ArticlePDF Available

An Orally Active Selective Androgen Receptor Modulator Is Efficacious on Bone, Muscle, and Sex Function with Reduced Impact on Prostate

Authors:

Abstract and Figures

A number of conditions, including osteoporosis, frailty, and sexual dysfunction in both men and women have been improved using androgens. However, androgens are not widely used for these indications because of the side effects associated with these drugs. We describe an androgen receptor (AR) ligand that maintains expected anabolic activities with substantially diminished activity in the prostate. LGD2226 is a nonsteroidal, nonaromatizable, highly selective ligand for the AR, exhibiting virtually no affinity for the other intracellular receptors. We determined that AR bound to LGD2226 exhibits a unique pattern of protein-protein interactions compared with testosterone, fluoxymesterone (an orally available steroidal androgen), and other steroids, suggesting that LGD2226 alters the conformation of the ligand-binding domain. We demonstrated that LGD2226 is fully active in cell-based models of bone and muscle. LGD2226 exhibited anabolic activity on muscle and bone with reduced impact on prostate growth in rodent models. Biomechanical testing of bones from animals treated with LGD2226 showed strong enhancement of bone strength above sham levels. LGD2226 was also efficacious in a sex-behavior model in male rats measuring mounts, intromissions, ejaculations, and copulation efficiency. These results with an orally available, nonaromatizable androgen demonstrate the important role of the AR and androgens in mediating a number of beneficial effects in bone, muscle, and sexual function independent from the conversion of androgens into estrogenic ligands. Taken together, these results suggest that orally active, nonsteroidal selective androgen receptor modulators may be useful therapeutics for enhancing muscle, bone, and sexual function.
Content may be subject to copyright.
An Orally Active Selective Androgen Receptor Modulator
Is Efficacious on Bone, Muscle, and Sex Function with
Reduced Impact on Prostate
Jeffrey N. Miner, William Chang, Mark S. Chapman, Patricia D. Finn, Mei Hua Hong,
Francisco J. Lo´pez, Keith B. Marschke, Jon Rosen, William Schrader, Russell Turner, Arjan van Oeveren,
Humberto Viveros, Lin Zhi, and Andres Negro-Vilar
Research and Development (J.N.M., W.C., M.S.C., P.D.F., M.H.H., F.J.L., K.B.M., J.R., W.S., A.v.O., H.V., L.Z., A.N.-V.),
Ligand Pharmaceuticals Inc., San Diego, California 92121; and D
ˆ
epartment of Nutrition and Exercise Sciences (R.T.),
Oregon State University, Corvallis, Oregon 97331
A number of conditions, including osteoporosis, frailty, and
sexual dysfunction in both men and women have been im-
proved using androgens. However, androgens are not widely
used for these indications because of the side effects associ-
ated with these drugs. We describe an androgen receptor (AR)
ligand that maintains expected anabolic activities with sub-
stantially diminished activity in the prostate. LGD2226 is a
nonsteroidal, nonaromatizable, highly selective ligand for the
AR, exhibiting virtually no affinity for the other intracellular
receptors. We determined that AR bound to LGD2226 exhibits
a unique pattern of protein-protein interactions compared
with testosterone, fluoxymesterone (an orally available ste-
roidal androgen), and other steroids, suggesting that
LGD2226 alters the conformation of the ligand-binding do-
main. We demonstrated that LGD2226 is fully active in cell-
based models of bone and muscle. LGD2226 exhibited anabolic
activity on muscle and bone with reduced impact on prostate
growth in rodent models. Biomechanical testing of bones from
animals treated with LGD2226 showed strong enhancement of
bone strength above sham levels. LGD2226 was also effica-
cious in a sex-behavior model in male rats measuring mounts,
intromissions, ejaculations, and copulation efficiency. These
results with an orally available, nonaromatizable androgen
demonstrate the important role of the AR and androgens in
mediating a number of beneficial effects in bone, muscle, and
sexual function independent from the conversion of andro-
gens into estrogenic ligands. Taken together, these results
suggest that orally active, nonsteroidal selective androgen
receptor modulators may be useful therapeutics for enhanc-
ing muscle, bone, and sexual function. (Endocrinology 148:
363–373, 2007)
S
UPPLEMENTAL ANDROGEN THERAPY is used to
treat a variety of male disorders characterized by low
testosterone (T) levels. In men 75 yr of age and older but
otherwise in good health, mean plasma T levels drop to 35%
of that of a comparable population of younger men (1). This
age-associated T decrease, or andropause, may cause the
fatigue, depression, reduced muscle and bone mass, de-
creased hematopoiesis, and sexual dysfunction sometimes
found in elderly men (2). Androgens not only are effective in
the elderly, but supplemental androgens have also demon-
strated efficacy in the treatment of osteoporosis, including
glucocorticoid-induced osteoporosis. They are also effica-
cious at building muscle and bone in wasting diseases such
as cancer and HIV (3). Furthermore, androgens may have a
role in the treatment of certain forms of female (4) and male
(5) sexual dysfunction.
Despite the mounting evidence that androgens are effec-
tive in a growing number of indications for both men and
women, they are not routinely prescribed. There are a num-
ber of problems with current therapies that limit their use-
fulness. These include prostate hypertrophy and the poten-
tial for induction or acceleration of prostate cancer disease in
men, the development of male secondary sex characteristics
in women (hirsutism and deepening of voice), and acne in
both sexes. The route of administration is also an issue;
steroidal androgens cannot be given orally without risking
liver toxicity. Injectable T or T esters can cause problems that
are associated with abnormally high T immediately after
administration. Other topical options such as T patches and
gels can cause local skin irritation and spousal transfer and
are cumbersome to use.
Although androgens clearly have a valuable effect on bone
in the clinic, conversion of T into estrogen by aromatization
has clouded the interpretation of the efficacy of androgens
directly on bone, in particular because of the well charac-
terized effects of estrogen on bone in females (6). Further-
more, the severe osteoporosis found in an estrogen receptor
(ER)-
-negative male has validated the important role the ER
plays in the male skeleton (7). That estrogens are important
First Published Online October 5, 2006
Abbreviations: AF2, Activation function 2; AR, androgen receptor;
CA, charcoal absorbed; DHT, dihydrotestosterone; DPD, deoxypyr-
idinoline; 17
-E
2
,17
-estradiol; ER, estrogen receptor; FBS, fetal bovine
serum;
-Gal,
-galactosidase; GR, glucocorticoid receptor; GRIP1, GR
interacting protein 1; IMDM, Iscove’s modified Dulbecco’s medium;
LBD, ligand-binding domain; MMTV, mouse mammary tumor virus;
MR, mineralocorticoid receptor; ORDX, orchidectomized; PLSD, pro-
tected least significant difference; PPAR, peroxisome proliferator-acti-
vated receptor; PR, progesterone receptor; PSA, prostate-specific anti-
gen; RSV, Rous sarcoma virus; SARM, selective AR modulator; T,
testosterone.
Endocrinology is published monthly by The Endocrine Society (http://
www.endo-society.org), the foremost professional society serving the
endocrine community.
0013-7227/07/$15.00/0 Endocrinology 148(1):363–373
Printed in U.S.A. Copyright © 2007 by The Endocrine Society
doi: 10.1210/en.2006-0793
363
does not diminish the need for androgen action in bone.
Nonaromatizable androgens are known to be active in can-
cellous bone without aromatization to estrogens (8). Fur-
thermore, male androgen receptor (AR) knockout mice de-
velop severe osteopenia (8 –10).
The development of an orally active, selective AR modu-
lator (SARM) with significant anabolic activity in muscle,
bone, and sexual function but with a reduction in the severity
of side effects may be useful for the treatment of osteoporosis,
frailty, and some forms of sexual dysfunction (11, 12).
Compounds derived from known AR antagonists (bica-
lutamide and flutamide) have been found to have relatively
little effect on prostate while maintaining effects on muscle,
but little or nothing is known about their effects on bone or
on sexual behavior. These molecules are rapidly cleared in
the liver (13, 14) and are thus not suitable for oral adminis-
tration. Other SARMs have been described, but these exhibit
a weak separation between their effects on prostate and bone
and are not orally available (14, 15). Moreover, the mecha-
nism by which these SARMs separate anabolic efficacy from
prostate effects is unknown (14 –20).
