
quences are required for ori function, while the AT-rich ele-
ment is dispensable (21). LANA is consistently expressed in KS
lesions and crucial for viral maintenance in proliferating cells
(1, 23). LANA not only modulates the transcription of viral
and cellular genes but also recruits a number of molecules to
regulate the replication of the viral episome and the segrega-
tion of the newly synthesized genome copies to daughter prog-
eny nuclei by tethering to host chromosomes (15, 29, 44, 46). A
simplified model suggests that LANA can mediate the tether-
ing of the KSHV genome to specific components of the chro-
matin structure through the binding of its C terminus with the
TR and association with components of the human chromatin
at its N terminus, which includes linker histones and MeCP3
(3, 23).
The long-term persistence of a viral agent which includes
KSHV depends on its interaction with are host cell. Its genome
replication and viral gene transcription are typically dependent
on the involvement of a number of cellular processes. The
finding that KSHV genomic DNA as well as TR-containing
plasmids is replicated only once during the cell cycle and that
LANA has no detectable polymerase or helicase activity re-
quired for DNA replication strongly suggest that replication of
the KSHV genome is dependent on cellular replication ma-
chinery (53). However, the mechanisms for the initiation and
regulation of KSHV replication as well as the segregation of
newly synthesized DNA copies to daughter cells are still largely
unknown. The identification of the cellular molecules involved
* Corresponding author. Mailing address: Department of Microbi-
ology and Abramson Comprehensive Cancer Center, University of
Pennsylvania, School of Medicine, Philadelphia, PA 19104. Phone:
(215) 746-0114. Fax: (215) 898-9557. E-mail: erle@mail.med.upenn
.edu.
9017

in KSHV replication, transcription control, and segregation
may provide clues towards improved understanding of the life
cycle and pathogenesis of KSHV. This study is designed to
identify the cellular proteins binding to the TR, which is a
critical component of the complex involved in viral tethering
and genome replication.
MATERIALS AND METHODS
Cell lines and plasmid. KSHV-negative cell line BJAB and KSHV-positive cell
line BC-3 were cultured in RPMI 1640 medium supplemented with 10% fetal
bovine serum, 2 mM
L-glutamine, and penicillin-streptomycin (5 U/ml and 5
␮g/ml, respectively). Both cell lines were grown at 37°C in a humidified environ-
ment supplemented with 5% CO
2
. pBSpuro was constructed by subcloning the
puromycin resistance expression cassette from pBABEpuro into the SalI and
ClaI sites of pBS (Stratagene, Inc., La Jolla, CA) containing multiple cloning
sites (50). The complete TR unit of KSHV (801 bp) was excised from cosmid
clone Z6 with restriction endonuclease NotI and ligated into pBSpuro at the
NotI site to obtain pBSpuroA3. The resultant plasmid contains three copies of
the TR.
Preparation of nuclear extracts. To isolate nuclear proteins binding with TRs,
nuclear extracts were prepared from the BJAB and BC-3 cell lines. Briefly, 100 ⫻
10
6
cells were harvested and washed with cold phosphate-buffered saline (PBS),
resuspended in buffer A (10 mM HEPES, 10 mM KCl, 1.5 mM MgCl
2
,5mM
dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride [PMSF], 10 ␮gof
aprotinin/ml), incubated on ice for 1 h, and Dounce homogenized (25 to 30
strokes, observed under a microscope if necessary). Extracted nuclei were col-
lected by centrifugation, washed once with buffer A, and then resuspended in
buffer B (20 mM HEPES, 10% glycerol, 420 mM NaCl, 1.5 mM MgCl
2
,5mM
DTT, 0.5 mM PMSF, 10 ␮g of aprotinin/ml). After 30 min of incubation on ice,
nuclear debris was removed by centrifugation at high speed. The supernatant
containing the nuclear protein was added to an equal volume of buffer C (20 mM
HEPES, 30% glycerol, 1.5 mM MgCl
2
, 0.2 mM EDTA, 5 mM DTT, 0.5 mM
PMSF, 10 ␮g of aprotinin/ml), and the mixture was snap frozen in aliquots for
storage at ⫺80°C. The protein concentration in the nuclear extracts was deter-
mined by a standard Bradford assay.
TR column preparation and nuclear extracts binding. pBSpuroA3 (containing
three copies of the terminal repeat) was amplified and extracted. The entire
801-bp TR fragment was purified after the vector was digested with a NotI
restriction enzyme (New England Biolabs, Beverly, MA) and resolved on a 1%
agarose gel. The 801-bp DNA fragment was retrieved from the gel. About 1 mg
of the purified fragment was incubated with CNBr-activated Sepharose (GE
Healthcare, Milwaukee, WI) according to the manufacturer’s protocol. The
unbound reactors were inactivated, and the Sepharose was extensively washed
with binding buffer and packed into an Econocolumn (Bio-Rad Laboratories,
Inc., Hercules, CA), resulting in TR(⫹)Sepharose. Nonspecific DNA binding
was absorbed with 125 ␮g of poly(dI-dC) (GE Healthcare, Milwaukee, WI).
The nuclear extracts were diluted 1:4 with buffer A and loaded to the TR
Sepharose column or the control column. The elutant that passed through the
TR Sepharose fraction was stored as the unbound fraction. After the column was
washed with buffer A, the bound proteins were eluted with the same buffer
containing sequentially increasing concentrations (50, 100, 300, 500, and 1,000
mM) of NaCl and finally washed with 2.5 M NaCl. Eluted proteins were dena-
tured by boiling in sample buffer and then separated on a 15-by-15-cm 8%
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel.
Proteins were visualized by Coomassie blue staining.
Two 30-bp complementary oligonucleotides (corresponding to nine 30-base
pair, high-GC-content repeats [83%] from oligonucleotide 24637 to 24907 of the
KSHV genome) (6), 5⬘GATCCCGGCGCGCCACCCTCCCCGGAGGGG3⬘
and 5⬘GATCCCCCTCCGGGGAGGGTGGCGCGCCGG3⬘, were synthesized
(Integrated DNA Technologies, Inc., Coralville, IA) as control DNA fragments.
First, two oligonucleotides were annealed together and the double-strand DNA
was purified with 15% PAGE gel. The 5⬘ terminal end of the purified DNA was
then phosphorylated with T4 polynucleotide kinase and ligated with T4 DNA
ligase (New England Biolabs, Beverly, MA). The DNA was resolved on a 1%
agarose gel, and fragments between 400 and 1,000 bp were retrieved from the gel
as a control DNA column with a repeated sequence similar to that of the KSHV
TR column.
LCQ mass spectrometry (MS) analyses. Distinct bands between 28 and ⬎260
kDa from 300-, 500-, and 1,000-mM NaCl elutions from both cell lines were
excised off the gel and subjected to LCQ proteomic analysis at the Proteomics
Core Facility at the University of Pennsylvania School of Medicine. Proteins for
each band with an LCQ score over 20 were reported.
Western blot analysis. Electrophoresed proteins were blotted onto 0.45-␮m
nitrocellulose paper (Osmonics, Inc., Minnetonka, MN) at 100 V for 1 to 2 h.
Blots were blocked with 5% milk in phosphate-buffered saline and washed three
times with TBST buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween
20) before overnight incubation with rabbit anti-LANA antiserum or mouse
anti-PARP (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and -NPM1 (Cell
Signaling Technology, Inc., Danvers, MA) antibodies or rabbit anti-ATR and
-BRG1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) antibodies at 4°C.
Blots were washed three times with TBST and incubated with a 1:10,000 dilution
of appropriate Alexa Fluor 680 or IRDye 800 secondary antibody (Molecular
Probes, Carlsbad, CA). Membranes were scanned with an Odyssey infrared
scanner (Li-Cor Biosciences, Lincoln, NE). Densitometric analysis was per-
formed with Odyssey scanning software.
Immunofluorescence in situ hybridization analysis. Immunofluorescence as-
say was performed as described previously (47). Briefly, BC-3 cells were fixed
with 3% paraformaldehyde at room temperature for 10 min and permeabilized
with 0.1% Triton in PBS for 5 min. Fixed cells were blocked with appropriate
serum and then incubated with the specific rabbit antibodies for LANA or
KSHV-positive human serum and antibody against one of the candidate pro-
teins, ATR, BRG1, NPM1, or PARP-1. Slides were washed three times in PBS,
followed by incubation with a 1:1,000 dilution of appropriate immunoglobulin-
Alexa Fluor 488/647-conjugated secondary antibodies. Then cells were postfixed
with 3% paraformaldehyde in PBS for 5 min, permeabilized in 0.1% Triton in
PBS for 3 min, and treated with 0.1 M Tris-HCl (pH 7.0) for 2 min and 2⫻ SSC
(1⫻ SSC is 0.15 M NaCl plus 0.015 M sodium citrate) twice for 2 min. Cells were
dehydrated in 70, 80, 90, and 100% ethanol at 4°C for 2 min each and dried. Then
cells were treated with 100 ␮g/ml RNase A for 45 min at 37°C, washed, dena-
tured in denaturing solution (70% formamide in 2⫻ SSC) at 70°C for 2 min,
dehydrated, dried, and subjected to in situ hybridization. A Z6 cosmid containing
the left end of the KSHV genome was used as a probe after being biotin labeled
with a NEBlot Phototope kit (New England Biolabs, Beverly, MA) according to
the manufacturer’s instructions. Slides were hybridized with the denatured bio-
tinylated Z6 cosmid probe overnight at 55°C. After hybridization, slides were
washed in 2⫻ SSC and 0.1⫻ SSC for 15 min each at 55°C, followed by the
detection of the KSHV genome with a streptavidin-conjugated Alexa Flour
594 (Molecular Probes, Carlsbad, CA). The slides were washed in PBS,
counterstained with 4⬘,6⬘-diamidino-2-phenylindole (DAPI), and mounted
with antifade solution. Slides were examined with an Olympus FluoView
FV300 confocal microscope, and images were analyzed with FluoView soft-
ware (Olympus, Inc., Melville, NY).
