Content uploaded by Amy K Schmid
Author content
All content in this area was uploaded by Amy K Schmid
Content may be subject to copyright.
Involvement of the S-layer proteins Hpi and SlpA in
the maintenance of cell envelope integrity in
Deinococcus radiodurans R1
Heather Rothfuss,
1
Jimmie C. Lara,
2
Amy K. Schmid
3
3
and Mary E. Lidstrom
1
,
2
Correspondence
Mary E. Lidstrom
lidstrom@u.washington.edu
Department of Chemical Engineering
1
,
Department of Microbiology
2
and Program in Molecular
and Cellular Biology
3
,
University of Washington, Seattle, WA 98195, USA
Received 3 March 2006
Revised 31 May 2006
Accepted 14 June 2006
The potential functions have been investigated of two proteins in Deinococcus radiodurans R1
predicted to be involved in the maintenance and integrity of the S layer: the hexagonally packed
intermediate (Hpi) protein, and SlpA (DR2577), a homologue of an S-layer SlpA protein in Thermus
thermophilus. Deletion of the hpi gene had little effect on the structure of the cell envelope or on
shear- or solvent-induced stress responses. However, deletion of the slpA gene caused substantial
alterations in cell envelope structure, and a significant defect in resistance to solvent and shear
stresses compared to the wild-type. Ultrastructural analysis of slpA mutant cells indicated loss of
much of the outer Hpi protein carbohydrate coat, the ‘pink envelope’, and the membrane-like
backing layer. Together these results suggest that the SlpA protein may be involved in attachment of
the Hpi surface layer to the inner cell envelope, and that SlpA may play an important role in the
maintenance of cell envelope integrity in D. radiodurans.
INTRODUCTION
Crystalline surface layers (S layers) made of proteins or
glycoproteins are a commonly observed surface structure in
prokaryotes (Sleytr et al., 1993). Most S-layer proteins
possess a signal sequence, predominantly contain hydro-
phobic and acidic amino acids, and, with the exception of
archaeal S layers, are low in sulfur-containing amino acids
(Kuen & Lubitz, 1996; Kue n et al., 1996; Sleytr et al., 1993).
Several strains possess more than one S-layer protein, and
these may be co-expressed or selectively expressed in
response to specific environmental conditions (Couture-
Tosi et al., 2002; Sleytr et al., 1993). The S-layer protein(s)
may represent up to 15 % of cell mass when present, causing
a burden on the cell (Sleytr et al., 1993) that may lead to S-
layer loss after long-term cultivation under idealized
laboratory conditions (Sleytr et al., 1993; Thompson et al.,
1982).
A number of functions have been proposed for S layers,
which in some cases have been experimentally confirmed
(Beveridge et al., 1997; Rachel et al., 1997; Sleytr et al., 1993).
These include adhesion, enzyme attachment, prevention of
adsorption of macromolecules, and cellular stability and
rigidity (Beveridge et al., 1997; Rachel et al., 1997; Sleytr
et al., 1993). The surface layers of Deinococcus radiodurans
strains SARK and R1 have been closely studied since the
early 1960s, the initial interest being rooted in the extreme
radiation resistance of these organisms (Thornley et al.,
1965). The role of S layers in this extreme resistance has not
yet been demonstrated, but a role in response to radiation
damage has been proposed (Gentner & Mitchel, 1975). A
diagram of the cell envelope structure in D. radiodurans as
proposed by Emde et al. (1980) is shown in Fig. 1. Stacked
upon the inner membrane face are a peptidoglycan layer, an
interstitial layer, and the ‘pink envelope’. The pink envelope
contains the S layer [hexagonally packed intermediate (HPI)
layer and lipid-rich backing], lipids, carbohydrates, proteins,
four to five carotenoids, and most likely the outer
membrane (Ku
¨
bler & Baumeister, 1978; Thompson et al.,
1982; Work & Griffi ths, 1968). The outermost layer of the
pink envelope is a long-chain carbohydrate coat, and in
5–10 % of the cell population it is only minimally present
(Baumeister et al., 1981; Emde et al., 1980). Of the pink
envelope components, the hexagonal network of the outer
surface array has received the most attention. The S layer is
predominantly made up of one protein, Hpi (Baumeister
et al., 1982; Peters & Baumeister, 1986). It has been proposed
that hydrophobic interactions are responsible for attach-
ment of the S layer to the outer membrane in the backing
layer, as well as for the association of the S-layer units
(Thompson et al., 1982). Although the HPI layer itself has
been characterized relatively well, the mechanism of the
unusually strong attachment of the HPI layer to the rest of
3Present address: Institute for Systems Biology, 1441 N 34th St,
Seattle, WA 98103, USA.
Abbreviations: HPI, hexagonally packed intermediate; S layer, surface
layer; SEM, scanning electron microscopy; SLH, S-layer homology.
