Content uploaded by Ari Rouhiainen
Author content
All content in this area was uploaded by Ari Rouhiainen on Mar 12, 2014
Content may be subject to copyright.
Pivotal Advance: Analysis of proinflammatory activity of highly
purified eukaryotic recombinant HMGB1 (amphoterin)
Ari Rouhiainen,
1
Sarka Tumova, Leena Valmu, Nisse Kalkkinen, and Heikki Rauvala
Neuroscience Center, and Institute of Biotechnology, University of Helsinki, Helsinki, Finland
Abstract: HMGB1 (amphoterin) is a 30-kDa hepa-
rin-binding protein that mediates transendothelial
migration of monocytes and has proinflammatory cy-
tokine-like activities. In this study, we have investi-
gated proinflammatory activities of both highly puri-
fied eukaryotic HMGB1 and bacterially produced
recombinant HMGB1 proteins. Mass analyses re-
vealed that recombinant eukaryotic HMGB1 has an
intrachain disulphide bond. In mass analysis of tissue-
derived HMGB1, two forms were detected: the car-
boxyl terminal glutamic acid residue lacking form
and a full-length form. Cell culture studies indicated
that both eukaryotic and bacterial HMGB1 proteins
induce TNF-␣secretion and nitric oxide release from
mononuclear cells. Affinity chromatography analysis
revealed that HMGB1 binds tightly to proinflamma-
tory bacterial substances. A soluble proinflammatory
substance was separated from the bacterial recombi-
nant HMGB1 by chloroform-methanol treatment.
HMGB1 interacted with phosphatidylserine in both
solid-phase binding and cell culture assays, suggesting
that HMGB1 may regulate phosphatidylserine-
dependent immune reactions. In conclusion,
HMGB1 polypeptide has a weak proinflammatory
activity by itself, and it binds to bacterial sub-
stances, including lipids, that may strengthen its
effects. J. Leukoc. Biol. 81: 49 –58; 2007.
Key Words: inflammation 䡠nitric oxide 䡠phosphatidylserine
䡠RAGE 䡠TNF-␣
INTRODUCTION
HMGB1 (amphoterin) is a 30-kDa heparin-binding protein
widely expressed in different tissues and organisms [1–3].
Macrophages, monocytes, endothelial cells, neurons, and var-
ious tumor cells secrete HMGB1 after induction, and high
amounts of HMGB1 have been detected in serum samples of
various inflammatory diseases [4 –10].
Recent studies have highlighted the role of HMGB1 as a
monocyte and endothelium-activating substance, and mediator
of inflammation [4, 11, 12, and as reviewed in 13 and 14].
HMGB1 induces inflammation during necrosis, whereas in
apoptotic cells, it is sequestered to the nucleus [11]. During
trauma and inflammation, HMGB1 is massively released to
extracellular space, where it mediates organ damage and le-
thality [4, 15]. Further, elevated levels of extracellular HMGB1
or HMGB1 mRNA are detected in cancer and in inflammatory
disorders, suggesting that HMGB1 is acting as a widespread
inflammatory mediator [16, 17].
HMGB1 binds to several transmembrane receptors, includ-
ing the receptor for advanced glycation end products (RAGE),
Toll-like receptors 2 and 4 (TLR2/4), and syndecan-1 (CD138),
and generates proinflammatory signaling to nucleus [18 –22].
Well-characterized signaling routes of HMGB1 are NF-B and
ERK1/2 activation by RAGE-ligation, and IKKa/b and NF-B
activation by TLRs [19, 23–25]. In addition, HMGB1 and
RAGE mediate transendothelial migration of monocytes and
tumor cells [5, 26].
HMGB1 has a characteristic bipolar structure (amphoterin),
and it avidly binds to various substances like DNA or heparin
[2]. Further, it is often post-translationally modified [27].
Whether HMGB1 in solid tissue or circulation binds other
inflammation mediators is currently unclear. HMGB1 derived
from eukaryotic cells is less proinflammatory than the recom-
binant protein derived from bacterial expression systems [28,
29]. This suggests that the different forms of HMGB1 or the
existence of HMGB1 binding cofactors influence proinflamma-
tory activity.
We have produced recombinant HMGB1 (recHMGB1) in a
baculovirus system yielding high expression levels (50 –100
mg/l) of recombinant protein [10]. In addition, we have pro-
duced an E. coli-derived recombinant, and purified HMGB1
from tissue. In this study, we have tested the effect of both
tissue derived and recombinant HMGB1 proteins in mononu-
clear cell proinflammatory responses.
MATERIALS AND METHODS
Materials
ATP (ATP), lipopolysaccharide (LPS), phosphatidic acid, phosphatidylethanol-
amine, polymyxin B and S100b were from Sigma-Aldrich (St. Louis, MO,
USA). Phosphatidylserine was from Avanti Polar Lipids (Alabaster, AL, USA).
Advanced glycation end bovine serum albumin (AGE-BSA) was produced as
described [24]. Recombinant HMGB1 (recHMGB1) was produced and purified
as described, and analyzed in GelCode Blue (Pierce, Rockford, IL)-stained
SDS-PAGE [5, 10]. cDNA coding for amino terminal amino acids 1-185 of
HMGB1 was cloned into pGEX-6P-1-plasmid. Recombinant GST-fusion pro-
1
Correspondence: Neuroscience Center, Viikinkaari 4, PL 56, University of
Helsinki, Helsinki 00014, Finland. E-mail: ari.rouhiainen@helsinki.fi
Received March 14, 2006; revised August 9, 2006; accepted August 9,
2006.
doi: 10.1189/jlb.0306200
0741-5400/07/0081-0049 © Society for Leukocyte Biology Journal of Leukocyte Biology Volume 81, January 2007 49
tein (deltaC-HMGB1) was expressed in BL21(pLysS) bacteria, and purified
using glutathione-sepharose column and PerScission Protease method (GE
Healthcare Bio-Sciences AB, Uppsala, Sweden). In some experiments deltaC-
HMGB1 was further purified with HiTrap Heparin and HiTrap SP chromatog-
raphies (GE Healthcare Bio-Sciences AB, New York, NY). The truncated
HMGB1 (deltaC-HMGB1) is still capable to trigger RAGE signaling [26], but
it is more soluble than the nascent HMGB1. Tissue HMGB1 was isolated from
E18-P2 rat brain using heparin-sepharose and Affi-Gel Blue chromatographies
(GE Healthcare Bio-Sciences AB) as described, except that the NaDH washing
step was omitted [30]. DNA content in recombinant protein stocks were
measured using CyQuant Kit (Promega, Madison, WI). Both recHMGB1 and
deltaC-HMGB1 contained 0.03 g DNA per 1 mg of protein. Endotoxin
content in recHMGB1 fraction was under detection limit [5].
Cells and cell culture
RAW 264.7 cells were cultured as described [5]. Mixed rat glial cultures were
prepared from neonatal rat brain and cultured as described [31]. PBMCs were
isolated from adult male NMRI mice. Blood was collected; mononuclear cells
were enriched using a method described by Graziani-Bowering et al., and cells
were washed with 1 mM EDTA-PBS [32]. In some assays, mononuclear cell
fractions from two mice were pooled. Cells in 10% FCS-RPMI were adhered to
HMGB1-coated or control cell culture wells.