Chromatin immunoprecipitations. For each immunoprecipitation, 2 ⫻ 10
7
BC-3 or BJAB cells were cross-linked by adding formaldehyde to a final con-
centration of 1% directly to the growth medium at 37°C for 10 min. The reaction
was quenched by adding glycine at a final concentration of 0.125 M. Cells were
washed once in ice-cold PBS containing protease inhibitor mini-mixture and 1
mM phenylmethylsulfonyl fluoride. Nuclei were pelleted at low speed, lysed in
SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8) for 10 min on
ice, and diluted to 1 ml in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2
mM EDTA, 16.7 mM Tris-HCl, pH 8, 16.7 mM NaCl, 1 mM phenylmethyl-
sulfonyl fluoride, protease inhibitor mini-mixture). Chromatin was sonicated to
⬃500-bp fragments and centrifuged at 13,000 rpm for 10 min at 4°C to remove
debris. A portion (5%) of each sample was set aside to measure input DNA, and
the remainder was diluted to 2 ml in dilution buffer and split into two 1-ml
aliquots. Nonspecific background was precleared with 30 ␮l of salmon sperm
DNA-protein A agarose beads and 1 ␮l of normal mouse immunoglobulin G for
1 h at 4°C with rotation. Supernatants were incubated with 2 ml of either
anti-ATR, BRG1, NPM1, or PARP-1 antibody overnight at 4°C with rotation
before immune complexes were collected with 30 ␮l salmon sperm DNA-protein
A agarose for1hat4°C. Beads were washed once each with low-salt wash buffer
(0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris, pH 8, 150 mM NaCl),
high-salt wash buffer (same as low salt but with 500 mM NaCl), and LiCl wash
buffer (0.25 M LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mM EDTA,
10 mM Tris, pH 8.0) and then twice in TE (10 mM Tris, 1 mM EDTA) (pH 8.0).
Pellets were resuspended in 150 ␮l of chromatin immunoprecipitation (ChIP)
assay elution buffer (1% SDS, 0.1 M NaHCO
3
) and rotated at room temperature
for 15 min. Samples were centrifuged, and eluates were removed. Elution was
repeated one more time, and eluates were combined. Input DNA (5% of total
sample previously set aside) was diluted to 300 ␮l in elution buffer, followed by
reverse cross-linking of all the samples, with the addition of NaCl to a concen-
tration of 0.3 M and 20 ␮g of RNase A for 5 to6hat65°C. Proteins were
removed from samples with 10 mM EDTA, 53 mM Tris-HCl, pH 6.5, and 50 ␮g
9018 SI ET AL. J. VIROL.

proteinase K overnight at 37°C. Samples were extracted once with phenol, once
with 1:1 phenol-chloroform, and once with chloroform and precipitated in alco-
hol. DNA samples were then amplified with primers (forward, 5⬘-GGGGGACCC
CGGGCAGCGAG-3⬘, and reverse, 5⬘-GGCTCCCCCAAACAGGCTCA-3⬘)
flanking TR nucleotides 677 to 766. pBSpuroA3 plasmid was amplified in each test
as a positive control.
Immunoprecipitation. For immunoprecipitation, 8 ⫻ 10
7
BJAB and BC-3 cells
were lysed on ice with 1 ml of radioimmunoprecipitation assay (RIPA) buffer (50
mM Tris, pH 7.5, 150 mM NaCl, 0.1% NP-40, 1 mM EDTA, pH 8.0) supple-
mented with protease inhibitors (1 mM PMSF, 10 ␮g of pepstatin/ml, 10 ␮gof
leupeptin/ml, and 10 ␮g of aprotinin/ml). The lysates were centrifuged at high
speed to remove the cell debris. A control serum was used to preclear the lysate
before it was incubated with specific antibody. Precleared lysates were then
incubated with anti-ATR, NPM1, BRG1 or PARP-1 antibodies overnight at 4°C
with rotation and further incubated with protein A/G Sepharose beads at 4°C for
1 h with rotation. The resulting immunoprecipitates were collected by centrifu-
gation at 2,000 ⫻ g for 3 min at 4°C, and the pellets were washed four times with
1 ml of ice-cold RIPA buffer. The immunoprecipitated pellets were resuspended
in 30 ␮lof2⫻ SDS protein sample buffer (62.5 mM Tris [pH 6.8], 40 mM DTT,
2% SDS, 0.025% bromophenol blue, and 10% glycerol) and then resolved using
SDS-PAGE with an 8% polyacrylamide gel. The separated proteins were trans-
ferred to a nitrocellulose membrane. Western blot analysis was performed for
the detection of LANA protein by the use of an anti-rabbit polyclonal antibody.
Similarly, reverse immunoprecipitation with an anti-LANA polyclonal serum was
performed for BJAB and BC-3 cells, which were probed for the detection of
ATR, NPM1, BRG1, or PARP-1 coimmunoprecipitation with LANA.
RESULTS
Affinity purification of KSHV TR binding proteins. DNA
binding proteins are involved in a large number of cellular
processes, such as transcription, replication, and recombina-
tion. It is well known that the biological activities of virus are
tightly associated with the activities of a number of cellular
processes. Moreover, since the terminal repeat element of
KSHV is a pivotal component required for the modulation
of viral replication, transcription, and long-term maintenance
FIG. 1. Proteomic study of TR binding proteins. (A) experimental design. KSHV TR element and 30-bp high-GC repeat control DNA were
bound to an activated CNrB resin column. Nuclear extracts from KSHV-positive (⫹) (BC-3) or -negative (⫺) (BJAB) cells were incubated with
the column, and proteins were eluted from the TR or control column, respectively. High-salt eluted materials were resolved on an SDS-PAGE gel.
The visible bands from a TR DNA affinity column were collected and subjected to protein mass spectrometry. (B) Coomassie blue staining of TR
binding proteins. Nuclear proteins from KSHV-positive (BC-3) and -negative (BJAB) cells bound to the TR affinity column were extensively
washed. TR binding proteins were eluted with elution buffer containing increased concentrations of salt. The proteins eluted at high-salt
concentrations (300 mM, 500 mM, and 1,000 mM NaCl) were resolved by SDS-PAGE (8%) and stained with Coomassie blue. Distinct bands were
identified and excised for proteomic analysis (LCQ sequencing). In total, 96 bands were subject to proteomic analysis, of which 36 were from BJAB
cells and 60 bands were from BC-3 cells.
FIG. 2. Profiling of TR binding proteins. The total proteins eluted
from both the KSHV-positive and -negative column cells (A), proteins
specific from KSHV-positive (B) and -negative columns (C), and pro-
teins common in both columns (D) were categorized into nine cate-
gories according to the functions of the proteins. The profiling of these
TR binding proteins is summarized in panels A to E.
aaaaaaaaaa
V
OL. 80, 2006 PROTEOMIC ANALYSIS OF KSHV TR BINDING PROTEINS 9019

TABLE 1. KSHV TR binding proteins eluted with 300 mM NaCl from BC3 and BJAB cells
a
Molecular
mass (kDa)
Description of TR binding proteins eluted from cell type
b
BJAB BC3
260 DNPK1 DNPK1
240 N DNA-PKcs; BRG1-associated factor 250a; nucleophosmin
1; ATR kinase
235 N U5 200-kDa protein; RNA polymerase II largest subunit;
Ki-67; nucleophosmin 1
230 N Topo II beta; DNA topoisomerase (ATP-hydrolyzing) (EC
5.99.1.3) alpha
220 BRG1 Nuclear DNA helicase II; splicing factor 3b, subunit 2
205 N BRG1; SNF2-alpha
195 SWI/SNF complex 155 N
185 SWI/SNF related, subfamily c, member 2; DNA
topoisomerase alpha
BRG1-associated factor 170
180 N Scaffold attachment factor B;
L-histidine decarboxylase;
SWI/SNF complex 155-kDa subunit
175 NA Splicing factor 3b, subunit 1; nuclear DNA helicase II
128 PARP-1; ADPRT; splicing factor 3a, subunit 1 PARP-1; ATP-dependent RNA helicase
120 Proliferating cell nuclear protein P120; DEAD box
polypeptide 24; PARP-1; 5⬘ to 3⬘
exoribonuclease 2
5⬘ to 3⬘ exoribonuclease
110 DNA topoisomerase I, similar to splicing factor
proline/glutamine rich; gamma interferon-
inducible protein 16
DNA topoisomerase I; mitochondrial topoisomerase I;
Cdc5-related protein, similar to splicing factor praline/
glutamine rich; gizzard PTB-associated splicing factor
105 N RNA helicase Gu; UBF-1
95 DEAD box-1; GTF3C4 protein DEAD box protein RB
85 N hnRNP R; DEAD/H box polypeptide 18; FUSE binding
protein
82 N DEAD/H box-3, Y linked; CAP-Rf; hnRNP Q2;
PABP-2
75 N hnRNP R; KU70; heat shock 70-kDa protein 8 isoform 1;
DEAD box polypeptide 17 isoform 1;
70 N N
62 DEAD/H box polypeptide 3 hnRNP K; DEAD/H box polypeptide 5
60 N hnRNP K isoform A; SWI/SNF complex 60-kDa subunit
56 N hnRNP K; PRP4; dyskerin; HSPC117; PAI-RBP1
55 N HSPC117; PAI-RBP1 protein; hnRNP K; mRNA (guanine-7)
methyltransferase
52 DNA topoisomerase I Paraneoplastic antigen like 5; hnRNP H1; CD2 antigen
(cytoplasmic tail) binding protein
48 N BAF53; HIV-1 Rev binding protein 2; nucleophosmin 1;
translation initiation factor eIF-4A2 homolog; RNA
binding protein AUF1; PDIP46 protein; hnRNP F;
DAZ-associated protein 1 isoform B; DEAD box protein
Continued on facing page
9020 SI ET AL. J. V
IROL.