0002-8971
G
2006 SGM Printed in Great Britain 2779
Microbiology (2006), 152, 2779–2787 DOI 10.1099/mic.0.28971-0
the pink envelope has not yet been determined. Therefore,
we performed phenotypic tests and conducted electron
microscopy to deter mine the role of HPI and another
potential S-layer protein, SlpA, in the maintenance of cell
envelope integrity in D. radi odurans.
METHODS
Bacterial strains and growth conditions. Escherichia coli JM 109
(Stratagene) was grown in Luria–Bertani broth or on agar plates at
37 uC in the presence of 50
mgml
21
ampicillin or kanamycin. D.
radiodurans R1 (ATCC 13939) strains were grown in tryptone/glu-
cose/yeast extract (TGY; Murray, 1992) at 30 uC on agar plates or in
broth with shaking at 250 r.p.m. The following antibiotics were
used: chloramphenicol, 3
mgml
21
; kanamycin, 8 mgml
21
in agar
plates and 4
mgml
21
in liquid cultures.
Chromosomal DNA preparation. A protocol for chromosomal
DNA mini-preparation from D. radiodurans was developed, based
on the larger-scale method published earlier (Udupa et al., 1994), as
follows. Cells were harvested from 1 ml culture in late-exponential
to stationary-phase growth by centrifugation for 2 min at 16 000 g
in a tabletop centrifuge. Cells were resuspended in 500
ml lysis
buffer, consisting of 50 mM Tris/HCl, pH 8?0, 50 mM EDTA,
0?2 M NaCl, 2 mg lysozyme ml
21
, 200 mgml
21
each of proteinase
K and Pronase E (Epicentre), and 0?6 % SDS. Cells were incubated
in this solution for 4–24 h, until lysis was apparent. Protein was
removed by one or two extractions by phenol/chloroform/isoamyl
alcohol (Roche), followed by one extraction by 0?5 ml chloroform.
The upper layer was added to 1?2 vols 2-propanol and inverted 15
times to precipitate DNA. The DNA was collected by centrifugation
or spooled onto a glass rod, washed with ice-cold 70 % (v/v) etha-
nol, allowed to dry, and dissolved in 50–200
ml0?1 M Tris buffer,
pH 8?0.
Electroporation. A new method for generating competent cells was
developed and optimized as follows. Cells were grown in 50 ml TGY
to early exponential phase (OD
600
=0?4–0?6), chilled on ice for
30 min, and pelleted by centrifugation at 4 uC for 8 min at 2700 g.
Cells were then resuspended in 10 ml 0?1 mM HEPES buffer,
pH 8?0, pelleted as above, resuspended in the same volume of
buffer, pelleted again and resuspended in 5 ml of the buffer. Cells
were pelleted once again and resuspended in 10 ml sterile ice-cold
10 % (v/v) glycerol, pelleted again and finally resuspended in 1 ml
10 % glycerol. Aliquots (100
ml) were frozen at 280 uC for up to
6 months. The highest transformation efficiencies were obtained
when the cells were electroporated at 10 kV cm
21
in a 0?2 cm elec-
trode gap cuvette (data not shown). This voltage was routinely used
with a capacitance of 25
mF and resistance of 200 V . TGY broth
(1 ml) was added, following by incubation at 30 uC with shaking for
1 h (plasmids) or 12–18 h (to complete chromosomal insertion),
and then plating to selective media.
Colony PCR. A sterile platinum wire was used to transfer cells
from a single colony to 20
ml PCR master-mix (Invitrogen), to
which 5 % (v/v) DMSO was added. PCR was carried out according
to the manufacturer’s instructions (Invitrogen), with an additional
5 min at 95 uC before the first cycle, and an annealing temperature
of 52 uC. Primers used are listed in Table 1.
RT-PCR. The expression of DR2508 and DR2577 was confirmed by
analysing RNA prepared from wild-type D. radiodurans R1 grown at
30 uC as previously reported (Schmid et al., 2005), and carrying out
PCR with the internal primers listed in Table 1. The PCR was car-
ried out with ‘Ready To Go’ RT-PCR beads (Amersham) according
to the manufacturer’s guidelines. Product-size controls were also
carried out with the chromosomal DNA template.
Generation of deletion mutants Dhpi (DR2508) and DslpA
(DR2577). The allelic exchange vector pCM184 (Marx & Lidstrom,
2002) was modified for use in D. radiodurans by cutting out the
tetracycline-resistance cassette and the IncP origin of transfer, and
replacing them with a fragment of pI8 (Meima & Lidstrom, 2000)
containing a promoter originally obtained from D. radiodurans
SARK followed by the chloramphenicol-resistance gene, to generate
pHMR173. This promoter is not found in the D. radiodurans R1
chromosome and was chosen to avoid undesirable recombinations
within the chromosome. This vector was further modified by the
addition of a minimal groESL promoter upstream of the kanamycin
cassette but still within the loxP sites. The primers mini-PgroF and
mini-PgroR (Table 1) were designed to amplify the 48 bp region of
the D. radiodurans R1 groESL promoter containing the transcription
start site and the 210 and 235 regions. Each primer was designed
to contain a DraIII site (in bold type in Table 1) to facilitate cloning.