The AR is a ligand-regulated transcription factor that mod-
ulates gene expression either by binding directly to the pro-
moter of target genes or by affecting gene expression indi-
rectly through the interaction with protein coregulators. It is
these interactions that result in the regulation of gene tran-
scription and a response to androgens. The AR contains three
domains involved in transcriptional regulatory activity, in-
cluding a central DNA-binding domain, a C-terminal ligand-
binding domain (LBD), and an N-terminal activation do-
main, all of which are capable of binding coregulatory
proteins. Many of these regulatory proteins contain a specific
motif of amino acids (LXXLL) that binds directly to the ac-
tivation function 2 (AF2) region of the LBD of the receptor
(21). AR itself has a related sequence, FxxLF, in the N ter-
minus. This sequence interacts directly with the LBD in a
hormone-dependent manner (22, 23). The AR N terminus is
bound to the C terminus in the presence of hormone in living
cells (24). Interaction between the receptor LBD and the
LxxLL motif of the coregulatory proteins or the receptor N
terminus depends on the nature of the ligand that is bound
to the receptor. Some agonist ligands allow this interaction,
many antagonists do not, and some ligands alter the affinity
and specificity of coactivator interactions (25–27). Ligands
that change the coregulator interaction profile may also alter
the function of AR when bound to these molecules as has
been seen for other steroid receptors (28).
This manuscript describes the discovery and character-
ization of LGD2226. LGD2226 exhibits anabolic activity in in
vitro and in vivo models of bone and muscle response to
androgen, despite reduced interaction of AR with certain
coactivators relative to steroids. In contrast to the effects of
T and dihydrotestosterone (DHT), prostate growth in the
LGD2226-treated animals was markedly reduced. Further-
more, this nonaromatizable compound is fully capable of
inhibiting resorption in cancellous bone and enhancing the
bone formation rate in cortical bone. The latter is solely a
property of androgens, because estrogens under the same
conditions inhibit cortical bone formation (29). These effects
in bone result in an overall increase in bone strength well
beyond the level achieved with endogenous T. LGD2226 is
fully efficacious at preventing castration-induced loss of sex-
ual function in male rats. Taken together, these data show
that LGD2226 exhibits a beneficial profile that would be
useful in a clinical setting characterized by low levels of T,
reduced bone mineral density, or reduced muscle mass with-
out some of the side effects of currently marketed steroidal
androgens.
Materials and Methods
In vitro binding
Extracts from Spodoptera frugiperda 9 (Sf9) moth cells infected with
recombinant baculovirus expressing the indicated receptor were used in
labeled hormone-binding assays. Growth and purification of recombi-
nant human AR baculovirus was done as described (25–27). Labeled
DHT (1–2 nm [
3
H]DHT) (Sigma Chemical Co., St. Louis, MO) at 130
Ci/mmol was used, and varying concentrations of competing ligand
(0–10
5
m). Dissociation constant (K
d
) values for the analogs were cal
-
culated by application of the Cheng-Prussof equation.
Mineralocorticoid receptor (MR), glucocorticoid receptor (GR), and
progesterone receptor (PR) expression in the baculovirus system and
binding assays were conducted similarly except that labeled ligands
were 1–2 nm [
3
H]aldosterone (TRK 434; Amersham, Arlington Heights,
IL) with a specific activity of 60 Ci/mmol, 1–2 nm [
3
H]dexamethsone at
84 Ci/mmol, and 2–3 nm [
3
H]progesterone at 93 Ci/mmol (Sigma),
respectively. Each binding assay point was done in duplicate, and each
full experiment was repeated three to five times.
Reporter assays
DMEM and Eagle’s MEM were obtained from BioWhittaker (Walk-
ersville, MD). All fetal bovine serum (FBS) was purchased from Hyclone
(Logan, UT). CV-1 cells were obtained from American Type Culture
Collection (Rockville, MD).
CV1 or MDA-MB-453 cells derived from a human mammary carci-
noma (ATCC HTB 131) were cultured in DMEM supplemented with
10% charcoal resin-stripped FBS. Cells were seeded 48 h before trans-
fection in 96-well microtiter plates. Cells were transiently transfected by
the calcium phosphate coprecipitation procedure (30) with a reporter
plasmid, MMTV-Luc, containing the mouse mammary tumor virus
(MMTV) long terminal repeat linked to luciferase, a
-galactosidase
(
-Gal) expression plasmid, pCMV-
-Gal, coding for the constitutive
expression of Escherichia coli
-Gal, and filler DNA (pGEM) in the pres-
ence (CV1) or absence (MDA) of hGR expression in plasmid (RSVhGR).
IL-6 repression assay
The human osteoblast cell line Saos-2 was transfected with a human
AR expression plasmid and a luciferase reporter plasmid consisting of
the IL-6 promoter controlling luciferase expression. Saos-2 cells (3 10
6
)
were seeded in a T225 flask and cultured for 24 h in DMEM supple-
mented with 10% FBS. FuGene 6 transfection reagent (Roche Molecular
Biochemicals, Indianapolis, IN), was used to transiently transfect the
cells according to the manufacturer’s specifications. Transient transfec-
tions were performed at a 3:1 (vol/wt) FuGene 6/DNA ratio containing
0.7
g human AR expression plasmid and 1.4
g luciferase reporter
plasmid per flask of cells for 16 h. Cells were removed from the flask
using trypsin and plated into 96-well plates (6 10
3
cells per well) in
DMEM-charcoal absorbed (CA) FBS. Compounds were diluted in
DMEM-CA FBS containing TNF
(10 ng/ml) and IL-1
(1 ng/ml) and
the cell incubated for 16 h in the absence and presence of compound
(from 10
11
to 10
6
m) and with DMEM-CA FBS alone. Medium was
removed, and cells were lysed in Triton X-100 buffer.
Prostate-specific antigen (PSA) promoter assay in a prostate
cancer cell line (22RV1)
Iscove’s modified Dulbecco’s medium (IMDM) was obtained from
Hyclone. The 22RV1 cells were obtained from American Type Culture
Collection. The 22RV1 cells are a human prostate carcinoma epithelial
364 Endocrinology, January 2007, 148(1):363–373 Miner et al. Anabolic SARM with Reduced Prostate Impact
cell line derived from a xenograft that was serially propagated in mice
after castration-induced regression and relapse of the parental, andro-
gen-dependent CWR22 xenograft. Cells were cultured in IMDM sup-
plemented with 10% FBS. Cells were seeded 24 h before transfection in
24-well plates. Cells were transiently transfected using FuGene 6
(Roche), according to the manufacturer’s specifications. Transient trans-
fections were performed at a 6/1 (vol/wt) FuGene 6/DNA ratio con-
taining 25 ng PSA reporter and 25 ng of a
-Gal expression plasmid,
pCMV-
-Gal, coding for the constitutive expression of Escherichia coli
-Gal, and 50 ng filler DNA (pGEM) per well for 18 h. Compounds were
diluted in IMDM-2% charcoal-treated-FBS medium and cells treated for
24 h and lysed and luciferase activity was measured using a luminom-
eter (Torcon).
Two-hybrid assays
Gal4 DNA-binding domain-peptide fusions were constructed by first
synthesizing the following oligonucleotides (all shown 5 to 3): FxxLF
forward, AATTCCCGTCCAGATCCAAGACCTACCGAGGAGCTTT-
CCAGAATCTGTTCCAGAGCGTGCGCGAAGTGATCT, and FxxLF
reverse, CTAGAGATCACTTCGCGCACGCTCTGGAACAGATTCTG-
GAAAGCTCCTCGGTAGGTCTTGGATCTGGACGGG; and D11/F
forward, AATTCCCGTCCAGAGTTGAGAGCGGGAGCAGCAGGTT-
TATGCAGCTTTTTATGGCGAACGATCTTCTTACCT, and D11/F re-
verse, CTAGAGGTAAGAAGATCGTTCGCCATAAAAAGCTGCAT-
AAACCTGCTGCTCCCGCTCTCAACTCTGGACGGG.
The forward and reverse pairs were annealed by heating to 95 C and
cooling slowly and then cloned into pM (Clontech, Palo Alto, CA) and
cut with EcoRI and XbaI. The resulting plasmids were sequenced to
verify the in-frame fusion to the Gal4 DNA-binding domain of the FxxLF
(the polypeptide SKTYRGAFQNLFQSVREVI) or the D11/F (VESGSS-
RFMQLFMANDLLT) (31). For experiments using Gal4-peptides, exper-
iments were conducted as described (25–27). HepG2 liver cells lacking
AR were transfected with reporter Gal4D5LUC3, VP16-hAR, Gal4-pep-
tide construct, Rous sarcoma virus (RSV)-
-Gal as a normalization con-
trol, and pGEM as carrier DNA. Transfections were carried out using
FuGene 6 per the manufacturer’s protocol (Roche). After 24 h treatment,
cells were lysed and assayed for luciferase and
-Gal activity. All values
shown are the mean of three wells and are representative of multiple
experiments.