of the virus in human cells (20, 30, 48), identification of the
cellular proteins binding to TR would be critically important
for a better understanding of the mechanisms involved in
KSHV maintenance and pathogenesis. A proteomics techno-
logical approach is well suited for systematically studying the
molecular anatomy of the TR and its DNA binding proteins. In
this study, the 801-bp TR DNA was purified and bound to a
simple and effective DNA affinity resin (22). Nuclear proteins
isolated from KSHV-positive (BC-3) and KSHV-negative
(BJAB) cell lines were isolated and subjected to the TR affinity
column separately. TR binding proteins bound to the column
were sequentially eluted with elution buffer containing an in-
creased concentration of salt. The proteins eluting at high-salt
concentrations (300 mM, 500 mM, and 1,000 mM NaCl) were
collected and resolved with 8% SDS-PAGE and stained with
Coomassie blue (Fig. 1A and B).
A total of 96 clearly visible bands, ranging from larger than
260 kDa to 28 kDa, were obtained from both KSHV-positive
and -negative cells from the above-mentioned three elutions
after Coomassie blue staining (Fig. 1). A comparison of pro-
tein bands revealed that there were some specific differences
seen in elutions from the KSHV-positive TR column for all the
salt concentrations (Fig. 1B). In total, 24 additional bands were
seen when combining all three elutions of KSHV-positive cells
compared to those seen with elutions of KSHV-negative cells
(60 and 36 bands, respectively) (Fig. 1). In addition, a small
number of bands (7 bands in the BJAB lane and 11 bands in
the BC-3 lane) were obtained at a very high-stringency elution
condition of 1 M NaCl in both cell lines (Fig. 1B).
Identification of the proteins associated with the TR DNA
elements. To identify TR binding proteins, all 96 protein bands
were excised from the gel and subjected to liquid chromatog-
raphy-tandem mass spectrometry analysis at the Proteomics
Core Facility at the University of Pennsylvania School of Med-
icine.
In this study, the search engine Mascot was used for protein
identification by searching MS data against primary sequence
databases (39). Mascot uses a statistical scoring algorithm, the
MOWSE score, to calculate the matching scores that represent
the level of confidence for the identification. According to its
calculation, significance thresholds differ between peptides in
the search. Therefore, in our results both MOWSE scores and
significance thresholds were considered. MS spectra were also
manually inspected to ensure that the identifications were rea-
sonable and of high confidence. In some cases, the score of a
single peptide was low (lower than the threshold), but corre-
lation with other identified peptides from the same protein and
peptide mass mapping results led to increased confidence in
the identification. The theoretical molecular weights of the
identified proteins were typically well matched to their corre-
lated positions on the gel, also supporting the MS results and
the level of confidence.
The results of the analysis identified 123 proteins from the
96 excised bands (Fig. 2). No protein was identified in three of
the gel bands (Tables 1 to 3). Table 1 shows the protein iden-
tification results categorized in KSHV-positive and -negative
cells and the corresponding molecular masses of proteins
eluted at 300 mM. Two additional detailed tables (Tables 2 and
3) show protein identification results of the bands eluted at 500
mM and 1 M, respectively. Notably, more than one protein was
identified in most bands, suggesting that the most visible bands
were a mixture of multiple proteins in the one-dimensional gel
slice. A comparison of the proteins identified indicated that
some were found in more than one band, corresponding to
different molecular masses, such as BAF250a, splicing factor
prp8, NPM1, BRG1/SMARCA4 isoform 2, U5 200-kDa
snRNP-specific protein, and the switch/sucrose nonfermenting
(SWI/SNF) complex 155-kDa subunit. This may reflect poten-
tial posttranslational modifications of a protein altering its
molecular mass (e.g., glycosylation and ribosylation, alternative
splice forms, or partial degradation of a protein); the identities
of these modifications are beyond the scope of this initial
study.
As indicated above, the identification results also showed a
trend of more proteins in low-salt elution and KSHV-positive
BC-3 cells than in KSHV-negative cells (compare Tables 1, 2,
TABLE 1—Continued
Molecular
mass (kDa)
Description of TR binding proteins eluted from cell type
b
BJAB BC3
39 N hnRPC; nucleophosmin 1; poly(rC) binding protein 2
isoform B; HNRAB protein; NF-AT 45-kDa protein
38 BA18I14.2.2 N
35 NA FBRNP; splicing factor U2AF 35-kDa subunit
31 hnRNP A2; hnRNP A1; hnRNP H3;
casein alphaS1
hnRNP R; DEAD/H box polypeptide 18; FUSE
binding protein
30 N hnRPA1B2 protein; hnRNP A1
29 N hnRNP A1; hnRNP A2; hnRNP A3; alternative splicing
factor ASF-2; fibulin 1 isoform D; fibrillarin; dynein,
axonemal, heavy polypeptide; bZIP-enhancing factor;
histone H1c
a
eIF, eukaryotic initiation factor; HIV-1, human immunodeficiency virus type 1; N, no bands shown; NA, data not available; PABP-2, poly(A) binding protein 2; PTB,
polypyrimidine tract binding protein; RB, retinoblastoma; UBF, upstream binding factor.
b
The numbers of proteins eluted from BJAB and BC3 cells were 14 and 28, respectively.
VOL. 80, 2006 PROTEOMIC ANALYSIS OF KSHV TR BINDING PROTEINS 9021

and 3 and Fig. 3A). The 123 polypeptides identified were
grouped into nine specific categories, and one group was un-
categorized as the proteins did not fit into any selected groups
(Fig. 2A). In KSHV-positive BC-3 cells, 116 proteins were
identified from 59 gel bands (no polypeptides were identified
in 1 of the bands) from all three elutions and 95 proteins were
seen exclusively in KSHV-positive BC-3 cells (Fig. 2B). How-
ever, in KSHV-negative BJAB cells, 28 proteins were identi-
fied from 34 gel slices (no proteins were identified in 2 of the
bands) from all three elutions, with only 7 proteins seen exclu-
sively in KSHV-negative BJAB cells (Fig. 2C and D). A com-
prehensive list, including accession numbers of all proteins
identified from all three elutions of KSHV-positive and -neg-
ative cell lines, are presented in Table 4 and are schematically
shown in Fig. 2E.
The identified proteins were grouped in 10 categories based
TABLE 2. KSHV TR binding proteins eluted with 500 mM NaCl in BC3 and BJAB cells
a
Molecular
mass (kDa)
Description of TR binding proteins eluted from cell type
b
BJAB BC3
260 N Splicing factor Prp8; nucleophosmin 1
240 BRG1-associated factor 250a BRG1-associated factor 250a; nucleophosmin 1
235 BRG1-associated factor 250a; splicing factor Prp8 Splicing factor Prp8; U5 snRNP-specific protein, 200 kDa
230 U5 snRNP 200 kDa; BRG1-associated factor 250a; SMARCA4
isoform 2
U5 snRNP-specific protein, 200 kDa
220 SMARCA4 isoform 2; SNF2-alpha SMARCA4 isoform 2; SNF2-alpha; PDCD 11
185 SWI/SNF complex 170-kDa subunit; BRG1-associated factor 170 SWI/SNF related, subfamily c
175 SWI/SNF complex 155-kDa subunit; splicing factor 3b, subunit 1,
155 kDa
SWI/SNF complex 155-kDa subunit
128 PARP-1; E1B 55-kDa-associated protein 5 PARP-1
110 DNA topoisomerase I DNA topoisomerase I; DEAD box polypeptide 23,
similar to splicing factor proline/glutamine rich; E1B
55-kDa-associated protein 5
95 DEAD box-1, similar to Ewing’s sarcoma breakpoint region 1 DEAD box-1, similar to Ewing’s sarcoma breakpoint
region 1; histone H1c
82 DEAD 3 NA
70 N DEAD box-5; CARF; FUS/TLS protein
62 hnRNP K isoform 1; cellular senescence-inhibited gene protein;
splicing factor U2AF large chain, human
hnRNP isoform K
60 Splicing factor U2AF large chain, human hnRNP K; U4/U6.U5 tri-snRNP-associated 65-kDa
protein; splicing factor U2AF large chain, human;
splicing factor SF3a60; dynain
56 N hnRNP; hypothetical protein DKFZp434I1614.1
55 Cytokeratin 1 RNA binding protein 56; RNA polymerase II; HSPC117;
ATR kinase; nuclear matrix protein NMP200 related
to splicing factor PRP19
39 N hnRNP H1; paraneoplastic antigen like 5; Ecto-ATPase
35 hnRNP K isoform A2; hnRNP A3 FBRNP; hnRNP A3; HNRPC; EndoA⬘ cytokeratin
31 hnRNP A2; hnRNP A3; hnRNP H3; hnRNP core protein A1 hnRNP A2/B1 isoform B1; hnRNP core protein A1;
hnRNP H3 isoform A; fibrillarin; histone H1d
30 N hnRNP A1; hnRNP A2; hnRNP A3; hnRNP H3; dynein,
axonemal, heavy polypeptide 8
29 N hnRNP A2; RPS2
a
N, no bands shown; NA, data not available.
b
The numbers of proteins eluted from BJAB and BC3 cells were 15 and 21, respectively.