The 72 bp PCR product was generated with the D. radiodurans R1
chromosomal DNA as template, cut with DraIII, and inserted direc-
tionally into the non-palindromic DraIII site upstream of the kana-
mycin cassette to drive kanamycin resistance in D. radiodurans R1.
The insertion was verified by PCR. The resulting vector, pHMR186,
contained multiple cloning sites on either side of the loxP-flanked
kanamycin cassette. To generate the deletion mutants, PCR products
were generated complementary to the regions upstream and down-
stream of hpi and slpA. Primers were specifically designed to delete
the entire target genes, essentially as described by Marx & Lidstrom
(2002). The PCR products were sequenced to ensure that no errors
were introduced during PCR. The resulting allelic exchange vectors
pHMR202 (containing hpi) and pHMR195 (containing slpA) were
transformed into D. radiodurans R1, and colonies selected in the
presence of kanamycin. To identify double-crossover recombinants,
colonies were screened for chloramphenicol sensitivity on plates.
Complete deletion was further confirmed by negative PCR tests with
primers targeted to the 59 and 39 regions of each gene. Primer sets
used in this study are listed in Table 1. We also constructed
pHMR179 expressing Cre recombinase on the D. radiodurans–E. coli
shuttle vector pRAD1 (Meima & Lidstrom, 2000), appropriate for
generating unmarked mutants by excising the kanamycin-resistance
cassette (data not shown).
Transmission electron microscopy. Cells were washed with
double-distilled water and fixed in modified Karnovsky’s fixative
(2 % paraformaldehyde, 2?5 % glutaraldehyde, 8 mM CaCl
2
in
0?1 M cacodylate buffer, pH 7?4) for 2 h at 4 uC. Samples were
washed in cacodylate buffer and post-fixed in 1 % osmium tetroxide
Fig. 1. Proposed structure of the D. radio-
durans envelope, adapted from Emde et al.
(1980).
2780 Microbiology 152
H. Rothfuss and others
in buffer for 2 h at room temperature. Following three 5 min wash
steps, cells were embedded in 1?5 % Noble agar and dehydrated in a
graded series of ethanol (35, 50, 70, 80, 90, 95, 100 %). Blocks were
then infiltrated at three concentrations of Spurr’s reagent using pro-
pylene oxide as the transition solvent, and ending in 100 % Spurr’s
resin. Thin sections of samples were stained with 7 % uranyl acetate
and Reynolds lead citrate for 20 and 10 min, respectively. Samples
were viewed using a JEOL 1200 Ex II transmission electron micro-
scope operated at 80 kV.
Scanning electron microscopy (SEM). Cells were fixed as
described above, washed three times for 5 min with double-distilled
water, spotted onto plastic cover slips coated with 1 % poly-
L-lysine,
dehydrated in a graded series of ethanol to 100 %, and critical point
dried. Samples were sputter coated with gold/palladium, and viewed
with a JEOL, JSM 6300F scanning electron microscope at 15 kV.
Protein analysis. Overnight cultures of D. radiodurans R1 and
HMR195 were left without shaking for 12–16 h to allow natural set-
tling of cells. After settling, the supernatant of the D. radiodurans
HMR195 mutant was cloudy and contained visible flocs, whereas
that of the wild-type strain was clear. Proteins were extracted from
3 ml of the supernatants using chloroform : methanol (1 : 2). The D.
radiodurans R1 wild-type pellet was resuspended in 25
ml SDS-PAGE
loading buffer (Sambrook et al., 1989), and the HMR195 pellet was
resuspended in 50
ml loading buffer, and both were boiled for 5 min
at 95 uC, after which equal volumes were loaded onto an 8 % polya-
crylamide gel along with molecular mass markers (Fermentas).
Three of the most prominent bands from the D. radiodurans
HMR195 supernatant were cut out of the gel.
Gel slice digestion and protein identification were performed by the
Proteomics and Spectroscopy Laboratory at the Fred Hutchinson
Cancer Research Center, Seattle, WA, by the following method.
Proteolytic digestion of Coomassie-stained gel slices was carried out as
described by Shevchenko et al. (1996). Following digestion, samples
were desalted using a microC18 ZipTip (Millipore) and dried. Samples
were then resuspended in 7
ml0?1 % trifluoroacetic acid (TFA) and
analysed by liquid chromatography electrospray ionization tandem
mass spectrometry (LC/ESI MS/MS) with an LCQ DECA XP mass
spectrometer (ThermoElectron), using an instrument configuration
described by Gatlin et al. (1998). Data were collected in a data-
dependent mode in which a MS scan was followed by MS/MS scans of
the three most abundant ions from the preceding MS scan. MS data
were searched against the D. radiodurans protein database (White et al.,
1999), using the software search algorithm
COMET (Institute for
Systems Biology). Protein identifications were considered valid if at
least two peptides were matched to a protein and if the peptide matches
had raw scores greater than 200 for +1 ions, 300 for +2 ions, and 300
for +3 ions, Z scores greater than 4, and percentage ions of greater
than 15 %.