GR interacting protein 1 (GRIP1) coactivation assay
A total of 3 10
6
CV-1 cells (American Type Culture Collection) were
transfected with FuGene 6 with 4
g MMTV-Luc, 0.5
g RSV-
-Gal, 1
ng RSV-driven hAR expression plasmid, and either 1
g pGEM or
pSG5.GRIP1 expression vector (kindly provided by M. Stallcup, Uni-
versity of Southern California). After 24 h, cells were trypsinized and
replated in 96-well plates (30,000 cells per well) with compounds as
indicated in Eagle’s MEM supplemented with 0.5% charcoal-treated-
FBS. Luciferase and
-Gal assays were performed after 24 h of treatment.
All values shown are representative of four experiments done in
triplicate.
Serum LH determination
Serum (200
l) was incubated at room temperature for 2–3 d with 100
l 1:100,000 diluted primary rabbit antibody (NIDDK antirat LH S-11
antibody), and 100
lof[
125
I]iodinated LH (Covance Laboratories, Inc.,
Vienna, VA) diluted to 200,000–300,000 cpm/ml was added and the
incubation continued for an additional 24 h. Bound LH was separated
from the free hormone by adding 50
l of 4% normal rabbit antibody and
50
l of 1:10 diluted goat antirabbit secondary antibody (Antibodies,
Inc., Davis, CA) on beads followed by overnight incubation at4Cand
centrifugation. Pellets were counted in a 10-channel
-counter. The assay
has a minimum detectable LH amount of 0.001 ng/tube. The intra- and
interassay variability is less than 10%.
Urine deoxypyridinoline (DPD) determination
Urine DPD and creatinine were assayed at SkeleTech, Inc. (Bothell,
WA). Both DPD and creatinine were assayed according to the protocol
of Metra Biosystems, Inc. (Mountain View, CA).
Data analysis
The data were analyzed for the effects of androgens on orchidecto-
mized (ORDX) rats by ANOVA, followed by Fisher’s protected least
significant difference (PLSD) test. P 0.05 was the level necessary to
achieve statistical significance.
Compounds and formulations
LGD2226 was synthesized at Ligand Pharmaceuticals, Inc., and flu-
oxymesterone (9
-fluoro-11
-hydroxy-17
-methyltestosterone) was
purchased from Spectrum (New Brunswick, NJ; catalog no. FL-134).
Both LGD2226 and fluoxymesterone were formulated as suspensions in
a vehicle containing 9.95% polyethylene glycol 400, 0.05% Tween 80, and
0.9% carboxymethyl cellulose in water. The concentrations of test com-
pounds corresponded to doses of 1, 3, 10, 30, and 100 mg/kg per 4-ml
vehicle. Calcein and tetracycline hydrochloride (Sigma) were used for
bone labeling. Calcein was dissolved in 2% NaHCO
3
and tetracycline
hydrochloride in sterile water. Both markers, which were used at a
concentration of 50 mg/ml, were injected in a volume of 0.1 ml, corre-
sponding to a dose of 5 mg/250 g rat into the perivascular region at the
base of the tail.
Animals
All procedures involving animals were approved by Ligand’s Insti-
tutional Animal Care and Use Committee.
Two-week study
For the 2-wk studies (see Fig. 3), adult (7-wk-old) Sprague Dawley
rats were purchased from Harlan (Indianapolis, IN), orchidectomized,
and treated using oral gavage immediately after surgery with either
vehicle or LGD2226 (1, 3, 10, 30, and 100 mg/kgd). Twenty-four hours
after the last dose, the animals were euthanized by decapitation. The
ventral prostate and levator ani muscle were collected, dissected free of
adipose tissue, blotted dry, and weighed.
Six-week study
For the 6-wk long-term bone study (see Fig. 4), 7-wk-old male
Sprague Dawley rats (250 g body weight) were used. Animals were
housed two to three per cage, fed standard rodent chow (Teklad, 8604)
containing 1.46% calcium, 0.99% phosphorus, and 4.96% vitamin D
3
and
maintained on a 12-h light, 12-h dark cycle (lights on at 0600 h). Animals
were acclimatized for 1 wk before beginning experiments. The first
bone-labeling marker, calcein (5 mg/rat0.1 ml) was administered to the
animals by perivascular injection at the base of the tail 3 d before ORDX.
At the beginning of the study (d 1), rats were arbitrarily allocated to
seven groups, with 10 animals per group. Groups were treated with
compound by oral gavage (groups 1–3 were vehicle treated): 1) gonad-
ally intact (baseline control group), 2) sham-operated, 3) ORDX, 4)
ORDX treated with fluoxymesterone (100 mg/kgd), and 5–7) ORDX
treated with LGD2226 at 1, 3, and 10 mg/kgd. On d 2, animals of the
baseline control group (group 1) were killed by decapitation, tibiae and
femora were isolated and tibiae transferred to 70% ethanol, and femora
were stored at 80 C. On d 32 and 40 (10 and 2 d before being killed),
rats received tetracycline (5 mg/rat0.1ml) as a second and third bone-
labeling time point. Urine was collected continuously over a 16-h period
in metabolic cages and frozen at 80 C. Cleared urine supernatants were
sent to SkeleTech for analysis of DPD and creatinine. At the end of the
study (6 wk), rats were weighed and then killed by decapitation. Serum
was processed and stored at 20 C for further analysis. Long bones,
consisting of tibiae and femora of both hind limbs, were isolated and
tibiae transferred to 70% ethanol. Femora were stored at 80 C. Tibiae
were evaluated using histomorphometric analysis.
Histomorphometry
Histomorphometric analyses of hind limb tibiae were carried out as
described (8, 32). Multiple parameters of cortical bone (tibial diaphysis)
and cancellous bone (proximal tibia metaphysis) were measured using
a digitizing morphometry system. The system consisted of an epifluo-
rescence microscope, a color video camera, and a digitizing pad (Nu-
Miner et al. Anabolic SARM with Reduced Prostate Impact Endocrinology, January 2007, 148(1):363–373 365
monics 2206) coupled to a personal computer and the morphometry
program OsteoMetrics (OsteoMetrics, Atlanta, GA).
Cortical bone measurements
Ground transverse sections were used for morphometric analysis of
cortical bone. Cross-sections of 150-mm thickness were cut at the tibio-
fibular junction with a low-speed saw (Isomet) equipped with a dia-
mond wafer blade. The sections were ground to a thickness of 15–20
m
on a roughened glass plate and were mounted in glycerin before mi-
croscopic examination under UV illumination to visualize calcein and
tetracycline fluorochrome labeling. The following measurements were
performed: 1) periosteal bone formation rate (mm
2
/d 10
3
), calculated
as the area outside of initial calcein label and inside the periosteal surface
divided by the labeling period; 2) bone mineral apposition rate (
m/d),
defined as the area outside of the initial calcein label and inside the
periosteal surface divided by the product of the labeled surface length
(see below) and the labeling period; and 3) periosteal mineralization rate,
calculated as the area bounded by each pair of tetracycline labels and
divided by the product of the length of the initial label and the labeling
period. These measurements are described in greater detail by Baylink
et al. (33).
Cancellous bone measurements
The tibiae were sectioned transversely at the mid-diaphysis with a
low-speed diamond saw and decalcified in 5% formic acid in 10% for-
malin for several days. The bones were then bisected in the midsagittal
plane using a scalpel and dehydrated in ascending grades of alcohol
before infiltrating and embedding in glycol-methylmethacrylate, a mix-
ture of methylmethacrylate and 2-hydroxyethylmethacrylate (12.5/1).
The resulting blocks were sectioned at an indicated thickness of 5
m
on a Jung-Reichart microtome (Heidelberg, Germany). The sections were
mounted on slides and subjected to morphometric analysis. Cancellous
bone was examined in the secondary spongiosa of the proximal tibia
metaphysis at a standard sampling site no less than 1 mm caudal to the
epiphysial growth plate. Measured parameters of cancellous bone in-
cluded 1) total bone area, defined as the total area of trabecular bone
present expressed as a percentage of the total tissue area (bone and
marrow area) in the sampling site, which was converted to a volume by
multiplication by unit thickness (bone volume/trabecular volume); 2)
cancellous bone perimeter, defined as the total trabecular surface length
present in the sampling site; 3) single- and double-labeled perimeters;
and 4) interlabeled widths.
The measured parameters were then used to calculate 1) percent
cancellous bone volume (cancellous bone area/total tissue area 100%)
and 2) cancellous bone formation rate (double-labeled perimeters
single-labeled perimeters/2) interlabeled widths/interval time/can-
cellous perimeters). All measurements and calculations were carried out
according to the standard nomenclature (34).