9022 SI ET AL. J. VIROL.

on their functions, which are shown in Fig. 2, and a detailed list
is provided in Table 5. The categories include the following:
proliferation/cell cycle regulatory proteins, proteins involved in
spliceosome components, such as heterogeneous nuclear ribo-
nuclear proteins, the DEAD/H family, the SWI/SNF protein
family, splicing factors, RNA binding proteins, transcription
regulation proteins, replication factors, modifying enzymes,
and a number of proteins that did not specially fit into any of
the above-listed groups based on known function and so re-
mained uncategorized.
Confirmation of individual proteins binding to the TR DNA
by Western blot analysis. To confirm the specificity of the TR
binding proteins, 400-to-1,000 bp DNA fragments composed of
30-bp double-stranded DNA repeats were used as the control
DNA column. The repeats are noncoding sequences of the
KSHV genome and have similar GC contents (approximately
83%) to TR. The eluted proteins from the control DNA col-
umn and TR element column were resolved on 8% SDS-
PAGE and transferred to a nitrocellulose membrane. After
Ponceau S staining, significantly fewer bands were seen, to an
almost undetectable level, on the membranes of control DNA
compared to those for the TR element elutions (Fig. 3A).
After probing with specific antibodies against the candidate
proteins PARP-1, ATR, NPM1, and BRG1, the presence of
these proteins was predominantly detected in the TR column
but not in the control DNA column (Fig. 3B). In addition,
because KSHV LANA is demonstrated to bind to the TR, the
presence of LANA protein was also verified in elutions from
the TR column (Fig. 3B, top panel). The data showed that
LANA mostly eluted from the column at 500 mM NaCl, an
extent similar to those of ATR and PARP-1 (Fig. 3, lane 4).
FIG. 3. Specific binding of candidate proteins to TR DNA affinity
column. (A) Ponceau S staining of nuclear extracts and TR binding
proteins identified at different salt concentrations. Nuclear extracts
(NE) and the high-salt-eluted proteins from both TR as well as control
DNA column were resolved on an 8% SDS-PAGE gel and stained with
Ponceau S. In comparison with the protein bands obtained from the
TR column, fewer bands were shown in control column. (B) The
presence of candidate proteins LANA, ATR, BRG1, NPM1, and
PARP-1 was detected in nuclear extracts, with faint signals for LANA
in BJAB due to overflow from the BC-3 NE lane. These proteins were
eluted from the TR column lane but not the control column.
TABLE 3. KSHV TR binding proteins eluted with 1 M NaCl in BC3 and BJAB cells
a
Molecular
mass (kDa)
Description of TR binding proteins eluted from cell type
b
BJAB BC3
240 BRG1-associated factor 250a BRG1-associated factor 250a
235 N Splicing factor Prp8
220 SNF2-alpha; SNF2-like 4 SMARCA4 isoform 2
185 SWI/SNF related, subfamily c, member 2 SWI/SNF related, subfamily c, member 2
175 Cytokeratin 1 Cytokeratin 1
70 N Fusion derived from t(12;16) malignant liposarcoma
62 Keratin 2a Cytokeratin 1
60 hnRNP K; splicing factor U2AF large chain,
human
hnRNP H1; SWI/SNF-related matrix-associated actin-dependent regulator
of chromatin d2; splicing factor U2AF
35 hnRNP A2/B1 isoform B1; dynein, axonemal,
heavy polypeptide 8
hnRNP A2; hnRNP A1; hnRNP H3 isoform A; hnRNP A3
31 hnRNP A2/B1 isoform B1; hnRNP H3
isoform A; TRRAP
hnRNP A2/B1 isoform B; hnRNP A3; hnRNP H3 isoform A
30 N hnRNP A2/B1 isoform B; dynein, axonemal, heavy polypeptide 8; histone
acetyltransferase MOZ2; envelope glycoprotein (HIV-1)
a
HIV, human immunodeficiency virus type 1; N, no bands shown.
b
The numbers of proteins eluted from BJAB and BC3 cells were 7 and 11, respectively.
VOL. 80, 2006 PROTEOMIC ANALYSIS OF KSHV TR BINDING PROTEINS 9023

TABLE 4. KSHV TR binding proteins identified in BC3 and BJAB cells
a
Molecular
mass (kDa)
Description of TR binding proteins eluted from cell type
BJAB BC3
260 DNPK1 (AAC50210) DNPK1; splicing factor Prp8 (CK610786); nucleophosmin 1 (NP_002511)
240 BRG1-associated factor 250a (AF231056) DNA-PKcs (P78527); BRG1-associated factor 250a; nucleophosmin 1;
ATR (NP_001175)
235 BRG1-associated factor 250a; splicing factor Prp8 U5 220-kDa protein (NP_006436); RNA polymerase II (NP_631961);
Ki-67 (NP_002408); nucleophosmin 1; splicing factor Prp8; U5
snRNP-specific protein, 200 kDa
230 U5 snRNP 200 kDa; BRG1-associated factor 250a;
BRG1
Topo II beta (NP_033435); DNA topoisomerase (ATP-hydrolyzing) (EC
5.99.1.3) alpha (A40493); U5 snRNP-specific protein, 200 kDa
(O75643)
220 BRG1 (AAG24790) Nuclear DNA helicase II; splicing factor 3b, subunit 2 (AAH00401);
SNF2-alpha (P51531); PDCD 11 (NM_014976); BRG1
195 SWI/SNF complex 155 (AAC50693) BRG1; SNF2-alpha
185 SWI/SNF-related subfamily c, member 2; DNA
topoisomerase alpha (CAA76313); SWI/SNF
complex 170-kDa subunit
BRG1-associated factor 170 (NP_620706); SWI/SNF related, subfamily c
180 N Scaffold attachment factor B (AAC18697);
L-histidine decarboxylase
(D16583); SWI/SNF complex 155-kDa subunit
175 SWI/SNF complex 155-kDa subunit (XP_343571);
splicing factor 3b, subunit 1; cytokeratin 1
Splicing factor 3b, subunit 1 (XP_343571); nuclear DNA helicase
II(NP_776461); SWI/SNF complex 155-kDa subunit;
cytokeratin 1 (P04264)
128 PARP-1 (P09874); ADPRT (NP_037195); splicing
factor 3a, subunit 1 (AAH29753); E1B 55-kDa-
associated protein 5 (AAH02564)
PARP-1; ATP-dependent RNA helicase (Q08211)
120 Proliferating cell nuclear protein P120 (AAA36398);
DEAD box polypeptide 24 (NP_065147); PARP-1;
5⬘–3⬘ exoribonuclease 2 (NP_036387)
5⬘–3⬘ exoribonuclease (NP_036387); DEAD box polypeptide 23
(AAH02366), similar to splicing factor proline/glutamine rich
(AAH04534); E1B 55-kDa-associated protein 5
110 DNA topoisomerase I (NP_003277), similar to
splicing factor proline/glutamine rich; gamma
interferon-inducible protein 16 (AB208989)
DNA topoisomerase I; mitochondrial topoisomerase I (NP_443195);
Cdc5-related protein (NP_001244), similar to splicing factor
praline/glutamine rich (AAH04534); gizzard PTB-associated
splicing factor (AAC59935)
105 N RNA helicase Gu (PC6010); UBF-1
95 DEAD box-1 (NP_004930); GTF3C4 protein
(BC094774)
DEAD box protein RB (NP_004930), similar to Ewing’s sarcoma
breakpoint region 1 (AAH11048)
85 N hnRNP R (AAH01449); DEAD/H box polypeptide 18 (AAH01238);
FUSE binding protein (AAC50892)
82 DEAD 3 DEAD/H box-3, Y linked (NP_004651); CAP-Rf (NM_001356);
hnRNP Q2 (AAK59704); PABP-2 (Q15097)
75 N HnRNP R (XP_001541); KU70 (NP_001460); heat shock 70-kDa
protein 8 isoform 1 (NP_006588); DEAD box polypeptide 17
isoform 1 (NP_006377)
70 N DEAD box-5; CARF (NM_017632); FUS/TLS protein; fusion derived
from t(12;16) malignant liposarcoma (AAH26062)
62 DEAD/H box polypeptide 3 (NP_001347); hnRNP
K isoform 1; cellular senescence-inhibited gene
protein (AAN46298); splicing factor U2AF large
chain, human (S20250); keratin 2a (NP_000414)
Cytokeratin 1; hnRNP K (NP_079555); DEAD/H box polypeptide 5
(NP_004387)
Continued on facing page
9024 SI ET AL. J. V
IROL.