Shear stress survival assay. Overnight cultures of D. radiodurans
R1 and the deletion mutants in hpi (HMR202) and slpA (HMR195)
were diluted to OD
600
0?5 in 1 ml 1 mM HEPES buffer with 500 ml
of 0?1 mm zirconium–silica beads added. Cell suspensions were
exposed to shear stress by vortexing for varying lengths of time (0,
30, 120 or 240 s). Survival was assessed by serial dilutions, spotting
5
ml aliquots of each dilution in triplicate onto TGY plates. c.f.u.
were calculated from the spot of each dilution series with countable
colonies. Because of the aggregation of slpA mutant cells, the survival
rate was underrepresented at 0 min, but after samples were vortexed
for 30 s, the colony count increased. To adjust for this factor, all cul-
tures were normalized to the c.f.u. counts after 30 s of vortexing.
Growth in the presence of toluene. Cells were streaked from
frozen stocks onto TGY plates containing antibiotics, as appropriate.
A single colony was grown overnight at 30 uC with shaking in 2 ml
Table 1. PCR primers and purposes of products
Cm, chloramphenicol; kan, kanamycin.
PCR product Primer name Primer sequence (5§–3§)
DraIII flanked 48 bp Pgro promoter mini-PgroF cgccacgttgtgcggtcagttgacatttttct
mini-PgroR gcgcacaacgtgatccgtcacggatggtagag
DR2577 flank 1, upstream of slpA DR2577-1044r_SacI gacggagctcatcctgccgagcggccttac
DR2577-20r_SacII gcagccgcgggtgcgcgtcgagcagcgttt
DR2577 flank 2, downstream of slpA DR2557+3543f_MunI aggagagatctgcttcgggcgcgaagtatt
DR2577+4553r_BglII gaggtcaattgttcggcgggggtttttgtt
DR2508 flank 1, upstream of hpi DR2508-943f_SacIcagagctcgttggccgcattgagcttgtg
DR2508-13r_SnaBI cgctacgtaagcggatgcgaagcgatcta
DR2508 flank 2, downstream of hpi DR2508+2846f_Asp718 cgggtaccagaagtacaagcacccaactaaaaag
DR2508+3691r_BglII cgagatctgtgaaacatcggcacgatagg
Internal PCR to verify slpA deletion DR2577_278f catgaccgccgaggacatga
DR2577_610r cggtcttgcaggtccaggat
Internal PCR to verify hpi deletion DR2508_11f tatcgcactcatggctctca
DR2508_355r gtgctaggaaccgtcgtgta
Verification of insertion by kan marker presence kan_fwd aagccacgttgtgtctca
kan_rev ccgtcaagtcagcgtaat
Screen for insertion of vector DNA with Cm cat-30f ccgagcttcgacgagatt
cat+711r attcaggcgtagcaccag
slpA insertion site flank to flank end length DR2577-1044r_SacI gacggagctcatcctgccgagcggccttac
DR2577+4553r_BglII gaggtcaattgttcggcgggggtttttgtt
hpi insertion site flank to flank end length DR2508-943f_SacIcagagctcgttggccgcattgagcttgtg
DR2508+3691r_Bgl
II cgagatctgtgaaacatcggcacgatagg
http://mic.sgmjournals.org 2781
S-layer proteins in D. radiodurans R1
TGY broth with antibiotics if neede d, and 0?25–1 ml was transferred
to 25 ml TGY without antibiotics in a 250 ml flask. After growth
overnight, the OD was measured using a Klett colorimeter (Klett–
Summerson) that had been calibrated to a spectrophotometer at
600 nm. Cultures were diluted in Klett flasks to the OD correspond-
ing to early exponential phase (a Klett value of 20–25, OD
600
of
about 0?16–0?2) in 12?5 ml TGY broth, and were capped with
rubber stoppers. The initial OD was recorded and deviations in
readings due to the vials were subtracted from this and subsequent
readings. The cultures were grown with shaking at 30 uC and
checked hourly until reaching a density of 40–45 Klett units. At
this point, the vials were briefly removed from the shaker to add
the appropriate amount of toluene, restoppered tightly, and the
stoppers were sealed with Parafilm to prevent loosening. The stop-
pers were not removed after this time, and measurements were
taken using the Klett colorimeter until readings stabilized in station-
ary phase.