Primary and secondary structure analyses
HMGB1 used in mass analyses was analyzed and purified using RP-HPLC [10,
33]. In some studies recHMGB1 was reduced and alkylated. Alkylation was
done using 4-vinylpyridine alkylating agent, which causes 105 Da or 106 Da
increase in mass when bound to nonreduced or reduced cysteine residue,
respectively [34]. Trypsin digestion and mass spectrometric analyses were
carried out as described [33, 34]. To determine disulfide-bonded cysteines,
tryptic peptides derived from nonreduced recHMGB1 were analyzed in mass
spectrometry.
Database searches
Expressed sequence tag (EST) searches of nucleotide databases were done
using tools from the Web sites of National Center for Biotechnology Informa-
tion (Rockville Pike, Bethesda, MD).
Heparin-binding experiments
Heparin-sepharose chromatographies were done as described previously [30]
using A
¨kta chromatography station and 1 ml HiTrap heparin column (GE
Healthcare Bio-Sciences AB). In some experiments, samples contained 1 mM
dithiothreitol or 10 mM -mercaptoethanol.
TNF-␣induction and secretion assays
In HMGB1-induced RAW 264.7 macrophage secretion assays, 0.1– 0.2 ⫻10
6
cells (in OPTIMEM I medium, Invitrogen, Carlsbad, CA) were cultured in the
wells of cell culture plates. Proteins or LPS were added in the medium as
defined in each experiment, and cells were cultured for indicated times. In
some studies, reduced (3% -mercaptoethanol treated) proteins were coated to
wells for 1 h and washed before cell culture. TNF-␣concentration in culture
medium was measured using ELISA (Bender Medsystems, Vienna, Austria).
TNF-␣standards used in ELISA were from Bender Medsystems, Roche
(Mannheim, Germany) and Endogen (Pierce). Resulting TNF-␣values were
normalized to values from uninduced cells, which was defined as 100%.
Mouse PBMC TNF-␣mRNA induction and
protein secretion
Cells were adhered to HMGB1-coated or control 48-well plate wells (3–7
wells/mouse total PBMCs) in 10% FCS-RPMI and cultured for 6 h. TNF-␣in
culture media was quantified using ELISA. In some assays, mRNA coding for
TNF-␣was detected from PBMC-cultures by RT-PCR. Cells were cultured for
6 h, and RT-PCR analysis was done as described [5]. Primers for TNF-␣were
acagaaagcatgatccgcgacg and ggctcagccactccagctgctc. Amplified DNA was an-
alyzed in agarose gel electrophoresis, and relative OD values of bands were
measured as described [5]. Porphobilinogen deaminase housekeeping gene
was used as a control, and TNF-␣values were normalized to porphobilinogen
deaminase values. The OD value of uninduced cells was defined as 1.
Interleukin-6 (IL-6) and monocyte chemotactic
protein-1 (MCP-1) expression analyses
RAW 264.7 cells were cultured for 2 days in OPTI-MEM I with or without
coated recHMGB1 (20 g/ml), S100b (20 g/ml), AGE-BSA (500 g/ml) or
with soluble LPS (0.1 g/ml). Equal amounts of RNA were reverse transcribed
and analyzed in RT-PCR. The oligopairs for IL-6 and MCP-1 were cagttgcct-
tcttgggactgatgctg and agcatccatcatttctttgtatctctgg, and atgcaggtccctgtcatgct-
tctgg and ggtgctgaagaccttagggcagatg, respectively. IL-6 and MCP-1 values
were normalized to porphobilinogen deaminase values [5]. The OD value of
uninduced cells was defined as 1. Trimmean values, excluding 17% of lowest
and highest values, were calculated for IL-6 samples, and mean values were
calculated for MCP-1 samples.
Nitric oxide secretion assay
RAW 264.7 or mixed rat glial cultures were treated with various amounts of
HMGB1 proteins or LPS and cultured for indicated times. RAW 264.7 cells
were cultured in RPMI or DMEM supplemented with 10% FCS, and PBMCs
were cultured in RPMI supplemented with 10% FCS. 10 g/ml of polymyxin
B was added to some assays. Nitric oxide was quantified from culture media
using Greiss Reagent System (Promega). Inducible nitric oxide synthase
(iNOS) expression levels were analyzed with RT-PCR using the primers
atggcttgcccctggaagttt and ggcttgtctctgggtcctctggt. Amplified DNA was normal-
ized and quantified as described above.
Coculture of endotoxin-activated RAW 264.7
cells with phospholipid vesicles and recHMGB1
Cells were cultured on microwell plates in 10% FCS-RPMI (1.5⫻10
5
cells/
well). LPS (10 ng/ml) was added to all of the wells. Phospholipid vesicles
containing phosphatidylcholine alone or phosphatidylcholine (70%) and phos-
phatidylserine (30%) were made as described with two exceptions: the chlo-
roform was evaporated with nitrogen gas, and filter pore size used was 0.2 m
[35]. Various amounts of phospholipid vesicles with or without 30 g/ml of
recHMGB1 were added, and cells were cultured for 20 h. Nitric oxide in
culture media was quantified using Greiss Reagent System. Values from cell
cultures without added lipids were determined as 1, and values of lipid
containing wells were normalized to this value in both control and recHMGB1
samples.
Extraction of HMGB1-binding bacterial
substances
XL-1 E. Coli cells were homogenized in cold TBS containing lysozyme (Sigma)
and protease inhibitors [36]. RecHMGB1 was coupled to EAH-sepharose (GE
Healthcare Bio-Sciences AB) at the concentration of 1 mg per 1 ml of
sepharose gel. The cleared soluble fraction was applied to recHMGB1 column.
The column was washed with TBS containing 0.5 M NaCl, and bound sub-
stances were eluted with increasing salt concentrations. Uncoupled sepharose
CL-4B (Sigma) was used as a control column. DNA content in the fractions was
measured using CyQuant assay kit. For macrophage TNF-␣secretion induc-
tion measurement, diluted fractions were coated to plastic wells. Macrophages
were adhered to wells and cultured, and TNF- ␣was measured by ELISA.
RecHMGB1 or glutathione-sepharose column and PerScission Protease
method purified deltaC-HMGB1 were used as samples in chloroform-methanol
extraction. Extraction was done using the method described by M. Pasciak et
al. with some modifications [37]. Briefly, 5 g of protein was diluted in 100 l
of PBS in polypropylene tube, and 600 l of chloroform-methanol (2:1) was
added with mixing. Then, 200 l of methanol and 300 l of water was added,
tubes were mixed by vortexing, and centrifuged at 16,000 gfor 5 min. The
upper phase was dried to plastic tubes, and 4 ⫻10
5
RAW 264.7 cells in 400
l of OPTIMEM I was added to tubes. Tubes were mixed after 30 min
incubation, and after 60 min incubation, cell suspensions were transferred to
a 48-well plate and subcultured for 2 h. TNF-␣was quantified from culture
supernatants using ELISA.
Phospholipid binding assay
The assay was carried out essentially as described by Nakano et al. [38].