BRG1 was seen to be tightly associated with the TR in BC-3
but had the same lower level of signal as that in the elution
from BJAB cells which are KSHV negative (Fig. 3, lanes 2, 4,
and 6). Interestingly, NPM1/B23 associated predominately
with TR from BC-3 extracts and was mostly eluted at 300
mM NaCl, with no detectable signals at 500 mM and 1 M
salt elutions (Fig. 3, lanes 2 and 4). Thus, ATR, BRG1,
NPM1/B23, and PARP-1 all associated with the TR DNA
element predominantly in the presence of KSHV latent
antigens which include LANA (Fig. 2, lanes 2, 4, and 6).
Although PARP-1 associated with the TR from BC-3 ex-
tracts with the highest signal at 500 mM elution, some sig-
nals were also seen in BJAB extracts at 300 and 500 mM and
1 M elutions, suggesting that PARP-1 is associated with the
TR element independently of the presence of the KSHV
latent antigen, including LANA.
Physical interaction between LANA candidate proteins and
KSHV TR element. To determine whether the candidate pro-
teins can bind to the TR DNA element, we examined the
interaction between candidate proteins and TR in BC-3 cells
by ChIP assay. The cross-linked chromatin from 50 million
cells was immunoprecipitated with specific antibodies against
PARP-1, ATR, NPM1, and BRG1, and a specific sequence was
amplified using primers that amplified a 90-bp amplicon within
the TR element. The results of the interaction between candi-
date proteins and the TR in the KSHV-positive cells are shown
by ChIP analysis (Fig. 4). ChIP analysis showed that the four
candidate proteins, PARP-1, ATR, NPM1, and BRG1, asso-
TABLE 4—Continued
Molecular
mass (kDa)
Description of TR binding proteins eluted from cell type
BJAB BC3
60 hnRNP K; splicing factor U2AF large chain, human hnRNP K isoform A; SWI/SNF complex 60-kDa subunit (AAC50696);
U4/U6.U5 tri-snRNP-associated 65-kDa protein (AAK49524); splicing
factor U2AF large chain, human; splicing factor SF3a60 (CAA57388);
dynein, axonemal, heavy polypeptide 8 (NP_001362); hnRNP H1
(NP_005511)
56 N hnRNP K; PRP4 (XP_131444); dyskerin (CAB51168); HSPC117; PAI-
RBP1 PAI-RBP1 (AAH02488); hypothetical protein
DKFZp434I1614.1 (T46344)
55 Cytokeratin 1 HSPC117 (BC016707); PAI-RBP1 protein; hnRNP K; mRNA (guanine-
7) methyltransferase (AB022605)
52 DNA topoisomerase I Paraneoplastic antigen-like 5; hnRNP H1; CD2 antigen (cytoplasmic tail)
binding protein (NP_006101)
48 N BAF53 (CR533529); HIV-1 Rev binding protein 2 (AAH16778);
nucleophosmin 1; translation initiation factor eIF-4A2 homolog
(S45142); RNA binding protein AUF1 (A54601); PDIP46 protein
(AAH01488); hnRNP F (AAH16736); DAZ-associated protein 1
isoform B (NP_061832); DEAD box protein (CAC14786)
39 BA18I14.2.2 (CAC08398) hnRPC (AAC61695); nucleophosmin 1; poly(rC) binding protein 2
isoform B (NP_035995); HNRAB protein (NP_006749); NF-AT 45-
kDa protein (BG625087); hnRNP H1; paraneoplastic antigen like 5
(BC101111); Ecto-ATPase (XP_302537)
35 hnRNP K isoform A2; hnRNP A3; dynein,
axonemal, heavy polypeptide 8
FBRNP (AA408025); splicing factor U2AF 35-kDa subunit; hnRNP A3;
HNRPC; EndoA⬘ cytokeratin (AAA37551); hnRNP H3 isoform A
31 hnRNP A2 (NP_112533); hnRNP A1 (P09651);
hnRNP H3 (XP_165561); casein alphaS1; hnRNP
core protein A1
hnRNP R; DEAD/H box polypeptide 18; FUSE binding protein; hnRNP
A2/B1 isoform B1 (NP_112533); hnRNP core protein A1 (P09651);
hnRNP H3 isoform A (NP_036339); fibrillarin (NP_001427); histone
H1d (NP_005310); hnRNP A3 (XP_165561)
30 N hnRPA1B2 protein; hnRNP A1; hnRNP A2; hnRNP A3; hnRNP H3;
dynein, axonemal, heavy polypeptide 8; histone acetyltransferase
MOZ2 (AF217500); envelope glycoprotein (HIV-1) (AAK85226)
29 N hnRNP A1; hnRNP A2; hnRNP A3; alternative splicing factor ASF-2
(B40040); fibulin 1 isoform D (CO779977); fibrillarin (NP_001427);
dynein, axonemal, heavy polypeptide; bZIP-enhancing factor
(NP_005773); histone H1c (NP_005311); hnRNP A2; RPS2
(AB082925)
a
eIF, eukaryotic initiation factor; HIV-1, human immunodeficiency virus type 1; N, no bands shown; PABP-2, poly(A) binding protein 2; PTB, polypyrimidine tract
binding protein; RB, retinoblastoma; UBF-1, upstream binding factor 1.
VOL. 80, 2006 PROTEOMIC ANALYSIS OF KSHV TR BINDING PROTEINS 9025

ciated with the TR DNA element, with no detectable signals
seen with the match antibody control (Fig. 4). These results
suggest that these proteins associated with the TR elements
and that it is possible that their signals also include association
with LANA bound to the TR element, although they may also
be able to be independent in their association with the TR
element.
Colocalization of LANA, PARP-1, ATR, NPM1, and BRG1
with TR DNA. Cellular and/or viral molecules that interact
in cells typically would also colocalize in vitro. Colocalization
in KSHV-positive BC-3 cells was detected by immunofluo-
rescence in situ hybridization analysis. Candidate proteins
(PARP-1, ATR, NPM1, and BRG1) were stained with specific
antibodies, and the viral DNA was probed with TR-specific
TABLE 5. Category of KSHV TR binding proteins
a
Category
Description of KSHV TR binding protein for cell type
BJAB specific Common BC3 specific
Proliferation/cell cycle
regulation
Proliferating cell nuclear protein
P120; cellular senescence-
inhibited gene protein
Ki-67; PDCD 11; proto-oncogene c-ros-1 protein precursor;
Cdc5-related protein; putative serine-rich protein, CARF;
CD2 antigen (cytoplasmic tail) binding protein 2
DEAD/H family DEAD/H box-1, -3, -9, and -23 DEAD/H box-5, -17, -18, and -4, RB, polypeptide 21 (Gu)
hnRNP protein family hnRNP protein family (U, K, A2,
A3, and H3)
hnRNP protein family (R, L, H1, F, A1, core protein A1,
Q2, hnRNB, and FBRNP), Similar to hnRNP U
SWI/SNF protein
family
SNF2-like 4 SNF60; SNF2-alpha; BAF250a;
SWI/SNF complex 155
SNFc2; SNFe1; SNF2d2; SMARCA4 isoform 2; possible
global transcription activator SNF2L2
Modifying enzyme PARP-1 HSPC117; ATR kinase; DNA-PK; kinesin family member
1B isoform alpha
Splicing factor Splicing factor 3a, subunit 1 U5 200-kDa protein; splicing
factor 3b, subunit 155 kDa;
splicing factor prp8
U5 snRNP-specific protein; U4/U6.U5 tri-snRNP-
associated 65-kDa protein; splicing factor, arginine/
serine-rich 8 isoform 1; precursor mRNA processing
protein; splicing factor 3b, subunit 2; splicing factor
SF3a60; alternative splicing factor ASF-2; splicing factor
U2AF 35 kDa; alternative splicing factor ASF-3; nuclear
matrix protein NMP200 related to splicing factor PRP19;
gizzard PTB-associated splicing factor; PRP4 pre-mRNA
processing factor 4 homolog; U3 small nucleolar
interacting protein
RNA binding proteins Poly(rC) binding protein 2 isoform B; PAI-RBP1 protein;
putative RNA binding protein KOC; AUF1; poly(A)
binding protein 2; TIA-1 protein; DAZ-associated
protein 1 isoform B; scaffold attachment factor B
Transcription
regulation proteins
GTF3C4 protein/general
transcription factor 3C
polypeptide 4; gamma
interferon-inducible
protein 16; TRRAP
5⬘–3⬘ exoribonuclease 2 mRNA (guanine-7) methyltransferase; bZIP-enhancing
factor; RNA polymerase II largest subunit; Dhm1-like
protein; nucleolar transcription factor 1 (UBF-1); FUS/
TLS protein; FUSE binding protein; translation initiation
factor eIF-4A2 homolog, human; transcription factor NF-
AT 45K; ATP-dependent RNA helicase A; TBP-
associated factor, RNA polymerase II; U3 small
nucleolar interacting protein; dyskerin; BAF53; fibrillarin
Replication factor E1B 55-kDa-associated protein; DNA
topoisomerase I
PDIP46 protein;
L-histidine decarboxylase; E1B 55-kDa-
associated protein; DNA topoisomerase (ATP-
hydrolyzing) (EC 5.99.1.3) alpha; DNA topoisomerase II;
histone H1c; histone acetyltransferase MOZ2
Uncategorized Dynein Heat shock 70-kDa protein 8 isoform 1; beta spectrin;
clathrin heavy chain 1; HIV-1 Rev binding protein 2;
envelope glycoprotein (HIV-1); ecto-ATPase
(ectonucleoside triphosphate diphosphohydrolase 2
isoform 1); nucleophosmin 1; myoblast antigen 24.1D5;
similar to Caenorhabditis elegans hypothetical 55.2-kDa
protein F16A11.2; KIAA 1934 protein; protein for
IMAGE:3938975; thyroid hormone receptor interactor
12; CLTC protein; protein for MGC:9466, similar to
Ewing’s sarcoma breakpoint region 1; hypothetical
protein DKFZp434I1614.1; fusion derived from t(12;16)
malignant liposarcoma; centaurin beta 5; pyruvate kinase,
liver, and RBC type; pyruvate kinase type L; similar to
splicing factor proline/glutamine rich; fusion derived
from t(12;16) malignant liposarcoma
a
eIF, eukaryotic initiation factor; HIV-1, human immunodeficiency virus type 1; PTB, polypyrimidine tract binding protein; RB, retinoblastoma; RBC, red blood cell;
TBP, TATA box binding protein; UBF-1, upstream binding factor 1.