RESULTS
Identification of putative S-layer genes
The hpi gene (DR2508) has been annotated in the genome of
D. radiodurans R1 (White et al., 1999) by its homology with
the hpi gene from the D. radiodurans SARK strain (Peters &
Baumeister, 1986). To identify additional candidates for S-
layer proteins, we searched the D. radiodurans R1 genomic
sequence for genes containing the S-layer homology (SLH)
domain (White et al., 1999). Among several other putative
S-layer-related protein genes, DR2577, DR1124 and DR0115
were identified as containing domains resembling the
annotated SLH domain. The corresponding gene products
are predicted to have molecular masses of 124, 43 and
31 kDa, respectively. DR2577 revealed homology to an S-
layer protein (SlpA) from a related organism, Thermus
thermophilus HB8 (25 % identity and 37 % similarity at the
amino acid level), suggesting that DR2577 was a candidate
for a secondary S-layer protein in D. radiodurans R1.
DR2577 was therefore chosen for further experimentation.
For the purpose of this study, we henceforth refer to DR2577
as slpA.
Deletion of the hpi and slpA genes
We first tested the expression of hpi and slpA in D.
radiodurans R1 via RT-PCR, and obtained positive results
(data not shown), indicating that hpi and slpA are actively
expressed in D. radiodurans wild-type. In order to determine
the possible roles of Hp i and SlpA in cell growth,
morphology, and resistance to shear and solvent stresses,
deletion mutants in both genes were generated, resulting in
the mutants HMR202 (defective in hpi) and HMR195
(defective in slpA). We further attempted to generate a
double hpi/slpA mutant, but these efforts were not
successful, possibly due to alterations in the cell envelope
that might have either interfered with cell competency or
reduced viability during electroporation and CaCl
2
treat-
ment (data not shown).
Growth phenotypes of the HMR202 (hpi) and
HMR195 (slpA) mutants
When grown in TGY broth at 30
u
C, the HMR202 (hpi )
mutant and wild-type demonstrated equivalent doubling
times, whereas that of the HMR195 mutant was about twice
the doubling time of the wild-type (Fig. 2), although a
similar OD was eventually reached after several days of
growth. Mutant HMR195 ( slpA) revealed a tendency toward
clumping, with the clumps resembling highly disordered
masses of cells under phase-contrast light microscopy (data
not shown). Furthermore, we observed that one of the pair
of dividing cells in D. radiodurans tetrads would often be
much smaller than the other. This suggested that normal
cellular divisi on was impaired in the slpA mutant strain
(data not shown). The colony morphology of mu tant
HMR195 (slpA) also differed from that of the wild-type: the
normally smooth and shiny colonies instead appeared
rugose and powdery, and were easily broken up with an
inoculating loop.
Electron mic roscopy of D. radiodurans R1 and
the HMR202 (hpi) and HMR195 (slpA) mut ants
Thin section microscopy (Figs 3, 4, 5 and 6) and SEM
(Fig. 7) were used to visualize the effects of the mutations on
D. radiodurans whole-cell and envelope morphology. The
HMR202 (hpi) mutant did not appear significantly altered
in thin section micrographs. The most obvious change was
that the peptidoglycan layer seemed to stain more
completely and appeared more dense, while the areas
surrounding the peptidoglycan layer appeared less dense
than in the wild-type cells. It also appeared, in general, that
the outer layer containing the backing layer, the HPI layer
and the carbohydrate coat was not as thick in this mutant as
in the wild-type cells. SEM also revealed few differences
Fig. 2. Growth of D. radiodurans R1 (#), and the hpi (%) and
slpA (n) mutants in TGY broth.
2782 Microbiology 152
H. Rothfuss and others
between the HMR202 mutant and the wild-type strain. The
shape of the cells did not seem affected, and the overall
tetrad shape appeared similar. However, the surfaces of the
HMR202 mutant cells appeared smoother than in the wild-
type. In particular, they lacked the ‘mushroom shapes’ or
‘beads’ (Baumeister & Ku
¨
bler, 1978; Thornley et al., 1965),
which can clearly be seen in the SEM image of wild-type cells
(Fig. 7a).
In contrast, the envelope of the HMR195 (slpA) mutant was
clearly compromised. As seen from thin section micro-
graphs (Fig. 5), the outer layers appeared to be detached
from the cell and peeling in places. However, we observed
that the peptidoglycan layer and perhaps some of the
interstitial layer remained attached (Fig. 6b). SEM also
showed dramatic differences between the HMR195 mutant
and wild-type cells (Fig. 7c). In summary, the electron
microscopy images suggested that the mutant cells were
shedding exterior layers of the cellular envelope.