Sixteen-week study
The 16-wk long-term bone study (see Fig. 4, G–I) was conducted
similarly to the 6-wk study with the following exceptions. Nine-month-
old male Sprague Dawley rats (500 g body weight) were housed
individually and acclimatized for 2 wk. On d 2, animals of the baseline
control group (group 1) were weighed, anesthetized by CO
2
, and then
euthanized by exsanguination. Ten and 2 d before the termination of the
16-wk study, rats received tetracycline (5 mg/rat0.1ml) as a second and
third bone-labeling time point. At the conclusion of the 16-wk treatment
period, bones, serum, and tissues were processed as described above; in
addition, lumbar vertebrae (L1–L2 and L3–L5) were excised and pro-
cessed for further analysis. Tibiae and L1–L2 lumbar vertebrae were
transferred into 70% alcohol, whereas L3–L5 lumbar vertebrae and fem-
ora were wrapped in saline-soaked gauze and stored in zipped plastic
bags at 80 C. Frozen L3–L5 vertebrae and femora were sent on dry ice
to SkeleTech for determination of bone mineral density and mechanical
properties.
Mechanical testing
Using a material testing system (model 5501R; Instron Corp., Canton,
MA), four types of mechanical testing were performed in the femur and
the lumbar vertebral body. The load and extension curve was collected
by the accompanied software (Merlin II; Instron Corp.). All tests were
conducted using a 5-kN load cell at a constant loading rate of 6 mm/min.
Compression test of the fourth lumbar vertebral body
A compression test was used to determine the mechanical properties
of the lumbar vertebral body, as described (35). The lumbar vertebral
body test specimen was obtained by removing the two epiphyseal ends,
posterior pedicle arch, and spinous process from the whole vertebra
using a slow-speed saw. An electronic caliper was used to measure the
average dorsal to ventral diameter (a), side-to-side diameter (b), and
height (h). The maximal load (36), stiffness (S), and energy (W) were
obtained from the load and extension curve. The following parameters
were calculated from the measured values: cross-sectional area (CSA)
(
a b)/4; ultimate strength (
) F
u
/CSA; elastic modulus (E)
S/(CSA/h); and toughness (T) W/(CSA h). Breaking strength is the
force necessary to compress/crush the bone (newtons). Ultimate break-
ing strength is the crush force per area (newtons per square millimeter).
Sexual behavior study
LGD2226 and fluoxymesterone were tested for effects on sexual be-
havior parameters in ORDX hooded Long-Evans rats between 5 and 6
months of age. These animals have previously been shown to respond
to androgens (37, 38). Ovariectomized female Sprague Dawley rats
(Charles River, MA) were used as stimulus. Rats were housed under a
reversed 12-h light, 12-h dark cycle. Before ORDX, male rats were first
tested for consistent sex behavior with sexually receptive (stimulus)
females. Males that reliably copulated over the course of several weeks
of testing were admitted to the treatment phase of the study.
The males were kept sexually active during a 6-wk interval between
screening tests and treatment by testing them in 20-min sex behavior
tests with stimulus females at 7- to 14-d intervals. The males were
castrated and implanted with Silastic capsules (30 mm long; inner di-
ameter, 1.57 mm; outer diameter, 3.18 mm; Dow Corning, Midland, MI)
containing 17
-estradiol (17
-E
2
) (Sigma; lot 28H0818; 50
g/ml in olive
oil) under isoflurane anesthesia. Before implantation, the Silastic cap-
sules were rinsed twice with 0.1 m PBS (pH 7.4) for removal of 17
-E
2
from the exterior of the capsule and then stirred overnight in PBS to
facilitate the release of the 17
-E
2
from the interior of the capsule. The
males were subdivided into three groups, and animals in each group
were dosed daily by oral gavage (4 ml/kg) with one of the following
treatments: vehicle (n 15), , LGD2226 (100 mg/kg in vehicle) (n 16),
or fluoxymesterone (100 mg/kg in vehicle) (n 16). Males were then
tested weekly at 6- or 7-d intervals starting 1 wk after surgery for 8 wk
with stimulus females (treatment phase of sexual behavior testing). The
males were killed 4 d after the last test session.
Results
In vitro activity
LGD2226 was synthesized based on structure-activity rela-
tionships within a series of bicyclic compounds (6-alkylamino-
1H-quinolin-2-ones) that exhibited AR agonist and antagonist
properties. This compound (6-[bis-(2,2,2-trifluoroethyl)amino]-
4-trifluoromethyl-1H-quinolin-2-one) binds AR with high af-
finity (K
d
1nm) (Fig. 1
, A and B). LGD2226 shows no
significant cross-reactivity with the intracellular receptors: GR,
PR, MR, ER, retinoic acid receptor, farsenoid X receptor-
, liver
X receptor-
, pregnane X receptor-
, peroxisome proliferator-
activated receptor (PPAR)-
, PPAR-
, and PPAR-
in binding
and cotransfection assays (data not shown). In cotransfection
assays using CV-1 cells (African green monkey kidney cell line
lacking AR) transfected with the androgen-responsive MMTV-
Luc reporter and the AR, LGD2226 is a strong, potent agonist,
similar to DHT and the synthetic steroid fluoxymesterone (Fig.
1C). DHT, T, fluoxymesterone, and LGD2226 all repressed
transcription from the IL-6 promoter in HOS osteoblast bone
366 Endocrinology, January 2007, 148(1):363–373 Miner et al. Anabolic SARM with Reduced Prostate Impact
cells by about 80% (Fig. 1D). Thus, LGD2226 is capable of
inducing both transcriptional activation and repression by AR.
LGD2226 activity is antagonized by known selective antago-
nists of AR in vitro and in vivo (data not shown). Because of the
negative effect of androgens on prostate size and prostate
cancer, we also tested the activity of LGD2226 in a prostate
cancer cell line (22RV1) for activation of the PSA promoter (Fig.
1E). We transfected a PSA/luciferase reporter into 22RV1 cells
and measured activity in response to androgens and the
SARM LGD2226. The results indicate that in contrast to the
MMTV and bone cell assays, LGD2226 exhibits weak partial
activity in this prostate cancer cell line.
Coactivator interactions
To understand the differential activity of LGD2226, we
have used a series of peptide-based two-hybrid assays to
analyze the effects of LGD2226 on the structure and function
of the AR AF2 pocket on the surface of the LBD. These assays
use the Gal4 DNA-binding domain tethered to small inter-
acting peptides that are capable of binding to AR in the
presence of ligand (31). The F peptide contains an FxxLF
motif derived from the AR N terminus and represents one of
the interaction sites between the AR N terminus and the AR
LBD (23). The steroidal agonists T and fluoxymesterone ef-
ficiently induce the interaction of AR and the peptide; how-
ever, LGD2226 is much weaker, exhibiting greatly reduced
efficacy and potency (Fig. 2A). In contrast, a peptide with a
different sequence (D11/F) (31) demonstrated equal efficacy
between the steroids and LGD2226 (Fig. 2B). As expected,
2-hydroxyflutamide, an AR antagonist, was inactive in both
assays. As shown in Fig. 2C, LGD2226 was fully capable of
antagonizing the fluoxymesterone-induced AR LBD-F-pep-
tide interaction, suggesting that indeed, the peptide was not
able to bind to the AR LBD in the presence of LGD2226.
FIG. 1. LGD2226, a selective AR ago-
nist. A and B, The structure (A) of
LGD2226 (6-[bis-(2,2,2-trifluoroethyl)
amino]-4-trifluoromethyl-1H-quinolin-
2-one) is shown together with a table
(B) showing its high-affinity binding
for AR and low-affinity binding for
other steroid receptors (GR, PR, and
MR). C, Cotransfection experiments
demonstrating full activation from the
MMTV-Luc reporter in response to in-
creasing concentrations of DHT (F),
fluoxymesterone (E), and LGD2226
(Œ). The
SEM is shown for each dose. D,
Strong IL-6 repression by DHT (f), flu-
oxymesterone (), and LGD2226 (Œ)is
shown. The SEM is also plotted for each
dose. E, Cotransfection experiments
demonstrating partial agonist activity
of LGD2226 in a 22RV1 prostate cancer
cell line measuring activation of the
PSA promoter by the compound com-
pared with steroidal androgens (DHT
and fluoxymesterone) at the same dose.
Vehicle is used as a background con-
trol, and SEM is shown on top of each
column with error bars.