9026 SI ET AL. J. VIROL.

DNA fragments. Confocal microscopy showed that these pro-
teins colocalized with the KSHV genome. Signals for the TR
DNA, LANA protein, and candidate proteins (PARP-1, ATR,
BRG1, and NPM1) were clearly colocalized, suggesting an
association of these proteins in a complex in KSHV-infected
cells (Fig. 5). These candidate proteins were all seen to colo-
calize with LANA in punctuate nuclear signals with the exclu-
sion of the nucleolus. Blue DAPI staining showed nuclear
chromatin stain. Brick-red merged panels showed the colocal-
ization of the candidate proteins with the KSHV genome sig-
nals, the orange merged signal showed the colocalization of
LANA and KSHV genome, as expected, and the white merged
signals indicated colocalization of LANA, candidate protein
ATR, BRG1, NPM1, or PARP-1, DAPI, and the KSHV ge-
nome (Fig. 5).
LANA associates with the candidate proteins ATR, NPM1,
BRG1, and PARP-1 in KSHV-positive cells. To further corrob-
orate the above-mentioned observations, we performed immu-
noprecipitation analysis for each of the above-mentioned pro-
teins or LANA and performed Western blotting for specific
antigens to determine whether they associated in a complex in
KSHV-positive cells. The results indicated that LANA associ-
FIG. 4. Physical interactions between candidate proteins and TR. The interaction between candidate proteins PARP-1, ATR, NPM1, BRG1,
and TR in BC-3 cells were confirmed by ChIP assay. For each immunoprecipitation, 2 ⫻ 10
7
BC-3 or BJAB cells were cross-linked using
formaldehyde. Chromatin was sonicated to ⬃500-bp fragments and precleared. After incubation with anti-ATR, BRG1, NPM1, or PARP-1
antibodies (Abs), immune complexes were collected with salmon sperm DNA-protein A/G Sepharose. With extensive washing, chromatin was
reverse cross-linked to purify bound DNA. The region of TR was amplified with primers flanking nucleotides 677 to 766. pBSpuroA3 plasmid was
amplified in each test as a positive control. (A) Specific amplification of TR DNA immunoprecipitated by antibodies against candidate genes.
(B) Quantification of the immunoprecipitation based on quantification of the amplified specific bands. RD, relative density.
FIG. 5. Colocalization of candidate proteins with TR and LANA. Shown is the colocalization between candidate proteins PARP-1, ATR,
NPM1, and BRG1 and the TR as well as LANA in BC-3 cells. BC-3 cells were fixed and probed with the specific rabbit antibodies for LANA or
human anti-LANA serum combining antibody against candidate protein ATR, BRG1, NPM1, or PARP-1. Slides were visualized by appropriate
immunoglobulin-Alexa Fluor-conjugated secondary antibodies. Then cells were postfixed, treated with RNase A, and denatured. The slides were
subjected to in situ hybridization with biotin-labeled Z6 cosmid probe and detected with a streptavidin-conjugated Alex Flour 594. The nuclei were
counterstained with DAPI. FISH, fluorescence in situ hybridization.
VOL. 80, 2006 PROTEOMIC ANALYSIS OF KSHV TR BINDING PROTEINS 9027

ated with ATR, BRG1, NPM1, and PARP-1 in the KSHV-
infected BC-3 cell line, using a specific antibody for LANA
and Western blotting for each of the four candidate proteins
(Fig. 6A). Importantly, in the reverse immunoprecipitation
using specific antibodies against candidate proteins, Western
blot analysis showed that LANA was detected in the immune
complexes (Fig. 6B). Thus, ATR, BRG1, NPM1, and PARP-1
can associate with LANA and the TR DNA element and may
also be important for TR function and KSHV persistence in
the cells.
DISCUSSION
In this study, we have successfully combined stringent pro-
tein purification with DNA affinity column and sensitive MS
analysis to identify a set of proteins binding to KSHV TR
DNA. Here, we present the identification of 123 proteins that
were bound to the TR DNA element of KSHV from KSHV-
negative and -positive B cell lines. The identity of binding
proteins was performed by analysis of multiple polypeptides
for each protein and confirmed by LCQ sequencing.
The TR sequence of the KSHV genome contains at least two
cis elements for LANA binding per copy of the TR element (2,
20). While two or more copies of TR are required for long-
term maintenance, a single TR confers LANA-dependent or-
igin activity on plasmid DNA (17). The TR can function like an
autonomous replicating element, with LANA bound to the
cognate sequences within the TR supporting viral replication
(15). The fact that LANA can suppress transcription when
bound to the TR seems to challenge a model by which the TR
can directly contribute to KSHV DNA replication (14). Dele-
tion mapping revealed a 71-bp-long minimal replicator con-
taining two distinctive sequence elements: LANA binding sites
(LBS1/2) and an adjacent 29- to 32-bp-long GC-rich sequence,
which is referred to as the replication element (21). LANA
interacts with many cellular factors, including RING3, pRb,
p53, HP1, CREB binding protein, mSin3, MeCP2, DEK, his-
tone H1, ORCs, and glycogen synthase kinase 3␤ (4, 12, 13, 24,
28, 29, 40, 41, 50, 52). The majority of these factors are in-
volved in transcription, remodeling chromatin structure, and
replication. Moreover, in support of our previous work, we
noted an association of histone H1 isoforms C and D, espe-
cially in the BC-3 elution, suggesting a requirement for TR
proteins which include LANA. However, no association of
additional histone, including H2A and H2B, H3, and H4, was
identified in this comprehensive screen. These proteins may be
required for the maintenance of viral episomes as well as
regulation of the transcription program during latency. Con-
sistent with this idea, LANA is known to be an essential factor
for maintaining the viral genome (18). However, it has been
demonstrated that LANA does not have any enzymatic activity
like helicase or polymerase. Therefore, enzymes which contain
these activities and core components of the replication ma-
chinery are most likely recruited to the TR, contributing to the
initiation and replication of the viral episome during latency.
Notably, the majority of the proteins identified are KSHV
specific and were found to be associated with the TR from the
BC-3, but not the BJAB, KSHV-negative nuclear extracts. This
finding suggests that the binding between these proteins and
TR DNA is KSHV dependent. Thus, the binding of these
proteins to the TR element may be mediated by KSHV-en-
coded proteins, mainly LANA, as LANA is predominantly
expressed during latent infection and binds to the TR. The
identified proteins were grouped into several categories ac-
cording to their nuclear functions. Among these are structural/
nuclear matrix protein components, such as heterogeneous
nuclear ribonuclear proteins and protein-associated splicing
factor and chromatin regulatory and structural proteins, which
include histones as well as proteins involved in other DNA-
modulating activities, such as the chromatin-remodeling pro-
tein DEAD/DEAH proteins, and proteins whose nuclear func-
tions are not yet fully known. These proteins are most likely in
direct association with TR DNA or associated with other viral
or cellular proteins bound to the TR in a macromolecular
complex. Some of the identified proteins, for example the
histones, have also been shown to be involved in DNA meta-
bolic processes and in association with DNA (34). Some pro-
teins identified are involved in the regulation of cell prolifer-
ation, for example, in proliferating cell nuclear proteins P120
and Ki-67 (11, 16). However, some have not been strictly clas-
sified in terms of their functions. The results presented here
suggest that the TR DNA element is important for a number
of biological processes likely to be associated with KSHV per-
sistence in the infected cell.