Analysis of supernatant proteins in the HMR195
mutant
If left without shaking overnight, D. radiodurans R1 wild-
type cells settle at the bottom of the flask, leaving a visually
clear supernatant. This is also true of D. radiodurans
HMR202 (hpi mutant). However, in D. radiodurans
HMR195 (slpA mutant) culture, flocs of material were
visible, even after several days without shaking. To examine
this material, proteins were extracted from the supernatant,
Fig. 3. Thin section electron micrograph of (a) D. radiodurans R1 tetrad and (b) magnification of the membrane. Layers corresponding
to those in Fig. 1 are indicated.
Fig. 4. Thin section electron micrograph of (a) D. radiodurans hpi mutant tetrad and (b) magnification of the membrane.
http://mic.sgmjournals.org 2783
S-layer proteins in D. radiodurans R1
concentrated, and ana lysed by SDS-PAGE along with the
26 concentrated supernatant from the D. radiodurans R1
culture. Much more protein was extracted from the
HMR195 mutant supernatant compared to the wild-type
supernatant, as seen on the gels (Fig. 8). In particular, two
bands of around 100 kDa, a nd one band of around 35 kDa,
seemed to be significantly and specifically enriched in the
mutant supernatant. The two 100 kDa bands (labelled 1 and
2 in Fig. 8) and the 35 kDa band (labelled 3) were removed
from the gel and analysed by MS (Table 2). Bands 1 and 2
were both identified as the Hpi (DR2508) protein. The
35 kDa band was very clearly dominated by the DR1185
protein, annotated as an S-layer-like, array-related protein
in the genomic database (White et al., 1999). Together with
the electron microscopy results, this suggests that the
flocculent material in the slpA mutant supernatants consists
of shed membrane components.
Stress resist ance of the HMR202 and HMR195
mutants
To understand the involvement of Hpi and SlpA proteins in
maintenance of cellular integrity, the resistance of mutant
cells to solvents and the ability to survive shear stress were
studied. Fig. 9 shows the survival curves at 30 s to 4 min of
continuous vortexing. Because disassociation of cellular
clumps in the HMR195 mutant culture occurred during the
first 30 s of vortexing, survival was normalized to total c.f.u.
after 30 s. D. radiodurans R1 showed no appreciable loss of
survival over this first 30 s time period (data not shown). The
survival of the HMR202 (hpi) mutant was not significantly
lower than that of the wild-type strain after 4 min of
vortexing, whereas in contrast, the survival of the HMR195
(slpA) mutant dropped one and a half orders of magnitude,
suggesting that SlpA contributes to shear stress resistance.
Fig. 5. Thin section electron micrograph of (a) D. radiodurans slpA mutant tetrad and (b) magnification of the membrane.
Fig. 6. Magnified thin section micrographs comparing D. radiodurans hpi and slpA mutant envelopes.
2784 Microbiology 152
H. Rothfuss and others
When grown with 0?5 % toluene, the HMR202 (hpi) mutant
showed a slower exp onential-phase growth rate and a lower
cell density in the stationary phase compared to wild-type
(Fig. 10). In contrast, the HMR195 (slpA) mutant was again
dramatically affected, showing no significant growth over
60 h after the addition of toluene. Taken together, these
results sug gest that SlpA may play a significant role in
maintenance of cell integrity, whereas Hpi appears to play a
minor role.
DISCUSSION
The structure of the D. radi odurans cell envelope has been
under study for almost 40 years. The order of the layers of
the envelope and the nature of some of these layers have
been determined (Baumeister et al., 1986; Emde et al., 1980;
Peters et al., 1987), but several questions remain regarding
the structure, and little is known about the potential
functions of the S layer. In this study, we mutated genes
encoding two of the S-layer proteins, hpi and slpA, and
studied phenotypes of the resultant mutants. Although
spontaneous mutants lacking an HPI l ayer have been
described in D. radiodurans SARK (Thompson et al., 1982),
this is the first study conducted with a genetically defined hpi
mutant. The phenotype of the HMR202 (hpi) mutant
indicates that the HPI layer is required for the formation of
external features of D. radiodurans R1. The rippled ‘grape-
skin’ appearance of D. radiodurans was first described in
1965 by Thornley and co-workers (Thornley et al ., 1965).
This topography has also been described as ‘irregular
granules’ or ‘small bead-like structures’ on the surface of the
cells (Baumeister & Ku
¨
bler, 1978). The hpi mutant
generated in this study appeared to lack both of these
structures, while they appeared to be present in the slpA
mutant. Whether the bead structures fulfil some function or
are simply remnants of S-layer irregularities at the points of
division remains unclear. However, the HPI layer does seem
to be involved in both the outer cell smoothness and the
formation of small bead-like structures on the outer surfaces
of D. radiodurans. Likewise, the functions tested in thi s
mutant, resistance to vortexing (as a measure of shear stress)
and resistance to toluene, were only minimally affected,
suggesting that Hpi does not play a major role in these
outer-layer-related functions.
(a)
(b)
(c)
Fig. 7. Scanning electron micrographs of the surfaces of (a) D.
radiodurans R1, (b) the hpi mutant and (c) the slpA mutant.