Miner et al. Anabolic SARM with Reduced Prostate Impact Endocrinology, January 2007, 148(1):363–373 367
Similarly, flutamide could also antagonize the F peptide in-
teraction with the AR LBD. The same results were obtained
using the full-length N terminus (data not shown). In addi-
tion, in another type of coactivation assay, GRIP-1 (also
known as steroid receptor coactivator 1) (39, 40) did not
enhance LGD2226-mediated transcription but markedly en-
hanced steroid-mediated transcription (Fig. 2D). This differ-
ential interaction was not seen with other coactivators in
similar assays (data not shown).
Two-week in vivo study
The strong in vitro efficacy profile in bone and muscle cell
assays as well as the clearly distinct coactivator binding
profile prompted us to test LGD2226 in vivo. A 2-wk study
was conducted in young adult rats that were ORDX at 8 wk
of age and dosed orally from 1–100 mg/kgd with LGD2226
or T (Fig. 3). T was used for this study because it is routinely
used clinically to treat hypogonadism. We have conducted
similar experiments with other orally available steroids (flu-
oxymesterone) with similar results. In Fig. 3, both LGD2226
and T exhibited strong anabolic activity on levator ani muscle
weight that was similar to sham at 3 mg/kg and greater than
sham at higher doses (Fig. 3A). High levels of androgen
typically results in increased growth of the prostate. How-
ever, in contrast to the results with the muscle endpoint,
LGD2226 produced considerably less prostate growth at all
FIG. 2. LGD2226-specific alterations in AR-coactivator interactions. A, HepG2 cells were transfected with plasmids encoding a Gal4-luciferase
reporter, Gal4-FxxLF (F-peptide), VP16-hAR, and RSV-
-Gal as a normalization control. After treatment with compounds or reference steroids
for 24 h, cells were assayed for luciferase activity. B, Cells were transfected as in A, except that Gal4-D11/F replaced the F-peptide. C, Cells
were transfected as in A. Luciferase and
-Gal values were determined after 24 h. Cell treatments were 1) vehicle alone, 2) 10 nM fluoxyme-
sterone, 3) 10 nM fluoxymesterone and 1
M LGD226, and 4) 10 nM fluoxymesterone and 1
M 2-hydroxyflutamide. D, CV-1 cells were transfected
with AR, MMTV-Luc reporter, RSV-
-Gal, and pSG5-HA.GRIP1. After 24 h, the cells were treated with the different compounds for 24 h at
10
M. Assays were done as for A.
FIG. 3. Tissue-selective agonist activity of LGD2226. A,
The muscle weights (levator ani) from eight rats treated for
2 wk with the indicated compound are averaged and plotted
as a percentage of sham controls (percent efficacy) together
with the SEM.T(F) and LGD2226 (E) were administered in
doses up to 100 mg/kg. B, Ventral prostate weights from
these same animals are plotted similarly together with the
SEM for each dose. C, LH levels in serum are shown relative
to sham. In this case, 100% represents sham-like levels of
suppression of LH.
368 Endocrinology, January 2007, 148(1):363–373 Miner et al. Anabolic SARM with Reduced Prostate Impact
doses when compared with T. Prostate weight reached levels
comparable to the intact animals only at 100 mg/kgd (Fig.
3B). T had almost doubled the prostate weight at 10 mg/kgd.
A large difference in potency and efficacy is also observed
when the effect of LGD2226 is compared with the effect of T
on LH suppression (Fig. 3C). Note that this graph is ex-
pressed as percent efficacy relative to sham; thus, high effi-
cacy equals high (sham-like) LH suppression in this case.
LGD2226 also suppressed seminal vesicle growth less effi-
ciently than T (data not shown). These results suggest that
LGD2226 is capable of strongly enhancing the development
of muscle without excessively stimulating the prostate and
the hypothalamus-pituitary-gonadal axis.
Six-week in vivo study
Positive impact on bone is crucial for the development of
a SARM; however, long-term studies are necessary to ob-
serve androgenic effects on this endpoint. After treating
young growing ORDX rats with oral doses of 1, 3, or 10
mg/kgd LGD2226 for 6 wk, we detected similar activity on
LH and similar selectivity of muscle vs. prostate size com-
pared with animals treated with fluoxymesterone at 100
mg/kg (Fig. 4, A–C). The animals were also examined for the
effects of the treatments on bone structure, strength, and
bone biomarkers. DPD is a collagen cross-link, which is pre-
dominantly found in the extracellular matrix of bone or car-
tilage (41). The urinary excretion of DPD is widely recog-
nized as a valuable marker of bone matrix degradation
during androgen deficiency in male rats (42– 44). DPD levels
were decreased in ORDX rats to sham values by LGD2226,
suggesting reduced bone resorption (Fig. 4D). To confirm
this activity in the bone itself, we examined tibiae from these
rats directly using histomorphometry. Mineral apposition
rate (number of osteoblasts) and bone formation rate (total
osteoblast activity) were calculated based on histomorpho-
metric data from tibiae from these animals. Neither castra-
FIG. 4. A–F, LGD2226 is active in bone (6-wk studies). The results of a 6-wk dosing experiment with LGD2226 are plotted for a variety of
endpoints including LH (A), muscle (B), prostate (C), DPD/urine creatinine (D), cancellous mineral apposition rate (E), and cancellous bone
formation rate/surface area (F). For each panel, various treatment results are shown for castrated rat control (gray vertical bar), LGD2226 dose
response 1, 3, 10 mg/kgd(f), fluoxymesterone 100 mg/kgd(F), and sham animals (black vertical bar). The data were analyzed for the effects
of androgens on ORDX rats by ANOVA, followed by Fisher’s PLSD test. *, P 0.05 was the level necessary to achieve statistical significance
from ORDX. G–I, LGD2226 is anabolic in bone (16-wk studies). The results of a 16-wk dosing experiment with LGD2226 are plotted for the
bone-related endpoints: G, bone mineral density; H, breaking strength; and I, ultimate breaking strength. The data were analyzed for the effects
of androgens on ORDX rats by ANOVA, followed by Fisher’s PLSD test. *, P 0.05 was the level necessary to achieve statistical significance
from ORDX; #, P 0.05 vs. sham.
Miner et al. Anabolic SARM with Reduced Prostate Impact Endocrinology, January 2007, 148(1):363–373 369
tion nor any dosing treatment of LGD2226 had significant
effects on either overall bone density or static or dynamic
measurements in cortical bone (data not shown). In cancel-
lous bone, as expected from earlier work in bone (44, 45) and
from the DPD data, bone formation and mineral apposition
rate were reduced in fluoxymesterone and LGD2226-treated
rats (Fig. 4, E and F). The reduced bone formation is due to
the direct coupling between bone formation and bone re-
sorption in cancellous bone and indicates a reduction in bone
turnover (44, 45); increased bone turnover with a net increase
in bone resorption is the mechanism for bone loss after
ORDX. For both parameters, LGD2226 was fully efficacious
at 3 mg/kg, effectively normalizing these parameters with
minimal effect on prostate.
Sixteen-week in vivo study
Because we were unable to see significant effects of
LGD2226 on overall bone density and bone formation in
cortical bone in this 2-month study in immature rats, we
conducted a longer study in skeletally mature ORDX rats
dosed orally for 16 wk. Fluoxymesterone treatment at 100
mg/kg for this length of time enlarged the livers of the
animals (data not shown). Oral steroidal androgens have
been associated with liver toxicity in humans and rodents
(46); however, liver enlargement has not been reported in
humans. No liver enlargement was seen with LGD2226 at 10
mg/kg (data not shown).
At 16 wk after ORDX, animals exhibited substantial loss of
bone density, and this loss was prevented by both the ste-
roidal androgen fluoxymesterone and the nonsteroidal an-
drogen LGD2226 (Fig. 4G). In addition, at the higher doses
of 3 and 10 mg/kg, LGD2226 caused frank increases in bone
mineral density above sham levels. The breaking strength
(newtons) and the ultimate breaking strength (newtons per
square millimeter) of LGD2226-treated tibae were above
sham at all doses, and 1 mg/kg of LGD2226 was equivalent
to 100 mg/kg of fluoxymesterone (Fig. 4, H and I).
Histomorphometric analysis of cortical bone from the
16-wk study revealed that both the periosteal mineral ap-
position rate and the periosteal bone formation rate were
significantly enhanced by treatment with LGD2226. This an-
abolic activity of LGD2226 was able to prevent bone loss and
maintain bone quality in ORDX rats by stimulating bone
formation while simultaneously inhibiting bone resorption
in cancellous bone.
Sex behavior model
In primates and in rats, nonaromatizable androgens act
both on the brain and in the periphery to stimulate male
sexual behavior. In rats, the central effects of nonaromatiz-
able androgens do not occur unless the animals are treated
concurrently with a behaviorally suboptimal priming dose of
estrogen (37, 38). The central and peripheral contributions of
androgens to the activation of male sexual behavior are often
evaluated by subdividing the behavior into motivation and
performance, respectively. Mounts, intromissions (insertion
of the penis into the vagina), and ejaculations were scored.