DNA damage can be experimentally induced by irradiation,
UV exposure, and chemical treatment (19, 45). However, this
damage may also arise naturally as a consequence of DNA
replication (31). Many of the repair and recombination pro-
teins are reported to be redistributed to double-stranded
breaks after irradiation or chemical treatment and colocalize
with cellular DNA replication sites during S phase (32). It is
believed that the presence of stalled replication forks or
stretches of single-stranded DNA is responsible for recruiting
these factors (27). In the absence of such repair functions,
genomic integrity degrades. In this study, multiple proteins
FIG. 6. Physical interactions between candidate proteins and
LANA. (A) The interaction between candidate proteins PARP-1,
ATR, NPM1, BRG1, and LANA in BC-3 cells were confirmed by
coimmunoprecipitation assay by pulling down the above-mentioned
proteins along with LANA using LANA-specific antibody. A total of
8 ⫻ 10
7
BJAB and BC-3 cells were lysed in RIPA buffer. After pre
-
clearing, the lysate was incubated with specific antibody against LANA
and resolved with 8% SDS-PAGE. Western blotting for the indicated
proteins was done by stripping and reprobing the same membrane.
(B) Reverse immunoprecipitation with specific antibodies against pro-
teins indicated was performed for BC-3 cells and probed with LANA
polyclonal antibody. Ab, antibody; IP, immunoprecipitate; PC, pre-
clear; WB, Western blot.
9028 SI ET AL. J. V
IROL.

associated with DNA damage repair, such as ATR and poly-
(ADP-ribose) polymerase (PARP-1), have been identified.
PARP-1 is a nuclear enzyme which is activated in response to
genotoxic insults by binding to damaged DNA and attaching
polymers of ADP-ribose to nuclear proteins at the expense of
its substrate NAD
⫹
(35). PARP-1 is important in DNA dam
-
age signaling and has been reported to bind KSHV TR DNA
(38). Our result confirmed the interaction between PARP-1
and TR DNA and further demonstrated that in spite of bind-
ing directly to the TR, PARP-1 also associates with LANA
independently of the TR, suggesting a role of PARP-1 in the
context of LANA function. ATM and rad3-related (ATR) pro-
teins are members of the phosphoinositide 3-kinase related
kinase family (7). ATR plays a crucial role in the normal
cell-cycle and early development and is also responsible for the
DNA damage response that halts the progression of the cell
cycle, in particular, in response to a variety of DNA damage
signals (8). Importantly, and likely to be related to its associ-
ation with the KSHV TR element, ATR is speculated to mod-
ulate the progression of DNA replication by regulating S-phase
kinases at unfired origins from its vantage point at active or
stalled replication forks and sites of damage (5). Thus, it may
play a role in ensuring the continued firing of the initiation of
replication at the TR during latent infection.
Two main groups of chromatin remodeling complexes exist
in mammalian cells: (i) those requiring ATP hydrolysis to alter
histone-DNA contacts, such as SWI/SNF protein (49), and (ii)
those that covalently modify histone proteins by a variety of
posttranslational modifications (phosphorylation, acetylation,
and methylation), such as histone acetyltransferases, methyl-
transferases, and histone deacetylase complexes (17). We have
detected members of both types of complexes as TR binding
proteins from our study. BRG1 is an ATPase associated with
SWI/SNF protein (33). NPM1 (B23 protein) is a multifunc-
tional nucleolar protein whose molecular chaperone activity is
proposed to play a role in ribosome assembly (10). The iden-
tification of these proteins suggests a role for these proteins in
KSHV replication and transcription. There is evidence that
interactions with transcription factors may target SWI/SNF
complexes to specific promoters to regulate transcription. It is
also possible that KSHV uses a similar mechanism of targeted
regulation by recruiting SWI/SNF complexes to weak viral
promoters in early infection or during reactivation to enhance
the transcription of a selected set of promoters and also the TR
element controlling transcription of some viral genes which
include K1 (25, 26).
We believe that the large number of binding proteins reflects
the multiple roles of the KSHV TR element in viral DNA
replication and gene expression. Additionally, not all of the
binding proteins are likely to interact directly with the TR
DNA. Therefore, some of the interactions may be dependent
on interaction with intermediate viral binding partners like
LANA. It remains to be determined which TR binding pro-
teins physically interact with TR independently of viral pro-
teins. Many of the identified proteins associate with numerous
other proteins, including other TR binding proteins. It is pos-
sible that the association of TR with one or two proteins may
lead to the recruitment of numerous other proteins or com-
plexes required for specific functions.
We hypothesize that KSHV recruits some of these cellular
proteins to the TR element which contains a latent replication
ori to participate directly in KSHV replication. Alternatively,
they may be targeted to damaged viral DNA that arises during
replication. The determination of the functions of these pro-
teins in the context of KSHV infection is likely to be complex.
A number of the TR binding proteins function in the major
cellular recombination repair pathways; thus, it will be of in-
terest to determine whether these proteins have a necessary
role in KSHV replication, are recruited to sites of DNA dam-
age or stalled replication forks, or may increase the efficiency
of KSHV replication initiation at the TR. Further studies are
needed to determine the specific role of the proteins identified
in viral infection and long-term genome persistence.
ACKNOWLEDGMENTS
This work was supported by grants from the Leukemia and Lym-
phoma Society of America and by public health service grants NCI
CA072510 and CA091792 and NIDCR DE01436 (to E.S.R.). E.S.R. is
a scholar of the Leukemia and Lymphoma Society of America.
We also thank Chao-Xing Yuan and the Proteomics Core Facility at
the University of Pennsylvania School of Medicine for their technical
support.
REFERENCES
1. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of
extrachromosomal KSHV DNA mediated by latency-associated nuclear an-
tigen. Science 284:641–644.
2. Ballestas, M. E., and K. M. Kaye. 2001. Kaposi’s sarcoma-associated her-
pesvirus latency-associated nuclear antigen 1 mediates episome persistence
through cis-acting terminal repeat (TR) sequence and specifically binds TR
DNA. J. Virol. 75:3250–3258.
3. Barbera, A. J., M. E. Ballestas, and K. M. Kaye. 2004. The Kaposi’s sarcoma-
associated herpesvirus latency-associated nuclear antigen 1 N terminus is
essential for chromosome association, DNA replication, and episome per-
sistence. J. Virol. 78:294–301.
4. Borah, S., S. C. Verma, and E. S. Robertson. 2004. ORF73 of herpesvirus
saimiri, a viral homolog of Kaposi’s sarcoma-associated herpesvirus, modu-
lates the two cellular tumor suppressor proteins p53 and pRb. J. Virol.
78:10336–10347.
5. Cha, R. S., and N. Kleckner. 2002. ATR homolog Mec1 promotes fork
progression, thus averting breaks in replication slow zones. Science 297:602–
606.
6. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles,
and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in
AIDS-associated Kaposi’s sarcoma. Science 266:1865–1869.
7. Cimprich, K. A., T. B. Shin, C. T. Keith, and S. L. Schreiber. 1996. cDNA
cloning and gene mapping of a candidate human cell cycle checkpoint pro-
tein. Proc. Natl. Acad. Sci. USA 93:2850–2855.
8. Cortez, D., S. Guntuku, J. Qin, and S. J. Elledge. 2001. ATR and ATRIP:
partners in checkpoint signaling. Science 294:1713–1716.
9. Cotter, M. A., II, and E. S. Robertson. 1999. The latency-associated nuclear
antigen tethers the Kaposi’s sarcoma-associated herpesvirus genome to host
chromosomes in body cavity-based lymphoma cells. Virology 264:254–264.
10. Dutta, S., I. V. Akey, C. Dingwall, K. L. Hartman, T. Laue, R. T. Nolte, J. F.
Head, and C. W. Akey. 2001. The crystal structure of nucleoplasmin-core:
implications for histone binding and nucleosome assembly. Mol. Cell 8:841–
853.
11. Fonagy, A., C. Swiderski, A. Wilson, W. Bolton, N. Kenyon, and J. W.
Freeman. 1993. Cell cycle regulated expression of nucleolar antigen P120 in
normal and transformed human fibroblasts. J. Cell. Physiol. 154:16–27.
12. Friborg, J., Jr., W. Kong, M. O. Hottiger, and G. J. Nabel. 1999. p53
inhibition by the LANA protein of KSHV protects against cell death. Nature
402:889–894.
13. Fujimuro, M., and S. D. Hayward. 2003. The latency-associated nuclear
antigen of Kaposi’s sarcoma-associated herpesvirus manipulates the activity
of glycogen synthase kinase-3␤. J. Virol. 77:8019–8030.
14. Garber, A. C., J. Hu, and R. Renne. 2002. Latency-associated nuclear antigen
(LANA) cooperatively binds to two sites within the terminal repeat, and both
sites contribute to the ability of LANA to suppress transcription and to
facilitate DNA replication. J. Biol. Chem. 277:27401–27411.
15. Garber, A. C., M. A. Shu, J. Hu, and R. Renne. 2001. DNA binding and
modulation of gene expression by the latency-associated nuclear antigen of
Kaposi’s sarcoma-associated herpesvirus. J. Virol. 75:7882–7892.