Phospholipids were dissolved in methanol, and various amounts of lipids (0,
50 Journal of Leukocyte Biology Volume 81, January 2007 http://www.jleukbio.org
100, or 300 g) were added in 100 l to microwells and dried. Wells were
blocked with 1% BSA-PBS, and 2 g/ml of recHMGB1 in 1% BSA-PBS was
added to the wells for 1 h. The wells were washed, and bound recHMGB1 was
detected with antipeptide I and antipeptide III ELISAs [10]. Wells omitting the
primary antibody were used as negative controls.
Statistics
Pvalues were calculated using Student's unpaired ttest in Microsoft
威
Excel2000 program (Microsoft Corporation, Redmond, WA). Error bars in all
figures represent means ⫾SD.
RESULTS
Structural analysis of HMGB1
Recombinant HMGB1 proteins were produced in either S9
baculovirus or E. coli expression systems. The baculovirus
system produced extremely high levels of full-length recH-
MGB1, yielding 50 –100 mg/l of recombinant protein in culture
stocks from which it was purified with heparin-sepharose and
ion exchange chromatography [10]. Tissue-HMGB1 was iso-
lated from young rat brain with a two-step chromatography
method using heparin-sepharose and Affi Gel Blue chromatog-
raphy [30]. Both recHMGB1 and tissue-HMGB1 migrated as a
single band in SDS-PAGE both under nonreducing and reduc-
ing conditions (Fig. 1A and data not shown). The finding that
proteins migrated faster under reducing conditions suggests
that the oxidation state is the same in both eukaryotic proteins.
Mass spectrometric analyses of tissue-HMGB1 suggested that,
compared with the recHMGB1, the major form lacks the car-
boxyl terminal glutamic acid residue (the mass was 129 Da
lower than excepted), and the minor form is the full-length
protein. Results of tissue HMGB1 analyses are similar to
results by Chou et al. [39]. No ESTs coding for glutamic acid
residue-lacking form of rat HMGB1 were found in databases,
suggesting that lack of the glutamic acid residue is not due to
modifications of the HMGB1 transcript (data not shown).
Primary structure of recHMGB1 protein was analyzed using
RP-HPLC and mass spectrometry. RecHMGB1 was eluted at
two close peaks in RP-HPLC, which both had identical masses
of 24760 (Fig. 1, B and E, and data not shown). After reduction
and alkylation, recHMGB1 was eluted as a single peak (Fig.
1C), suggesting that different retention times of the native
protein fractions may be due to differences in protein confor-
mation. Tissue-HMGB1 was eluted at three peaks (Fig. 1D) as
described earlier [10]. The most prominent peak was identified
as HMGB1 (data not shown and Ref. 10).
The mass of the RP-HPLC purified recHMGB1 was 2–3 Da
lower than the calculated theoretical mass, suggesting one
intrachain disulphide bond (Fig. 1E). Mass-spectrometric anal-
yses of the trypsinized recHMGB1 peptides showed that the
disulfide bond exists between the first two cysteines within the
A-box in the HMGB1 derived from the first peak of RP-HPLC
(data not shown).
We tested whether reduction has any effect on heparin
binding. The reduced and nonreduced recHMGB1 bound to
heparin-sepharose with a similar affinity, indicating that hep-
arin binding of HMGB1 is redox state independent (Fig. 1F).
Effect of HMGB1 proteins on TNF-␣secretion
from mononuclear cells
The eukaryotic and bacterial recombinant HMGB1 proteins
and the tissue-derived protein were tested for their effect on
TNF-␣secretion using RAW 267.4 cells or mouse PBMCs.
The full-length bacterial recombinant was somewhat more ac-
tive than the deleted form (deltaC-HMGB1), but both recom-
binants rapidly induced TNF-␣secretion when added in solu-
tion or coated on the substrate (shown for deltaC-HMGB1 in a
3-h assay in Fig. 2A). In contrast, no significant TNF-␣
induction was observed under the same conditions for the
eukaryotic recombinant HMGB1 in 3-h assays (Fig. 2A). How-
ever, a TNF-␣inducing activity that was slightly above the
baseline was observed for the eukaryotic proteins in long-term
assays (shown for the recombinant and tissue-derived protein
in an 8-h assay in Fig. 2B). The reducing agent -mercapto-
ethanol had no effect on the ability of recombinant HMGB1
proteins to induce TNF-␣secretion (data not shown). An
inducing effect on TNF-␣secretion and mRNA level was also
observed for eukaryotic HMGB1 in PBMCs in 6-h assays (Fig.
2, C and D).
RecHMGB1 does not induce expression of IL-6
and MCP-1
RAGE ligation has been shown to induce expression of proin-
flammatory cytokines IL-6 and MCP-1 [40, 41]. We tested
using RT-PCR whether coated recHMGB1 is capable of in-
ducing IL-6 and MCP-1 in macrophages. AGE-BSA and S100b
were used as RAGE-ligand controls, and LPS was used as a
control for macrophage activation. Both AGE-BSA and LPS
induced significant upregulation of IL-6 and MCP-1 after 2
days of culture, whereas recHMGB1 and S100b had no effect
(Table 1). Interestingly, S100b and S100A1 were recently
shown to be incapable of inducing cytokine production [42, 43].
HMGB1 induces nitric oxide release from
macrophages
We tested whether recombinant HMGB1 proteins induce nitric
oxide release from both primary cells and transformed macro-
phages. A slow nitric oxide secretion was seen in RAW 264.7
cell cultures with high concentrations of soluble eukaryotic
HMGB1 (Fig. 3A), and it was not inhibited by polymyxin B
(data not shown). Bacterially produced soluble HMGB1 was a
more potent nitric oxide inducer (Fig. 3B). Effect of eukaryotic
soluble HMGB1 proteins on iNOS mRNA expression was
tested. RAW 264.7 cells were treated with 100 g/ml of
recHMGB1 or 10 or 100 ng/ml of LPS for 19 h, and iNOS
mRNA was quantified using RT-PCR analysis. Values ob-
tained were 104 ⫾1.3% (P⬍0.05), 111 ⫾4.6%, and 115 ⫾
5.5% [for 100 g/ml HMGB1, 10 ng/ml of LPS, and 100 ng/ml
of LPS, respectively (n⫽3)] when uniduced expression was
determined as 100%. In mixed rat glial primary cell cultures,
soluble recHMGB1 induced nitrite release at lower concentra-
tions than from RAW 264.7 cells (Fig. 3C).
HMGB1 binds to bacterial proinflammatory
substances
Because the bacterially produced recombinant HMGB1 in-
duced strong proinflammatory reactions in mononuclear cells,
Rouhiainen et al. HMGB1 and cytokine expression 51
Fig. 1. Structural characteristics of recombinant HMGB1. (A)
Analysis of recHMGB1 (3.25 micrograms) or tissue derived
HMGB1 (1 microgram) was performed in GelCode Blue stained
SDS-PAGE. Proteins migrate as 30 kDa bands. (B–D) RP-HPLC
analysis of native HMGB1 proteins, and reduced and alkylated
recHMGB1. recHMGB1 elutes at two close peaks in RP-HPLC (B).