Mounting is considered to be the clearest measure of moti-
vation, whereas intromitting is considered a measure of both
motivation and performance. Ejaculation is associated with
performance. Copulatory efficiency is an overall perfor-
mance measure describing the animal’s ability to achieve an
intromission when mounting.
Reliably copulating, 6- to 9-month-old male rats were
ORDX and implanted with silastic capsules containing low-
dose estrogen and treated with vehicle, LGD2226, or flu-
oxymesterone. The animals were tested for sexual activity
every 6–7 d for 8 wk. The number of tests on which a given
rat 1) mounted, 2) intromitted, and 3) ejaculated were de-
termined and expressed in graphical format. Vehicle-treated
animals exhibited declines in both motivational and perfor-
mance indicators during the course of the study. In contrast,
oral dosing of these animals with either fluoxymesterone or
LGD2226 significantly enhanced sexual function over vehicle
alone. This included LGD2226-mediated increases in
mounts, intromissions, and ejaculations (Fig. 5, A–C). The
FIG. 5. Sex behavior study. These panels show the number of tests on
which ORDX, E
2
-treated rats treated with vehicle, LGD2226 100
mg/kg, or fluoxymesterone 100 mg/kg mounted (A), intromitted (B),
and ejaculated (C) when tested with sexually receptive female rats.
D, Copulatory efficiency for the same animals. Data are expressed as
means
SEM.*,P 0.05 vs. vehicle-treated group [one-way ANOVA
followed by Fisher’s PLSD test (A and B); Kruskal-Wallis test followed
by Mann-Whitney U test (C)]. At the time of castration, all males were
implanted with 30-mm-long Silastic capsules containing 17
-E
2
(50
g/ml) and began receiving daily oral dosing with fluoxymesterone
(100 mg/kg; black bars), LGD2226 (100 mg/kg; hatched bars), or ve-
hicle (white bars) for 8 wk. *, P 0.05 vs. vehicle-treated group
(two-way ANOVA with repeated measures followed by Fisher’s PLSD
test).
370 Endocrinology, January 2007, 148(1):363–373 Miner et al. Anabolic SARM with Reduced Prostate Impact
SARM also exhibited full efficacy on copulatory efficiency
(Fig. 5D) beginning at wk 4. LGD2226 and fluoxymesterone
were not significantly different from each other. Thus, both
androgens were capable of preventing the loss of motivation
and performance that occurs after castration in this rodent
model.
Discussion
Steroidal androgens are used in both men and woman for
a large variety of diseases including osteoporosis, frailty,
hypogonadism, sexual dysfunction, and others (47). Andro-
gens are quite effective because they are anabolic on bone
and muscle and act both centrally and peripherally on sexual
function.
The search for novel androgens that have a desirable ef-
ficacy profile coupled with reductions in the common side
effects associated with currently prescribed steroidal andro-
gens is being actively pursued (12–15).
Several groups, starting from the known AR antagonists
bicalutamide and flutamide, have developed a series of in-
jectable compounds that exhibit less effect on prostate while
maintaining effects on muscle or bone (12–20).
We have discovered a structurally distinct class of orally
active nonsteroidal compounds capable of functioning as
SARMs. We describe here a member of this class, LGD2226,
that binds competitively to the AR LBD with an affinity in the
nanomolar range. This compound is highly selective for the
AR, with greater than 1000-fold less affinity for any other
nuclear receptor (Fig. 1). In contrast to other described in-
jectable molecules with less selectivity, LGD2226 is a full
agonist in a number of in vitro efficacy assays and a partial
agonist in a prostate cancer cell PSA assay (Figs. 1 and 2).
Molecular analysis of the coactivator peptide interaction pro-
file of LGD2226 revealed significant differences between this
molecule and reference steroids. This differential profile was
generated using a number of peptides capable of binding to
the AR in a ligand-dependent fashion. We discovered that
one peptide derived from the N terminus of AR itself, despite
strong steroid-dependent interactions, was unable to bind
efficiently to AR in the presence of LGD2226. This suggested
that in much the same way that selective ER modulators alter
the conformation of the AF2 coactivator pocket of the ER,
LGD2226 alters the structure of this area of the AR in subtle
but critical ways such that certain peptides interact with
normal affinity, but the binding of others are significantly
reduced. The N-terminal interaction has been postulated to
play an important role in the regulation of gene expression
by the AR in prostate (23). We tested LGD2226 in several
versions of N-C interaction assays and found that the com-
pound exhibited reduced activity. Thus, it is likely that when
AR binds LGD2226, the N terminus is less tightly bound to
the LBD than when the AR is bound to steroids. In addition,
we have found that the coactivator GRIP 1 is less able to
coactivate a receptor bound to LGD2226 than one bound to
steroidal androgens.
This altered coactivator and N-terminal interaction profile
likely is the result of alterations in the structure of the re-
ceptor LBD helix 12 region. X-ray crystallographic analysis
of AR bound to LGD2226 is underway and will be published
elsewhere. The functional consequences of this altered co-
activator interaction profile were tested in vivo in a rat model
of androgen deficiency. There is controversy on the relative
contribution of AR vs. ER to bone structure and function,
because of the conversion of T to estrogen. Neither fluoxyme-
sterone nor LGD2226 is subject to aromatization to estrogen;
thus our experiments address this issue directly by testing
the effects of both nonaromatizable androgens on critical
parameters of bone formation, resorption, and strength in
ORDX rats as well as other endpoints.
We conducted a 2-wk study in ORDX rats with T or
LGD2226 and examined several parameters. We demon-
strated significant changes in LH. This critical steroidogenic
hormone is under tight negative feedback control by T, and
ORDX resulted in the expected rise in serum LH. This in-
crease was entirely and potently prevented by the control
steroid and by LGD2226 (Fig. 3A). Muscle weight from these
treated animals increased dramatically in response to
LGD2226 and the steroid, consistent with the role of andro-
gens in maintaining and enhancing muscle growth. At the
same dose that LGD2226 was powerfully anabolic to muscle,
prostate growth was limited, not reaching eugonadal levels
even at 10 mg/kg (Fig. 3, B and C). This separation in desired
efficacy and side effect suggests that this molecule could
have beneficial effects in patients in need of the anabolic
effects of androgens while avoiding the stimulatory effects
on prostate.
The effects on muscle notwithstanding, a critical compo-
nent of any SARM must be its activity on bone. As expected,
after 6 wk of dosing with vehicle, ORDX animals increased
bone resorption either because of the decreased activity of the
AR in response to endogenous T and DHT or because of the
decreased activation by the ER in response to decreased
estrogen from aromatized T. After dosing for 6 wk with the
nonaromatizable, orally available androgen fluoxymester-
one and with LGD2226, organ weights and hormone mea-
surements changed significantly for LH (Fig. 4A), levator ani
(Fig. 4B), and prostate (Fig. 4C), but the tissue selectivity
noted in the 2-wk study remained. Note that fluoxymester-
one is less potent on the organ endpoints than T. In addition,
both compounds efficiently blocked the bone resorption
marker DPD (Fig. 4D). Examination of the cancellous bone by
histomorphometry corroborated the marker data. Castration
increased both bone formation rate and mineral apposition
rate, and androgen treatment decreased these endpoints (Fig.
4, E and F). This androgen-driven decrease in bone formation
rate occurs because of the linkage between resorption and
formation of new bone in the cancellous compartment (48).
Androgens decrease resorption in cancellous bone on which
bone formation depends, and so formation drops as well.
Thus, by multiple measures, androgens that act solely
through the AR are capable of inhibiting bone resorption in
cancellous bone. This result indicates that it is possible for
androgens to mediate similar effects as estrogens in the can-
cellous compartment, suggesting that therapy with andro-
gens would at least mimic the antiresorptive activity of es-
trogens and bisphosphonates. In contrast, in rat cortical bone,
there is very little bone resorption, providing an ideal envi-
ronment to measure anabolic effects on bone formation di-
Miner et al. Anabolic SARM with Reduced Prostate Impact Endocrinology, January 2007, 148(1):363–373 371
rectly. It is known that estrogen actually inhibits bone for-
mation in cortical bone (32).
To measure bone formation in the cortical compartment,
we conducted an extended study of 16 wk of oral dosing with
LGD2226 followed by structural and histomorphometric
analysis of bones from treated and control animals. Bone
mineral density was significantly affected by both castration
and treatment with the androgenic compounds. Fluoxyme-
sterone and LGD2226 fully maintained bone density, and
LGD2226 at 3 and 10 mg/kg actually increased bone density
above eugonadal levels (Fig. 4G). This change in density was
accompanied by a change in breaking strength of the bone
that was well above eugonadal for all doses of LGD2226 (Fig.