16. Gerdes, J., L. Li, C. Schlueter, M. Duchrow, C. Wohlenberg, C. Gerlach, I.
Stahmer, S. Kloth, E. Brandt, and H. D. Flad. 1991. Immunobiochemical
VOL. 80, 2006 PROTEOMIC ANALYSIS OF KSHV TR BINDING PROTEINS 9029

and molecular biologic characterization of the cell proliferation-associated
nuclear antigen that is defined by monoclonal antibody Ki-67. Am. J. Pathol.
138:867–873.
17. Gregory, P. D., K. Wagner, and W. Horz. 2001. Histone acetylation and
chromatin remodeling. Exp. Cell Res. 265:195–202.
18. Grundhoff, A., and D. Ganem. 2003. The latency-associated nuclear antigen
of Kaposi’s sarcoma-associated herpesvirus permits replication of terminal
repeat-containing plasmids. J. Virol. 77:2779–2783.
19. Hoeijmakers, J. H. 2001. Genome maintenance mechanisms for preventing
cancer. Nature 411:366–374.
20. Hu, J., A. C. Garber, and R. Renne. 2002. The latency-associated nuclear
antigen of Kaposi’s sarcoma-associated herpesvirus supports latent DNA
replication in dividing cells. J. Virol. 76:11677–11687.
21. Hu, J., and R. Renne. 2005. Characterization of the minimal replicator of
Kaposi’s sarcoma-associated herpesvirus latent origin. J. Virol. 79:2637–
2642.
22. Kadonaga, J. T., and R. Tjian. 1986. Affinity purification of sequence-specific
DNA binding proteins. Proc. Natl. Acad. Sci. USA 83:5889–5893.
23. Krithivas, A., M. Fujimuro, M. Weidner, D. B. Young, and S. D. Hayward.
2002. Protein interactions targeting the latency-associated nuclear antigen of
Kaposi’s sarcoma-associated herpesvirus to cell chromosomes. J. Virol. 76:
11596–11604.
24. Krithivas, A., D. B. Young, G. Liao, D. Greene, and S. D. Hayward. 2000.
Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepres-
sor complex and negatively regulates Epstein-Barr virus gene expression in
dually infected PEL cells. J. Virol. 74:9637–9645.
25. Lagunoff, M., and D. Ganem. 1997. The structure and coding organization of
the genomic termini of Kaposi’s sarcoma-associated herpesvirus. Virology
236:147–154.
26. Lagunoff, M., D. M. Lukac, and D. Ganem. 2001. Immunoreceptor tyrosine-
based activation motif-dependent signaling by Kaposi’s sarcoma-associated
herpesvirus K1 protein: effects on lytic viral replication. J. Virol. 75:5891–
5898.
27. Lambert, S., and A. M. Carr. 2005. Checkpoint responses to replication fork
barriers. Biochimie 87:591–602.
28. Lim, C., D. Lee, T. Seo, C. Choi, and J. Choe. 2003. Latency-associated
nuclear antigen of Kaposi’s sarcoma-associated herpesvirus functionally in-
teracts with heterochromatin protein 1. J. Biol. Chem. 278:7397–7405.
29. Lim, C., H. Sohn, Y. Gwack, and J. Choe. 2000. Latency-associated nuclear
antigen of Kaposi’s sarcoma-associated herpesvirus (human herpesvirus-8)
binds ATF4/CREB2 and inhibits its transcriptional activation activity. J Gen.
Virol. 81:2645–2652.
30. Lim, C., H. Sohn, D. Lee, Y. Gwack, and J. Choe. 2002. Functional dissection
of latency-associated nuclear antigen 1 of Kaposi’s sarcoma-associated her-
pesvirus involved in latent DNA replication and transcription of terminal
repeats of the viral genome. J. Virol. 76:10320–10331.
31. Lindahl, T. 1993. Instability and decay of the primary structure of DNA.
Nature 362:709–715.
32. Lisby, M., and R. Rothstein. 2005. Localization of checkpoint and repair
proteins in eukaryotes. Biochimie 87:579–589.
33. Lusser, A., and J. T. Kadonaga. 2003. Chromatin remodeling by ATP-
dependent molecular machines. Bioessays 25:1192–1200.
34. Marzluff, W. F., and R. J. Duronio. 2002. Histone mRNA expression: multiple
levels of cell cycle regulation and important developmental consequences. Curr.
Opin. Cell Biol. 14:692–699.
35. Masutani, M., H. Nakagama, and T. Sugimura. 2005. Poly(ADP-ribosyl)-
ation in relation to cancer and autoimmune disease. Cell. Mol. Life Sci.
62:769–783.
36. Moore, P. S., and Y. Chang. 2003. Kaposi’s sarcoma-associated herpesvirus
immunoevasion and tumorigenesis: two sides of the same coin? Annu. Rev.
Microbiol. 57:609–639.
37. Moore, P. S., S. J. Gao, G. Dominguez, E. Cesarman, O. Lungu, D. M.
Knowles, R. Garber, P. E. Pellett, D. J. McGeoch, and Y. Chang. 1996.
Primary characterization of a herpesvirus agent associated with Kaposi’s
sarcomae. J. Virol. 70:549–558.
38. Ohsaki, E., K. Ueda, S. Sakakibara, E. Do, K. Yada, and K. Yamanishi.
2004. Poly(ADP-ribose) polymerase 1 binds to Kaposi’s sarcoma-associated
herpesvirus (KSHV) terminal repeat sequence and modulates KSHV repli-
cation in latency. J. Virol. 78:9936–9946.
39. Perkins, D. N., D. J. Pappin, D. M. Creasy, and J. S. Cottrell. 1999. Prob-
ability-based protein identification by searching sequence databases using
mass spectrometry data. Electrophoresis 20:3551–3567.
40. Platt, G. M., G. R. Simpson, S. Mittnacht, and T. F. Schulz. 1999. Latent
nuclear antigen of Kaposi’s sarcoma-associated herpesvirus interacts with
RING3, a homolog of the Drosophila female sterile homeotic (fsh) gene.
J. Virol. 73:9789–9795.
41. Radkov, S. A., P. Kellam, and C. Boshoff. 2000. The latent nuclear antigen of
Kaposi sarcoma-associated herpesvirus targets the retinoblastoma-E2F path-
way and with the oncogene Hras transforms primary rat cells. Nat. Med.
6:1121–1127.
42. Renne, R., M. Lagunoff, W. Zhong, and D. Ganem. 1996. The size and
conformation of Kaposi’s sarcoma-associated herpesvirus (human herpesvi-
rus 8) DNA in infected cells and virions. J. Virol. 70:8151–8154.
43. Russo, J. J., R. A. Bohenzky, M. C. Chien, J. Chen, M. Yan, D. Maddalena,
J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA 93:14862–14867.
44. Sakakibara, S., K. Ueda, K. Nishimura, E. Do, E. Ohsaki, T. Okuno, and K.
Yamanishi. 2004. Accumulation of heterochromatin components on the
terminal repeat sequence of Kaposi’s sarcoma-associated herpesvirus medi-
ated by the latency-associated nuclear antigen. J. Virol. 78:7299–7310.
45. Sancar, A., L. A. Lindsey-Boltz, K. Unsal-Kacmaz, and S. Linn. 2004. Mo-
lecular mechanisms of mammalian DNA repair and the DNA damage check-
points. Annu. Rev. Biochem. 73:39–85.
46. Schwam, D. R., R. L. Luciano, S. S. Mahajan, L. Wong, and A. C. Wilson.
2000. Carboxy terminus of human herpesvirus 8 latency-associated nuclear
antigen mediates dimerization, transcriptional repression, and targeting to
nuclear bodies. J. Virol. 74:8532–8540.
47. Si, H., and E. S. Robertson. 2006. Kaposi’s sarcoma-associated herpesvirus-
encoded latency-associated nuclear antigen induces chromosomal instability
through inhibition of p53 function. J. Virol. 80:697–709.
48. Stedman, W., Z. Deng, F. Lu, and P. M. Lieberman. 2004. ORC, MCM, and
histone hyperacetylation at the Kaposi’s sarcoma-associated herpesvirus
latent replication origin. J. Virol. 78:12566–12575.
49. Sudarsanam, P., and F. Winston. 2000. The Swi/Snf family nucleosome-
remodeling complexes and transcriptional control. Trends Genet. 16:345–351.
50. Verma, S. C., T. Choudhuri, R. Kaul, and E. S. Robertson 2006. Latency-
associated nuclear antigen (LANA) of Kaposi’s sarcoma-associated herpesvirus
interacts with origin recognition complexes at the LANA binding sequence
within the terminal repeats. J. Virol. 80:2243–2256.
51. Verma, S. C., and E. S. Robertson. 2003. Molecular biology and pathogenesis
of Kaposi sarcoma-associated herpesvirus. FEMS Microbiol. Lett. 222:155–
163.
52. Viejo-Borbolla, A., M. Ottinger, E. Bruning, A. Burger, R. Konig, E. Kati,
J. A. Sheldon, and T. F. Schulz. 2005. Brd2/RING3 interacts with a chro-
matin binding domain in the Kaposi’s sarcoma-associated herpesvirus latency-
associated nuclear antigen 1 (LANA-1) that is required for multiple func-
tions of LANA-1. J. Virol. 79:13618–13629.
53. Zhou, J., C. Chau, Z. Deng, W. Stedman, and P. M. Lieberman. 2005.
Epigenetic control of replication origins. Cell Cycle 4:889–892.
9030 SI ET AL. J. VIROL.