The images have been colourized to display surface features.
Bars: (a) 100 nm; (b) 1 mm; (c) 100 nm.
Fig. 8. SDS-PAGE of the supernatants of the D. radiodurans
slpA mutant culture and the R1 wild-type culture.
http://mic.sgmjournals.org 2785
S-layer proteins in D. radiodurans R1
The structural phenotype of the HMR195 (slpA) mutant was
much more dramatic. From the microscopy studies, it
appeared that layers were peeling from the surface of the
mutant cells. Tests for supernatant proteins in the HMR195
mutant revealed that these layers must have contained Hpi
and DR1185, a protein annotated as an S-layer-like, array-
related protein (White et al., 1999). This phenotype is
similar to that of the SlpA mutant of T. thermophilus HB8
(Olabarria et al., 1996). In T. thermophilus HB 8, SlpA is an S-
layer protein possessing the SLH domain near its N
terminus, which is implicated in having a role in attaching
to the peptidoglycan layer (Olabarria et al., 1996). The
removal of thi s SLH domain has been shown to result in
shedding S layers (Olabarria et al., 1996). In D. radiodurans,
the S-layer protein Hpi does not contain an SLH domain.
However, our results suggest that D. radiodurans SlpA may
provide this anchoring function. As it is not possible to
identify the HPI layer in thin sections (Thornley et al., 1965),
and due to difficulties in determining the structure of such
an extremely perturbed cell envelope, we were not able to
directly discern which layers were peeling off. However, it is
clear that the layers peeling away from the cell surface do not
have the original curvature of the cell wall. It has been
previously determined that the backing layer of the pink
envelope, rather than the HPI layer, provides the rigidity and
the curvature of the cell envelope (Baumeister et al., 1981),
suggesting that the SlpA protein interacts with the backing
layer. The slpA mutant of D. radiodurans was also strikingly
more sensitive than the wild-type and hpi mutant to both
shear and toluene stress, resistance to which is known to be
imparted by the cell envelope, thus underscoring the
importance of SlpA in outer layer integrity.
ACKNOWLEDGEMENTS
We are grateful to Kelly Fitzgerald and Christopher Marx for valuable
discussion, Mila Chistoserdova and Marina Kalyuzhnaya for helpful
comments on the manuscript, and Gloria Jacobson for technical
assistance. This work was supported by a grant from the US
Department of Energy (ER20294).
REFERENCES
Baumeister, W. & Ku¨ bler, O. (1978). Topographic study of the cell
surface of Micrococcus radiodurans. Proc Natl Acad Sci U S A 75,
5525–5528.
Table 2. Identification of proteins enriched in the supernatant of the slpA mutant
Band numbers correspond to those shown in Fig. 8.
Band Protein Molecular weight
(kDa)
Amino acid coverage
(%)
Description
1 DR2508 99?444?3 Hpi
2 DR2508 99?443?4 Hpi
3 DR1185 36?779?8 S-layer-like array-related protein
Fig. 9. Survival of D. radiodurans R1 and the S-layer mutants
after vortexing. #, R1; n, DslpA; %, Dhpi.
Fig. 10. Growth of D. radiodurans R1 and the S-layer mutants
after 0?5 % toluene shock. #, R1; n, DslpA; %, Dhpi. Arrow,
addition of toluene.
2786 Microbiology 152
H. Rothfuss and others
Baumeister, W., Ku¨ bler, O. & Zingsheim, H. P. (1981). The structure
of the cell envelope of Micrococcus radiodurans as revealed by metal
shadowing and decoration. J Ultrastruct Res 75, 60–71.
Baumeister, W., Karrenberg, F., Rachel, R., Engel, A., Ten Heggeler,
B. & Saxton, W. O. (1982).
The major cell envelo pe protein of
Micrococcus radiodurans (R1). Structural and chemical characteriza-
tion. Eur J Biochem 125, 535–544.
Baumeister, W., Barth, M., Hegerl, R., Guckenberger, R., Hahn, M. &
Saxton, W. O. (1986).
Three-dimensional structure of the regular
surface layer (HPI layer) of Deinococcus radiodurans. J Mol Biol 187,
241–250.
Beveridge, T. J., Pouwels, P. H., Sa
´
ra, M. & 22 other authors (1997).
Functions of S-layers. FEMS Microbiol Rev 20, 99–149.
Couture-Tosi, E., Delacroix, H., Mignot, T., Mesnage, S., Chami, M.,
Fouet, A. & Mosser, G. (2002).
Structural analysis and evidence for
dynamic emergence of Bacillus anthracis S-layer networks. J Bacteriol
184, 6448–6456.
Emde, B., Wehrli, E. & Baumeister, W. (1980). The topography of
the cell wall of Micrococcus radiodurans. Electron Microsc 2, 460–461.