4, H and I). Thus, this SARM not only increased the amount
of bone present but also significantly enhanced the strength
of that bone. One explanation for this activity is that the
compound may be enhancing the rate of bone formation in
the periosteum. Using histomorphometry on cortical bone
samples, we established that LGD2226 is capable of enhanc-
ing both the mineral apposition rate and the bone formation
rate in castrated animals. Neither the steroid fluoxymester-
one nor LGD2226 was able to fully maintain the rate of bone
formation compared with sham, suggesting other testes com-
ponents may also be important. This beneficial effect of an-
drogens on cortical bone is not a consequence of aromati-
zation to estrogen for two reasons: 1) estrogen in this model
is actually inhibitory to cortical bone formation and mineral
apposition rate (49) and 2) LGD2226 and fluoxymesterone
are both active on building bone and neither one is aroma-
tizable. Thus the benefits generated by these compounds are
due to the activation of the AR likely acting directly on
osteoblasts. Other well characterized antiresorptive agents
such as bisphosphonates (50) and estrogen are incapable of
this type of activity. Only true anabolic agents such as ste-
roidal androgens or PTH (51) build bone strength and mass
by enhancing the action of osteoblasts. These results dem-
onstrate that LGD2226 exhibits a highly beneficial profile on
bone, with both antiresorptive, and, significantly, anabolic
bone effects.
There are initial reports of nongenomic effects of andro-
gens on bone (36), which are hypothesized to play a role in
mediating the effects of androgens. We know that LGD2226
strongly activates and represses classical androgen-respon-
sive genes through genomic mechanisms, but we have no
data on the activity of LGD2226 on potential nongenomic
effects.
The role of androgens in libido and sexual function is well
established for both males and females (4). Declines in an-
drogen levels can affect multiple aspects of sexual activity in
patients. Supplemental topical androgens have provided
benefit in a number of clinical trials (52, 53), but their use is
confounded by prostate-related side effects in men and an-
drogenic side effects in women as well as skin irritation at the
site of application in both sexes.
LGD2226 was tested for activity in a sexual behavior
model in rats along with the nonaromatizable androgen flu-
oxymesterone as a positive control. In this model, the re-
sponse of male rats to the presence of a sexually receptive
female is examined. Castrated males were tested for their
receptiveness to females by monitoring behavioral re-
sponses. Dosing castrated animals (on a low-priming-dose
estrogen) with either fluoxymesterone or the SARM
LGD2226 resulted in an improvement in measures of both
performance and motivation, including mounts, intromis-
sions, ejaculations, and copulatory efficiency compared with
vehicle (Fig. 5).
Thus, LGD2226 is a highly active androgen, capable of
anabolic activity on both bone and muscle. In addition,
LGD2226 exhibits a safer profile on prostate growth and is
able to enhance sexual function and motivation. This bene-
ficial profile is likely the result of alterations in the confor-
mation of the LBD of the AR when it binds to LGD2226. This
compound is an orally available SARM, the prototype of a
series of molecules that may provide patients with additional
bone, muscle, and quality of life enhancement with fewer of
the side effects produced by current therapies.
Acknowledgments
We thank Robin Chedester for help with manuscript preparation and
Junlian Hu, Hong Sun, Boris Risek, William D. Hunter, Robert Hill, Joe
Higgins, Kelven Burnett, Denise Johnston, Lynn Cozby-Vomhof, Fe
Khalil, Aurora Bernal, and Glenda Evans for help in carrying out these
experiments. We thank Mehrnouch Motamedi and Neelakandha S. Mani
for help with the synthesis of LGD2226 and improvements therein. We
also thank Eric Vajda and Kay Klausing for helpful comments and
suggestions.
Received June 15, 2006. Accepted September 26, 2006.
Address all correspondence and requests for reprints to: Jeffrey N.
Miner, 10275 Science Center Drive, San Deigo, California 92121. E-mail:
jminer@ligand.com.
Current address for P.D.F.: Metabasis Therapeutics, Inc., La Jolla,
California 92037.
Current address for W.S.: Environmental Diseases and Medicine Pro-
gram, National Institute of Environmental Health Sciences, National
Institutes of Health, Research Triangle Park, North Carolina 27709.
Disclosure Statement: J.N.M., W.C., M.S.C., P.D.F., M.H.H., F.J.L.,
K.B.M., J.R., W.S., A.v.O., H.V., L.Z., and A.N.-V. are currently or were
previously employed by Ligand Pharmaceuticals. R.T. has nothing to
declare.
References
1. Gooren L 2003 Testosterone supplementation: why and for whom? Aging
Male 6:184 –199
2. Seidman SN, Klein DF 2004 AA2500 testosterone gel normalizes androgen
levels in aging males with improvements in body composition and sexual
function. J Clin Endocrinol Metab 89:63586359
3. Bhasin S, Storer TW, Asbel-Sethi N, Kilbourne A, Hays R, Sinha-Hikim I,
Shen R, Arver S, Beall G 1998 Effects of testosterone replacement with a
nongenital, transdermal system, Androderm, in human immunodeficiency
virus-infected men with low testosterone levels. J Clin Endocrinol Metab
83:3155–3162
4. Davis SR, Burger HG 2003 The role of androgen therapy. Best Pract Res Clin
Endocrinol Metab 17:165–175
5. Aversa A, Isidori AM, Spera G, Lenzi A, Fabbri A 2003 Androgens improve
cavernous vasodilation and response to sildenafil in patients with erectile
dysfunction. Clin Endocrinol (Oxf) 58:632– 638
6. Levine JP 2003 Long-term estrogen and hormone replacement therapy for the
prevention and treatment of osteoporosis. Curr Womens Health Rep 3:181–186
7. Grumbach MM 2000 Estrogen, bone, growth and sex: a sea change in con-
ventional wisdom. J Pediatr Endocrinol Metab 13(Suppl 6):1439 –1455
8. Wakley GK, Schutte Jr HD, Hannon KS, Turner RT 1991 Androgen treatment
prevents loss of cancellous bone in the orchidectomized rat. J Bone Miner Res
6:325–330
9. Sato T, Matsumoto T, Kawano H, Watanabe T, Uematsu Y, Sekine K, Fukuda
T, Aihara K, Krust A, Yamada T, Nakamichi Y, Yamamoto Y, Nakamura T,
Yoshimura K, Yoshizawa T, Metzger D, Chambon P, Kato S 2004 Brain
masculinization requires androgen receptor function. Proc Natl Acad Sci USA
101:1673–1678
10. Kawano H, Sato T, Yamada T, Matsumoto T, Sekine K, Watanabe T, Na-
372 Endocrinology, January 2007, 148(1):363–373 Miner et al. Anabolic SARM with Reduced Prostate Impact
kamura T, Fukuda T, Yoshimura K, Yoshizawa T, Aihara K, Yamamoto Y,
Nakamichi Y, Metzger D, Chambon P, Nakamura K, Kawaguchi H, Kato S
2003 Suppressive function of androgen receptor in bone resorption. Proc Natl
Acad Sci USA 100:9416 –9421
11. Chen F, Rodan GA, Schmidt A 2002 Development of selective androgen
receptor modulators and their therapeutic applications. Zhonghua Nan Ke Xue
8:162–168
12. Negro-Vilar A 1999 Selective androgen receptor modulators (SARMs): a novel
approach to androgen therapy for the new millennium. J Clin Endocrinol
Metab 84:3459 –34562
13. Yin D, Xu H, He Y, Kirkovsky LI, Miller DD, Dalton JT 2003 Pharmacology,
pharmacokinetics, and metabolism of acetothiolutamide, a novel nonsteroidal
agonist for the androgen receptor. J Pharmacol Exp Ther 304:1323–1333
14. Dalton JT, Mukherjee A, Zhu Z, Kirkovsky L, Miller DD 1998 Discovery of
nonsteroidal androgens. Biochem Biophys Res Commun 244:1– 4
15. Hanada K, Furuya K, Yamamoto N, Nejishima H, Ichikawa K, Nakamura T,
Miyakawa M, Amano S, Sumita Y, Oguro N 2003 Bone anabolic effects of
S-40503, a novel nonsteroidal selective androgen receptor modulator (SARM),
in rat models of osteoporosis. Biol Pharm Bull 26:1563–1569
16. Chen J, Hwang DJ, Chung K, Bohl CE, Fisher SJ, Miller DD, Dalton JT 2005
In vitro and in vivo structure-activity relationships of novel androgen receptor
ligands with multiple substituents in the B-ring. Endocrinology 146:5444–5454
17. Gao W, Reiser PJ, Coss CC, Phelps MA, Kearbey JD, Miller DD, Dalton JT
2005 Selective androgen receptor modulator treatment improves muscle
strength and body composition and prevents bone loss in orchidectomized
rats. Endocrinology 146:4887– 4897
18. Kim J, Wu D, Hwang DJ, Miller DD, Dalton JT 2005 The para substituent of
S-3-(phenoxy)-2-hydroxy-2-methyl-N-(4-nitro-3-trifluoromethyl-phenyl)-prop
ionamides is a major structural determinant of in vivo disposition and activity of
selective androgen receptor modulators. J Pharmacol Exp Ther 315:230 –239
19. Hamann LG, Higuchi RI, Zhi L, Edwards JP, Wang XN, Marschke KB, Kong
JW, Farmer LJ, Jones TK 1998 Synthesis and biological activity of a novel series
of nonsteroidal, peripherally selective androgen receptor antagonists derived
from 1,2-dihydropyridono[5,6-g]quinolines. J Med Chem 41:623–639
20. Furr BJ, Valcaccia B, Curry B, Woodburn JR, Chesterson G, Tucker H 1987
ICI 176,334: a novel non-steroidal, peripherally selective antiandrogen. J En-
docrinol 113:R7–R9
21. Gelmann EP 2002 Molecular biology of the androgen receptor. J Clin Oncol
20:3001–3015
22. He B, Wilson EM 2002 The NH
2
-terminal and carboxyl-terminal interaction
in the human androgen receptor. Mol Genet Metab 75:293–298
23. He B, Lee LW, Minges JT, Wilson EM 2002 Dependence of selective gene
activation on the androgen receptor NH2- and COOH-terminal interaction.