After reduction and alkylation of cysteine residues recHMGB1
elutes as a single peak (C). Tissue derived HMGB1 eluted as one
major peak. In addition, two minor peaks are detected (D). Time (t)
and absorbance (AU) axes in figures are not in scale. (E) The first
peak of recHMGB1 separated in RP-HPLC (B) was analyzed in
mass spectrometry. The data indicated the molecular mass of 24760 Da for recHMGB1. A second recHMGB1 peak from RP-HPLC
(B) gave an identical mass (data not shown). (F) Reduction does not influence recHMGB1 binding to heparin. Non-reduced or reduced
recHMGB1 was analyzed in heparin-Sepharose chromatography. The bound protein was eluted with 0.15–1.5 M NaCl gradient. All
recHMGB1 samples were eluted at the same NaCl concentration (0.7 M NaCl).
52 Journal of Leukocyte Biology Volume 81, January 2007 http://www.jleukbio.org
we tested whether HMGB1 is capable of binding macrophage-
activating bacterial substances. HMGB1 affinity chromatogra-
phy revealed that some bacterial components bind tightly to
HMGB1, and when released from HMGB1, they can elicit a
proinflammatory response (Fig. 4A). One such substance,
DNA, was detected from fractions eluted from the HMGB1
affinity column (data not shown).
Eukaryotic recHMGB1 and the bacterial recombinant pro-
teins purified with glutathione-sepharose column and PerScis-
sion Protease method were treated with chloroform-methanol to
denature the proteins and to separate possible polypeptide-
bound lipophilic substances. Both organic and polar phases
were separated with the addition of water. The polar phase from
the bacterial recombinant was found to induce macrophage
TNF-␣secretion. No such activity was found in eukaryotic
recHMGB1 or bacterial protein that was further purified with
heparin- and ion-exchange chromatography (Fig. 4B and data
not shown).
HMGB1 has been previously shown to bind both phospha-
tidylserine and sulfatide lipids [44, 45]. In this study, we tested
HMGB1 binding to three phospholipids expressed in E. coli:
phosphatidic acid, phosphatidylethanolamine, and phosphati-
dylserine [46]. HMGB1 bound strongly to phosphatidylserine
as excepted. In addition, HMGB1 bound strongly to phospha-
tidic acid. Binding to phosphatidylethanolamine was much
weaker (Fig. 4C).
Phosphatidylserine is a well-known immune suppressor
[47]. Therefore, we tested the effect of recHMGB1 on phos-
phatidylserine-mediated inhibition of nitric oxide release from
macrophages [48]. Phosphatidylserine vesicles inhibited LPS
induced nitric oxide release from RAW 264.7 cells dose de-
pendently (Fig. 4D). Coincubation with recHMGB1 affected
Fig. 2. HMGB1 and TNF-␣expression. Bacterially
produced recombinant HMGB1is a more potent TNF-␣
secretion inducer than eukaryotic recombinant
HMGB1. RAW 264.7 cells (1–2 ⫻10
5
cells/well in
OPTIMEM I) were added to HMGB1-coated (20 or 100
g/ml) microwells, and cultured for 3 h (A). TNF-␣
concentration in the culture medium was measured
using ELISA. Values from control wells were deter-
mined as 100%, and sample values were normalized
to control values. Solid bars denote 20 g/ml; open
bars denote 100 g/ml. (n⫽3, *, P⬍0.04 when com-
pared with controls, #, P⬍0.05 when compared with
recHMGB1 samples). Eukaryotic recHMGB1 in-
duces TNF-␣release from macrophages. 20 g/ml of
recHMGB1 or tissue-HMGB1 was added to RAW
264.7 cultures (1–2⫻10
5
cells/well in OPTIMEM I).
LPS (0.1 g/ml) was added to positive control cultures.
Cells were cultured for 8 h (B). TNF-␣concentration in
the culture medium was measured using ELISA. Values
from wells without activators were determined as 100%,
and sample values were normalized to nonactivated
control values (n⫽5; *, P⬍0.01). Tissue-derived
HMGB1 induces TNF-␣secretion from mouse PBMCs.
Freshly isolated mouse PBMCs in 10% FCS-RPMI
were adhered to tissue-HMGB1-coated (20 g/ml)
plastic wells and cultured (C). After 6 h of culture,
TNF-␣concentration in the medium was measured.
Results were calculated as in Fig. 2B. (n⫽4, *,
P⬍0.03). HMGB1 induces TNF-␣mRNA in mouse
PBMCs. Cells were isolated and cultured as described
in Fig. 3C. RNA was isolated and analyzed in RT-PCR,
and relative OD values of the bands were measured (D).
OD value of uninduced cells was determined as 1. ODs
of bands were normalized to porphobilinogen mRNA
bands. *, P⬍0.05 when compared with uninduced
sample. (n⫽3).
TABLE 1. recHMGB1 or S100b Does Not Induce IL-6 or MCP-1 Gene Expression After Culture of 2 Days
a
HMGB1 S100b AGE-BSA LPS
IL-6 0.94 ⫾0.12 (P⫽ns) 0.90 ⫾0.46 (P⫽ns) 2.09 ⫾0.21 (P⬍0.03) 7.70 ⫾2.29 (P⬍0.03)
MCP-1 0.94 ⫾0.17 (P⫽ns) 0.97 ⫾0.22 (P⫽ns) 2.39 ⫾0.65 (P⬍0.03) 2.45 ⫾0.57 (P⬍0.03)
a
RAW 264.7 cells were cultured for 2 days in OPTI-MEM I with recHMGB1 (20 g/ml), S100b (20 g/ml), AGE-BSA (500 g/ml), or LPS (0.1 g/ml). Equal
amounts of RNA were analyzed in IL-6 and MCP-1 RT-PCR, and relative OD values of the bands were measured and normalized to values of the housekeeping
gene porphobilinogen deaminase. The OD value of uninduced samples was defined as 1.
Rouhiainen et al. HMGB1 and cytokine expression 53
only slightly the inhibitory effect of phosphatidylserine (Fig.
4D).
DISCUSSION
In the current study, we have taken advantage of the high
expression level of HMGB1 in our baculovirus expression
system in insect cells, which is expected to reduce the risk of
contaminating substances in the recombinant protein. The
expression system made it possible to isolate the recombinant
in a highly purified form using mild nondenaturing conditions,
without using trichloroacetic acid that is commonly used to
purify HMG-type proteins. For example, plasminogen activa-
tion-enhancing effect by HMGB1 and its DNA binding capa-
bility are strongly affected by acid treatment of the protein [10,
49]. Further, we have purified tissue-derived HMGB1 from rat
brain and show that it is very similar to recHMGB1.
Structural studies of the baculovirus-derived HMGB1 pro-
duced in animal cells show that it contains an intrachain
disulfide bond. Occurrence of the disulfide bond has been also
demonstrated in HMGB1 isolated from tissue [30, 50, 51]. The
molecular mass of the recombinant HMGB1 corresponds ex-
actly to the calculated molecular mass and does not give
evidence of other post-translational modifications, than the
presence of one disulfide bond. The tissue-derived HMGB1
used in this study differs from the recombinant eukaryotic
protein in that the major form lacks the carboxyl terminal
glutamic acid residue. The minor form is the full-length pro-
tein.
Post-translational modifications may regulate induction of
inflammatory reactions by HMGB1 [27]. The results of this
study indicate that genuine reduced and oxidized HMGB1
polypeptides are weak TNF-␣and nitric oxide-inducing agents
in mononuclear cells. Further studies are warranted to reveal
how post-translational modifications affect proinflammatory ac-
tivity of HMGB1.