Gatlin, C. L., Kleemann, G. R., Hays, L. G., Link, A. J. & Yates, J. R.,
3rd (1998).
Protein identification at the low femtomole level from
silver-stained gels using a new fritless electrospray interface for liquid
chromatography-microspray and nanospray mass spectrometry. Anal
Biochem 263, 93–101.
Gentner, N. E. & Mitchel, R. E. (1975). Ionizing radiation-induced
release of a cell surface nuclease from Micrococcus radiodurans.
Radiat Res 61, 204–215.
Ku¨ bler, O. & Baumeister, W. (1978). The structure of a periodic cell
wall component (HPI-layer of Micrococcus radiodurans). Cytobiologie
17, 1–9.
Kuen, B. & Lubitz, W. (1996). Analysis of S-layer proteins and genes.
Chapter 4 in Crystalline Bacterial Cell Surface Proteins, pp. 77–102.
Edited by P. M. U. B. Sleytr, D. Pum & M. Sa
´
ra. Austin, TX: R. G.
Landes.
Kuen, B., Sa
´
ra, M. & Lubitz, W. (1996). Heterologous expression and
self-assembly of the S-layer protein SbsA of Bacillus stearothermo-
philus in Escherichia coli. Mol Microbiol 19, 495–5 03.
Marx, C. J. & Lidstrom, M. E. (2002). Broad-host-range cre-lox
system for antibiotic marker recycling in Gram-negative bacteria.
Biotechniques 33, 1062–1067.
Meima, R. & Lidstrom, M. E. (2000). Characterization of the minimal
replicon of a cryptic Deinococcus radiodurans SARK plasmid and
development of versatile Escherichia coli-D. radiodurans shuttle
vectors. Appl Environ Microbiol 66, 3856–3867.
Murray, R. G. E. (1992). The deinococci. In The Prokaryotes: a
Handbook on the Biology of Bacteria: Ecophysiology, Isolation,
Identification, Applications. Edited by H. G. T. A. Ballows, M.
Dworkin W. Hader & K. Schleifer. New York: Springer.
Olabarria, G., Carrascosa, J. L., de Pedro, M. A. & Berenguer, J.
(1996).
A conserved motif in S-layer proteins is involved in
peptidoglycan binding in Thermus thermophilus. J Bacteriol 178,
4765–4772.
Peters, J. & Baumeister, W. (1986). Molecular cloning, expression, and
characterization of the gene for the surface (HPI)-layer protein of
Deinococcus radiodurans in Escherichia coli. J Bacteriol 167, 1048–1054.
Peters, J., Peters, M., Lottspeich, F., Scha
¨
fer, W. & Baumeister, W.
(1987). Nucleotide sequence analysis of the gene encoding the
Deinococcus radiodurans surface protein, derived amino acid
sequence, and complementary protein chemical studies. J Bacteriol
169, 5216–5223.
Rachel, R., Pum, D., S
ˇ
marda, J., S
ˇ
majs, D., Komrska, J., Krzyza
´
nek,
V., Rieger, G. & Stetter, K. O. (1997). Fine structure of S-layers.
FEMS Microbiol Rev 20, 13–23.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
Schmid, A. K., Howell, H. A., Battista, J. R., Peterson, S. N. &
Lidstrom, M. E. (2005). Global transcriptional and proteomic
analysis of the Sig1 heat shock regulon of Deinococcus radiodurans.
J Bacteriol 187, 3339–3351.
Shevchenko, A., Wilm, M., Vorm, O. & Mann, M. (1996). Mass
spectrometric sequencing of proteins silver-stained polyacrylamide
gels. Anal Chem 68, 850–858.
Sleytr, U. B., Messner, P., Pum, D. & Sa
´
ra, M. (1993). Crystalline
bacterial cell surface layers. Mol Microbiol 10, 911–916.
Thompson, B. G., Murray, R. G. E. & Boyce, J. F. (1982). The
association of the surface array and the outer membrane of
Deinococcus radiodurans. Can J Microbiol 20, 1081–1088.
Thornley, M. J., Horne, R. W. & Glauert, A. M. (1965). The fine
structure of Micrococcus radiodurans. Arch Mikrobiol 51, 267–289.
Udupa, K. S., O’Cain, P. A., Mattimore, V. & Battista, J. R. (1994).
Novel ionizing radiation-sensitive mutants of Deinococcus radio-
durans. J Bacteriol 176, 7439–7446.
White, O., Eisen, J. A., Heidelberg, J. F. & 29 other authors (1999).
Genome sequence of the radioresistant bacterium Deinococcus
radiodurans R1. Science 286, 1571–1577.
Work, E. & Griffiths, H. (1968). Morphology and chemistry of cell
walls of Micrococcus radiodurans. J Bacteriol 95, 641–657.
http://mic.sgmjournals.org 2787
S-layer proteins in D. radiodurans R1