Treatment with reducing agents has no effect on HMGB1’s
heparin binding activity or proinflammatory activity, suggest-
ing that HMGB1 can preserve its functions in the absence of
the disulfide bond. In addition, NMR studies have previously
shown that the recombinant A-box of HMGB1, having one
cysteine replaced with serine, folds in a manner that allows a
close contact of the cysteine with the replacing serine residue
[52]. This suggests that the disulfide formation is not necessary
for folding to such conformation where the two cysteines are in
close proximity. Further, CD spectroscopy studies revealed
that both the reduced and nonreduced recHMGB1 have essen-
tially the same ␣-helical structure, suggesting that reduction
has no effect on secondary structure (Tumova and Rauvala,
unpublished results). In contrast, CD spectroscopy studies of
Fig. 3. RecHMGB1 induces nitric oxide release and up-
regulates iNOS in macrophage cultures. Time course study
of HMGB1-induced nitric oxide release. RAW 264.7 cells
were cultured in the presence of various amounts of soluble
recHMGB1 or LPS, and nitric oxide was quantified from cul-
ture media after 1, 2, or 3 days of culture (A). Control cells are
denoted by solid bars; 0.1 g/ml of recHMGB1 is denoted by
open bars; 1 g/ml of recHMGB1 is denoted by dark gray bars;
10 g/ml of recHMGB1 is denoted by light gray bars; 100
g/ml of recHMGB1 is denoted by checkered bars; and 1
g/ml of LPS is denoted by ruled bars (n⫽3; *, P⬍0.05 when
compared with control samples). Bacterially produced HMGB1
is a potent nitric oxide inducer. RAW 264.7 cell were cultured
in the presence of soluble deltaC-HMGB1 (20 g/ml) or LPS
(0.1 g/ml) for 24 h (B). Nitric oxide in culture media was
quantified. (n⫽4; *, P⬍0.005 when compared with control
samples). RecHMGB1 induces nitric oxide release from pri-
mary cell cultures. Mixed glial cell cultures from neonatal rat
brains were incubated with LPS (1 g/ml) or recHMGB1 (1–30
g/ml) for 1 day, and nitric oxide was quantified from the
culture medium (C). The number of experiments is at least six
in all conditions tested. *, P⬍0.05 when compared with sam-
ples without recHMGB1 or LPS.
54 Journal of Leukocyte Biology Volume 81, January 2007 http://www.jleukbio.org
perchloric acid-treated HMGB1 revealed major changes in
spectra after reducing of the disulfide bond [53].
Our current results and previous results from other groups
suggest that eukaryotic and bacterial HMGB1 proteins differ in
their ability to induce TNF-␣[28, 29]. Further, our results
show that a TNF-␣-inducing activity can be extracted by a
lipid solvent (chloroform/methanol) from the bacterially ex-
pressed recombinant but not from the highly purified baculo-
virus-derived protein expressed in animal cells. It seems prob-
able that the extremely high expression level achieved in our
eukaryotic system largely overrides the occurrence of copuri-
fying factor(s) that enhance proinflammatory activity.
The occurrence of the proinflammatory activity in the polar
phase in Folch partition after chloroform-methanol extraction
of the bacterially produced recombinant suggests that the
activity is enhanced by a polar lipid. Tentative analysis of
lipids in this fraction using mass spectrometry reveals a com-
plex lipid pattern (A. Rouhiainen, H. Rauvala, and P. Somer-
harju, unpublished observations), and further work is war-
ranted to elucidate the molecular nature of the active compo-
Fig. 4. HMGB1-binding substances and cytokine expression. HMGB1 binds to bacterial proinflamma-
tory substances. E. coli homogenates were applied to HMGB1 or sepharose CL-4B columns, the columns
were washed with 0.5 M NaCl-TBS (0.5 M wash), and bound substances were eluted with increasing salt
concentrations. TNF-␣induction by coated wash and elution fractions was determined in macrophage cell
culture assay (A). HMGB1 column fractions ⫽black bars; Sepharose CL-4B column fractions are denoted
by open bars. An active substance can be extracted by chloroform-methanol-water partition to polar lipid
phase from bacterially produced HMGB1. Five migrograms of recHMGB1 or deltaC-HMGB1 purified
using glutathione-sepharose chromatography (in 100 l of PBS) was treated with chloroform-methanol
mixture, and water was added to separate nonpolar and polar phases. The polar phase was dried to plastic
tubes. Induction of macrophage TNF-␣secretion was assayed using RAW 264.7 cells, and secreted
TNF-␣was quantified using ELISA (B). Samples from control partitions were used as controls, and their TNF-␣release was determined as 100%. (n⫽3;
*, P⬍0.05 when compared with control). HMGB1 binds to acidic phospholipids. Binding of HMGB1 to phospholipid-coated wells was detected by ELISA
(C). Phospholipids were dissolved in methanol, and various amounts of lipids (0, 100, or 300 g) were dried on microwells. The wells were blocked with
BSA and incubated with 2 g/ml of recHMGB1 for 1h. Bound recHMGB1 was detected with antipeptide I (squares) and antipeptide III (triangles) ELISAs.
Results of control ELISA without primary antibody are indicated by solid circles. PA, phosphatitic acid; PE, phosphatidylethanolamine; PS, phospha-
tidylserine; n⫽3. *, P⬍0.05 when compared with control wells. Effect of HMGB1 on phosphatidylserine-mediated inhibition of LPS-induced macrophage
nitric oxide release (D). LPS (10 ng/ml)-activated RAW 264.7 cells were cultured in the presence of 30, 60, or 120 g/ml of PS-containing vesicles, or
in the presence of 60 or 120 g/ml of phosphatidylcholine (PC) vesicles. Nitric oxide in culture medium was measured after 20 h, and the results were
normalized to values of cell cultures without added lipids. PS inhibited nitric oxide release dose dependently when compared with PC control (solid bars).
Effect of HMGB1 (30 g/ml) on the PS-mediated inhibition was tested (open bars) (n⫽3).
Rouhiainen et al. HMGB1 and cytokine expression 55
nents(s). Furthermore, we show that HMGB1 binds to purified
lipids in a microwell binding assay and interacts with phos-
phatidylserine in cell culture assay, agreeing with our previous
finding of HMGB1 binding to platelet lipids [44]. It appears
clear that HMGB1 binds at least phosphatidic acid and phos-
phatidylserine. Interestingly, phosphatidylserine has been im-
plicated in the regulation of inflammation [54, 55], and
HMGB1 might thus affect interactions of phosphatidylserine
with cells and regulate its anti-inflammatory activities.
HMGB1 is present in circulation during different inflamma-
tory diseases, but its function there is not fully understood [4,
6, 7]. Binding of HMGB1 to substances derived from microbes
and/or injured tissues might create complexes up-regulating
innate immune responses that, in turn, jeopardize tissue integ-
rity through production of toxic inflammatory mediators. For-
eign material binding capacity phenomenon for some circulat-
ing proteins, such as the LPS binding protein, vitronectin, and
fibronectin, is known to occur. These proteins have been shown
to strengthen macrophage responses to bacterial substances
[56, 57]. Furthermore, other highly charged recombinant pro-
teins, for example, heat shock proteins produced in bacterial
expression systems [58 –61], have been shown to induce im-
mune cell activations through binding to microbe-derived sub-
stances.
Our nitric oxide induction results are similar to those of
Kuniyasu et al. who detected nitric oxide induction in macro-
phages by eukaryotic HMGB1 [23]. These results suggest that
nitric oxide synthase upregulation and nitric oxide release are
induced by high concentrations of HMGB1. Nitric oxide syn-
thase gene expression is regulated by NF-B [reviewed in 62].
Since the HMGB1 receptors TLR2/4 and RAGE activate NF-
B, it seems reasonable to assume that these receptors are
involved in HMGB1/macrophage signaling [19, 23, 63]. In fact,
Kuniyasu et al. have shown that HMGB1 activates NF-Bin
human monocytes [23]. Sumi and Ignarro have shown that
AGE-BSA-induced nitric oxide synthase upregulation is inhib-
ited by anti-RAGE antibodies in RAW 264.7 cells [64]. How-
ever, Adami et al. described that the RAGE ligand S100b-
induced nitric oxide release from microglial cells is RAGE
signaling independent but RAGE-ectodomain mediated, sug-
gesting that other cell surface receptors exist for S100b [65].
The recent study by Kim et al. showed that down-regulation of
HMGB1 by short hairpin RNA in postischemic brain decreases
iNOS mRNA expression, suggesting that HMGB1 is involved
in iNOS regulation in vivo [66].
ACKNOWLEDGMENTS
A. R. was supported by grants from the Aarne and Aili Tu-
runens´ Foundation and the Maud Kuistila Memorial Founda-
tion. H. R. was supported by grants from the Academy of
Finland, Finnish Cancer Organizations and the Sigrid Juse´lius
Foundation. We thank Seija Lehto and Eeva-Liisa Saarikalle
for excellent technical assistance.
REFERENCES
1. Bustin, M. (2002) At the crossroads of necrosis and apoptosis: signaling to
multiple cellular targets by HMGB1. Sci. STKE 151, PE39.
2. Merenmies, J., Pihlaskari, R., Laitinen, J., Wartiovaara, J., Rauvala, H.
(1991) 30-kDa heparin-binding protein of brain (amphoterin) involved in
neurite outgrowth. Amino acid sequence and localization in the filopodia
of the advancing plasma membrane. J. Biol. Chem. 266, 16722–16729.
3. Bianchi, M. E., Beltrame, M., Paonessa, G. (1989) Specific recognition of
cruciform DNA by nuclear protein HMG1. Science 243, 1056 –1059.
4. Wang, H., Bloom, O., Zhang, M., Vishnubhakat, J. M., Ombrellino, M.,
Che, J., Frazier, A., Yang, H., Ivanova, S., Borovikova, L., et al. (1999)
HMG-1 as a late mediator of endotoxin lethality in mice. Science 285,
248 –251.
5. Rouhiainen, A., Kuja-Panula, J., Wilkman, E., Pakkanen, J., Stenfors, J.,
Tuominen, R. K., Lepantalo, M., Carpen, O., Parkkinen, J., Rauvala, H.
(2004) Regulation of monocyte migration by amphoterin (HMGB1). Blood
104, 1174 –1182.
6. Sunden-Cullberg, J., Norrby-Teglund, A., Rouhiainen, A., Rauvala, H.,
Herman, G., Tracey, K. J., Lee, M. L., Andersson, J., Tokics, L., Treutiger,
C. J. (2005) Persistent elevation of high-mobility group box-1 protein
(HMGB1) in patients with severe sepsis and septic shock. Crit. Care Med.
33, 564 –573.
7. Yamada, S., Inoue, K., Yakabe, K., Imaizumi, H., Maruyama, I. (2003)
High-mobility group protein 1 (HMGB1) quantified by ELISA with a
monoclonal antibody that does not cross-react with HMGB2. Clin. Chem.
49, 1535–1537.
8. Mullins, G. E., Sunden-Cullberg, J., Johansson, A. S., Rouhiainen, A.,
Erlandsson-Harris, H., Yang, H., Tracey, K. J., Rauvala, H., Palmblad, J.,
Andersson, J., et al. (2004) Activation of human umbilical vein endothelial
cells leads to relocation and release of high-mobility group box chromo-
somal protein 1. Scand. J. Immunol. 60, 566 –573.
9. Rauvala, H., Merenmies, J., Pihlaskari, R., Korkolainen, M., Huhtala,
M. L., Panula, P. (1988) The adhesive and neurite-promoting molecule
p30: analysis of the amino-terminal sequence and production of antipep-
tide antibodies that detect p30 at the surface of neuroblastoma cells and
of brain neurons. J. Cell Biol. 107, 2293–2305.
10. Parkkinen, J., Raulo, E., Merenmies, J., Nolo, R., Kajander, E. O.,
Baumann, M., Rauvala, H. (1993) Amphoterin, the 30-kDa protein in a
family of HMG1-type polypeptides. Enhanced expression in transformed
cells, leading edge localization, and interactions with plasminogen acti-
vation. J. Biol. Chem. 268, 19726 –19738.
11. Scaffidi, P., Misteli, T., Bianchi, M. E. (2002) Release of chromatin protein
HMGB1 by necrotic cells triggers inflammation. Nature 418, 191–195.
12. Treutiger, C. J., Mullins, G. E., Johansson, A. S., Rouhiainen, A., Rauvala,
H. M., Erlandsson-Harris, H., Andersson, U., Yang, H., Tracey, K. J.,
Andersson, J., et al. (2003) High mobility group 1 B-box mediates acti-
vation of human endothelium. J. Intern. Med. 254, 375–385.
13. Lotze, M. T., Tracey, K. J. (2005) High-mobility group box 1 protein
(HMGB1): nuclear weapon in the immune arsenal. Nat. Rev. Immunol. 5,
331–342.
14. Sunden-Cullberg, J., Norrby-Teglund, A., Treutiger, C. J. (2006) The role
of high mobility group box-1 protein in severe sepsis. Curr. Opin. Infect.
Dis. 19, 231–236.
15. Tsung, A., Sahai, R., Tanaka, H., Nakao, A., Fink, M. P., Lotze, M. T.,
Yang, H., Li, J., Tracey, K. J., Geller, D. A., et al. (2005) The nuclear
factor HMGB1 mediates hepatic injury after murine liver ischemia-reper-
fusion. J. Exp. Med. 201, 1135–1143.
16. Hatada, T., Wada, H., Nobori, T., Okabayashi, K., Maruyama, K., Abe, Y.,
Uemoto, S., Yamada, S., Maruyama, I. (2005) Plasma concentrations and
importance of high mobility group box protein in the prognosis of organ
failure in patients with disseminated intravascular coagulation. Thromb.
Haemost. 94, 975–979.
17. Pachot, A., Monneret, G., Voirin, N., Leissner, P., Venet, F., Bohe, J.,
Payen, D., Bienvenu, J., Mougin, B., Lepape, A. (2005) Longitudinal study
of cytokine and immune transcription factor mRNA expression in septic
shock. Clin. Immunol. 114, 61– 69.
18. Hori, O., Brett, J., Slattery, T., Cao, R., Zhang, J., Chen, J. X., Nagashima,
M., Lundh, E. R., Vijay, S., Nitecki, D., et al. (1995) The receptor for
advanced glycation end products (RAGE) is a cellular binding site for
amphoterin. Mediation of neurite outgrowth and co-expression of rage and
amphoterin in the developing nervous system. J. Biol. Chem. 270,
25752–25761.
19. Park, J. S., Svetkauskaite, D., He, Q., Kim, J. Y., Strassheim, D., Ishizaka,
A., Abraham, E. (2004) Involvement of toll-like receptors 2 and 4 in
cellular activation by high mobility group box 1 protein. J. Biol. Chem.
279, 7370 –7377.
20. Park, J. S., Gamboni-Robertson, F., He, Q., Svetkauskaite, D., Kim, J. Y.,
Strassheim, D., Sohn, J. W., Yamada, S., Maruyama, I., Banerjee, A., et al.
(2006) High mobility group box 1 protein interacts with multiple Toll-like
receptors. Am. J. Physiol. Cell Physiol. 290, C917–C924.
56 Journal of Leukocyte Biology Volume 81, January 2007 http://www.jleukbio.org
21. Izuishi, K., Tsung, A., Jeyabalan, G., Critchlow, N. D., Li, J., Tracey, K. J.,
Demarco, R. A., Lotze, M. T., Fink, M. P., Geller, D. A., et al. (2006)
High-mobility group box 1 preconditioning protects against liver isch-
emia-reperfusion injury. J. Immunol. 176, 7154 –7158.
22. Salmivirta, M., Rauvala, H., Elenius, K., Jalkanen, M. (1992) Neurite
growth-promoting protein (amphoterin, p30) binds syndecan. Exp. Cell
Res. 200, 444 – 451.
23. Kuniyasu, H., Yano, S., Sasaki, T., Sasahira, T., Sone, S., Ohmori, H.
(2005) Colon cancer cell-derived high mobility group 1/amphoterin in-
duces growth inhibition and apoptosis in macrophages. Am. J. Pathol.
166, 751–760.
24. Huttunen, H. J., Fages, C., Rauvala, H. (1999) Receptor for advanced
glycation end products (RAGE)-mediated neurite outgrowth and acti-
vation of NF-kappaB require the cytoplasmic domain of the receptor
but different downstream signaling pathways. J. Biol. Chem. 274,
19919 –19924.
25. Ishihara, K., Tsutsumi, K., Kawane, S., Nakajima, M., Kasaoka, T. (2003)
The receptor for advanced glycation end-products (RAGE) directly binds
to ERK by a D-domain-like docking site. FEBS Lett. 550, 107–113.
26. Huttunen, H. J., Fages, C., Kuja-Panula, J., Ridley, A. J., Rauvala, H.
(2002) Receptor for advanced glycation end products-binding COOH-
terminal motif of amphoterin inhibits invasive migration and metastasis.
Cancer Res. 62, 4805– 4811.
27. Ulloa, L., Messmer, D. (2006) High-mobility group box 1 (HMGB1)
protein: Friend and foe. Cytokine Growth Factor Rev. 17, 189 –201.
28. Zimmermann, K., Volkel, D., Pable, S., Lindner, T., Kramberger, F.,
Bahrami, S., Scheiflinger, F. (2004) Native versus recombinant high-
mobility group B1 proteins: functional activity in vitro. Inflammation 28,
221–229.
29. Li, J., Wang, H., Mason, J. M., Levine, J., Yu, M., Ulloa, L., Czura, C. J.,
Tracey, K. J., Yang, H. (2004) Recombinant HMGB1 with cytokine-
stimulating activity. J. Immunol. Methods 289, 211–223.
30. Rauvala, H., Pihlaskari, R. (1987) Isolation and some characteristics of an
adhesive factor of brain that enhances neurite outgrowth in central neu-
rons. J. Biol. Chem. 262, 16625–16635.
31. Golde, S., Chandran, S., Brown, G. C., Compston, A. (2002) Different
pathways for iNOS-mediated toxicity in vitro dependent on neuronal
maturation and NMDA receptor expression. J. Neurochem. 82, 269 –282.
32. Graziani-Bowering, G. M., Graham, J. M., Filion, L. G. (1997) A quick,
easy and inexpensive method for the isolation of human peripheral blood
monocytes. J. Immunol. Methods 207, 157–168.
33. Ylonen, A., Rinne, A., Herttuainen, J., Bogwald, J., Jarvinen, M., Kalk-
kinen, N. (1999) Atlantic salmon (Salmo salar L.) skin contains a novel
kininogen and another cysteine proteinase inhibitor. Eur. J. Biochem.
266, 1066 –1072.
34. Ylonen, A., Kalkkinen, N., Saarinen, J., Bogwald, J., Helin, J. (2001)
Glycosylation analysis of two cysteine proteinase inhibitors from Atlantic
salmon skin: di-O-acetylated sialic acids are the major sialic acid species
on N-glycans. Glycobiology 11, 523–531.
35. Chen, X., Doffek, K., Sugg, S. L., Shilyansky, J. (2004) Phosphatidylserine
regulates the maturation of human dendritic cells. J. Immunol. 173,
2985–2994.
36. Froman, G., Switalski, L. M., Speziale, P., Hook, M. (1987) Isolation and
characterization of a fibronectin receptor from Staphylococcus aureus.
J. Biol. Chem. 262, 6564 – 6571.
37. Pasciak, M., Holst, O., Lindner, B., Mordarska, H., Gamian, A. (2003)
Novel bacterial polar lipids containing ether-linked alkyl chains, the
structures and biological properties of the four major glycolipids from
Propionibacterium propionicum PCM 2431 (ATCC 14157
T
).J. Biol. Chem.
278, 3948 –3956.
38. Nakano, T., Ishimoto, Y., Kishino, J., Umeda, M., Inoue, K., Nagata, K.,
Ohashi, K., Mizuno, K., Arita, H. (1997) Cell adhesion to phosphatidyl-
serine mediated by a product of growth arrest-specific gene 6. J. Biol.
Chem. 272, 29411–29414.
39. Chou, D. K., Evans, J. E., Jungalwala, F. B. (2001) Identity of nuclear
high-mobility-group protein, HMG-1, and sulfoglucuronyl carbohydrate-
binding protein, SBP-1, in brain. J. Neurochem. 77, 120 –131.
40. Schmidt, A. M., Hasu, M., Popov, D., Zhang, J. H., Chen, J., Yan, S. D.,
Brett, J., Cao, R., Kuwabara, K., Costache, G., et al. (1994) Receptor for
advanced glycation end products (AGEs) has a central role in vessel wall
interactions and gene activation in response to circulating AGE proteins.
Proc. Natl. Acad. Sci. USA 91, 8807– 8811.
41. Hou, F. F., Jiang, J. P., Guo, J. Q., Wang, G. B., Zhang, X., Stern,
D. M., Schmidt, A. M., Owen, W. F., Jr. (2002) Receptor for advanced
glycation end products on human synovial fibroblasts: role in the
pathogenesis of dialysis-related amyloidosis. J. Am. Soc. Nephrol. 13,
1296 –1306.
42. Valencia, J. V., Mone, M., Koehne, C., Rediske, J., Hughes, T. E. (2004)
Binding of receptor for advanced glycation end products (RAGE) ligands
is not sufficient to induce inflammatory signals: lack of activity of endo-
toxin-free albumin-derived advanced glycation end products. Diabetologia
47, 844 – 852.
43. Ehlermann P, Eggers K, Bierhaus A, Most P, Weichenhan D, Greten J,
Nawroth PP, Katus HA, Remppis A. (2006) Increased proinflammatory
endothelial response to S100A8/A9 after preactivation through advanced
glycation end products. Cardiovasc. Diabetol. 5, 6.
44. Rouhiainen, A., Imai, S., Rauvala, H., Parkkinen, J. (2000) Occurrence of
amphoterin (HMG1) as an endogenous protein of human platelets that is
exported to the cell surface upon platelet activation. Thromb. Haemost.
84, 1087–1094.
45. Mohan, P. S., Laitinen, J., Merenmies, J., Rauvala, H., Jungalwala, F. B.
(1992) Sulfoglycolipids bind to adhesive protein amphoterin (P30) in the
nervous system. Biochem. Biophys. Res. Commun. 182, 689 – 696.
46. Raetz, C. R., Dowhan, W. (1990) Biosynthesis and function of phospho-
lipids in Escherichia coli. J. Biol. Chem. 265, 1235–1238.
47. Savill, J., Dransfield, I., Gregory, C., Haslett, C. (2002) A blast from the
past: clearance of apoptotic cells regulates immune responses. Nat. Rev.
Immunol. 2, 965–975.
48. De, S. R., Ajmone-Cat, M. A., Nicolini, A., Minghetti, L. (2002) Expres-
sion of phosphatidylserine receptor and down-regulation of pro-inflamma-
tory molecule production by its natural ligand in rat microglial cultures.
J. Neuropathol. Exp. Neurol. 61, 237–244.
49. Wagner, J. P., Quill, D. M., Pettijohn, D. E. (1995) Increased DNA-
bending activity and higher-affinity DNA binding of high-mobility group
protein HMG-1 prepared without acids. J. Biol. Chem. 270, 7394 –7398.
50. Baker, C., Isenberg, I., Goodwin, G. H., Johns, E. W. (1976) Physical
studies of the nonhistone chromosomal proteins HMG-1 and HMG-2.
Biochemistry 15, 1645–1649.
51. Elton, T. S., Reeves, R. (1985) The effects of oxidation on the reverse-
phase high-performance liquid chromatography characteristics of the high
mobility groups 1 and 2 proteins. Anal. Biochem. 149, 316 –321.
52. Hardman, C. H., Broadhurst, R. W., Raine, A. R., Grasser, K. D., Thomas,
J. O., Laue, E. D. (1995) Structure of the A-domain of HMG1 and its
interaction with DNA as studied by heteronuclear three- and four-dimen-
sional NMR spectroscopy. Biochemistry 34, 16596 –16607.
53. Kohlstaedt, L. A., Sung, E. C., Fujishige, A., Cole, R. D. (1987) Non-
histone chromosomal protein HMG1 modulates the histone H1-induced
condensation of DNA. J. Biol. Chem. 262, 524 –526.
54. Gaipl, U. S., Beyer, T. D., Baumann, I., Voll, R. E., Stach, C. M., Heyder,
P., Kalden, J. R., Manfredi, A., Herrmann, M. (2003) Exposure of anionic
phospholipids serves as anti-inflammatory and immunosuppressive sig-
nal–implications for antiphospholipid syndrome and systemic lupus ery-
thematosus. Immunobiology 207, 73– 81.
55. Brouckaert, G., Kalai, M., Krysko, D. V., Saelens, X., Vercammen, D.,
Ndlovu, M., Haegeman, G., D'Herde, K., Vandenabeele, P. (2004) Phago-
cytosis of necrotic cells by macrophages is phosphatidylserine dependent
and does not induce inflammatory cytokine production. Mol. Biol. Cell 15,
1089 –1100.
56. Mathison, J. C., Tobias, P. S., Wolfson, E., Ulevitch, R. J. (1992) Plasma
lipopolysaccharide (LPS)-binding protein. A key component in macro-
phage recognition of gram-negative LPS. J. Immunol. 149, 200 –206.
57. Vassallo, R., Kottom, T. J., Standing, J. E., Limper, A. H. (2001) Vitro-
nectin and fibronectin function as glucan binding proteins augmenting
macrophage responses to Pneumocystis carinii. Am. J. Respir. Cell Mol.
Biol. 25, 203–211.
58. Gao, B., Tsan, M. F. (2003) Recombinant human heat shock protein 60
does not induce the release of tumor necrosis factor alpha from murine
macrophages. J. Biol. Chem. 278, 22523–22529.
59. Bausinger, H., Lipsker, D., Ziylan, U., Manie, S., Briand, J. P., Cazenave,
J. P., Muller, S., Haeuw, J. F., Ravanat, C., de la Salle, H., et al. (2002)
Endotoxin-free heat-shock protein 70 fails to induce APC activation. Eur.
J. Immunol. 32, 3708 –3713.
60. Gao, B., Tsan, M. F. (2003) Endotoxin contamination in recombinant
human heat shock protein 70 (Hsp70) preparation is responsible for the
induction of tumor necrosis factor alpha release by murine macrophages.
J. Biol. Chem. 278, 174 –179.
61. Reed, R. C., Berwin, B., Baker, J. P., Nicchitta, C. V. (2003) GRP94/gp96
elicits ERK activation in murine macrophages. A role for endotoxin
contamination in NF-B activation and nitric oxide production. J. Biol.
Chem. 278, 31853–31860.
62. Lowenstein, C. J., Padalko, E. (2004) iNOS (NOS2) at a glance. J. Cell Sci.
117, 2865–2867.
63. Yonekura, H., Yamamoto, Y., Sakurai, S., Watanabe, T., Yamamoto, H.
(2005) Roles of the receptor for advanced glycation endproducts in dia-
betes-induced vascular injury. J. Pharmacol. Sci. 97, 305–311.
Rouhiainen et al. HMGB1 and cytokine expression 57
64. Sumi, D., Ignarro, L. J. (2004) Regulation of inducible nitric oxide
synthase expression in advanced glycation end product-stimulated raw
264.7 cells: the role of heme oxygenase-1 and endogenous nitric oxide.
Diabetes 53, 1841–1850.
65. Adami, C., Bianchi, R., Pula, G., Donato, R. (2004) S100B-stimulated NO
production by BV-2 microglia is independent of RAGE transducing ac-
tivity but dependent on RAGE extracellular domain. Biochim. Biophys.
Acta 1742, 169 –177.
66. Kim, J. B., Sig Choi, J., Yu, Y. M., Nam, K., Piao, C. S., Kim, S. W., Lee,
M. H., Han, P. L., Park, J. S., Lee, J. K. (2006) HMGB1, a novel
cytokine-like mediator linking acute neuronal death and delayed neuroin-
flammation in the postischemic brain. J. Neurosci. 26, 6413– 6421.
58 Journal of Leukocyte Biology Volume 81, January 2007 http://www.jleukbio.org