J Biol Chem 277:25631–25639
24. Schaufele F, Carbonell X, Guerbadot M, Borngraeber S, Chapman MS, Ma
AA, Miner JN, Diamond MI 2005 The structural basis of androgen receptor
activation: intramolecular and intermolecular amino-carboxy interactions.
Proc Natl Acad Sci USA 102:9802–9807
25. Gee AC, Carlson KE, Martini PG, Katzenellenbogen BS, Katzenellenbogen
JA 1999 Coactivator peptides have a differential stabilizing effect on the bind-
ing of estrogens and antiestrogens with the estrogen receptor. Mol Endocrinol
13:1912–1923
26. Takimoto GS, Graham JD, Jackson TA, Tung L, Powell RL, Horwitz LD,
Horwitz KB 1999 Tamoxifen resistant breast cancer: coregulators determine
the direction of transcription by antagonist-occupied steroid receptors. J Ste-
roid Biochem Mol Biol 69:45–50
27. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regu-
lation of the agonist/antagonist activity of the mixed antiestrogen, 4-hy-
droxytamoxifen. Mol Endocrinol 11:657– 666
28. Coghlan MJ, Jacobson PB, Lane B, Nakane M, Lin CW, Elmore SW, Kym PR,
Luly JR, Carter GW, Turner R, Tyree CM, Hu J, Elgort M, Rosen J, Miner JN
2003 A novel antiinflammatory maintains glucocorticoid efficacy with reduced
side effects. Mol Endocrinol 17:860 869
29. Vanderschueren D, Vandenput L 2000 Androgens and osteoporosis. Andro-
logia 32:125–130
30. Berger TS, Parandoosh Z, Perry BW, Stein RB 1992 Interaction of glucocor-
ticoid analogues with the human glucocorticoid receptor. J Steroid Biochem
Mol Biol 41:733–738
31. Chang CY, McDonnell DP 2002 Evaluation of ligand-dependent changes in
AR structure using peptide probes. Mol Endocrinol 16:647– 660
32. Turner RT, Hannon KS, Demers LM, Buchanan J, Bell NH 1989 Differential
effects of gonadal function on bone histomorphometry in male and female rats.
J Bone Miner Res 4:557–563
33. Baylink D, Stauffer M, Wergedal J, Rich C 1970 Formation, mineralization,
and resorption of bone in vitamin D-deficient rats. J Clin Invest 49:1122–1234
34. Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ,
Ott SM, Recker RR 1987 Bone histomorphometry: standardization of nomen-
clature, symbols, and units. Report of the ASBMR Histomorphometry No-
menclature Committee. J Bone Miner Res 2:595– 610
35. Mosekilde L, Danielsen CC, Gasser J 1994 The effect on vertebral bone mass
and strength of long term treatment with antiresorptive agents (estrogen and
calcitonin), human parathyroid hormone-(1–38), and combination therapy,
assessed in aged ovariectomized rats. Endocrinology 134:2126 –2134
36. Kousteni S, Chen JR, Bellido T, Han L, Ali AA, O’Brien CA, Plotkin L, Fu
Q, Mancino AT, Wen Y, Vertino AM, Powers CC, Stewart SA, Ebert R, Parfitt
AM, Weinstein RS, Jilka RL, Manolagas SC 2002 Reversal of bone loss in mice
by nongenotropic signaling of sex steroids. Science 298:843– 846
37. Larsson K, Sodersten P, Beyer C, Morali G, Perez-Palacios G 1976 Effects of
estrone, estradiol and estriol combined with dihydrotestosterone on mounting
and lordosis behavior in castrated male rats. Horm Behav 7:379–390
38. Baum MJ, Tobet SA, Starr MS, Bradshaw WG 1982 Implantation of dihy-
drotestosterone propionate into the lateral septum or medial amygdala facil-
itates copulation in castrated male rats given estradiol systemically. Horm
Behav 16:208 –223
39. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel
mouse protein that serves as a transcriptional coactivator in yeast for the
hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:
49484952
40. McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, O’Malley BW 1999 Nuclear
receptor coactivators: multiple enzymes, multiple complexes, multiple func-
tions. J Steroid Biochem Mol Biol 69:3–12
41. Fujimoto D, Moriguchi T, Ishida T, Hayashi H 1978 The structure of pyr-
idinoline, a collagen crosslink. Biochem Biophys Res Commun 84:52–57
42. Uebelhart D, Gineyts E, Chapuy MC, Delmas PD 1990 Urinary excretion of
pyridinium crosslinks: a new marker of bone resorption in metabolic bone
disease. Bone Miner 8:87–96
43. Seyedin SM, Kung VT, Daniloff YN, Hesley RP, Gomez B, Nielsen LA,
Rosen HN, Zuk RF 1993 Immunoassay for urinary pyridinoline: the new
marker of bone resorption. J Bone Miner Res 8:635– 641
44. Vanderschueren D, Jans I, van Herck E, Moermans K, Verhaeghe J, Bouillon
R 1994 Time-related increase of biochemical markers of bone turnover in
androgen-deficient male rats. Bone Miner 26:123–131
45. Prakasam G, Yeh JK, Chen MM, Castro-Magana M, Liang CT, Aloia JF 1999
Effects of growth hormone and testosterone on cortical bone formation and
bone density in aged orchiectomized rats. Bone 24:491– 497
46. Vazquez E 1998 Comparing Oxandrin and Anadrol-50. Posit Aware 9:49 –51
47. Orwoll ES 2001 Androgens: basic biology and clinical implication. Calcif
Tissue Int 69:185–188
48. Coxam V, Bowman BM, Mecham M, Roth CM, Miller MA, Miller SC 1996
Effects of dihydrotestosterone alone and combined with estrogen on bone
mineral density, bone growth, and formation rates in ovariectomized rats.
Bone 19:107–114
49. Turner RT, Wakley GK, Hannon KS 1990 Differential effects of androgens on
cortical bone histomorphometry in gonadectomized male and female rats.
J Orthop Res 8:612– 617
50. Cohen SB 2004 An update on bisphosphonates. Curr Rheumatol Rep 6:5965
51. Madore GR, Sherman PJ, Lane JM 2004 Parathyroid hormone. J Am Acad
Orthop Surg 12:67–71
52. McNicholas TA, Dean JD, Mulder H, Carnegie C, Jones NA 2003 A novel
testosterone gel formulation normalizes androgen levels in hypogonadal men,
with improvements in body composition and sexual function. BJU Int 91:69 –74
53. Wang C, Swedloff RS, Iranmanesh A, Dobs A, Snyder PJ, Cunningham G,
Matsumoto AM, Weber T, Berman N 2000 Transdermal testosterone gel
improves sexual function, mood, muscle strength, and body composition
parameters in hypogonadal men. Testosterone Gel Study Group. J Clin En-
docrinol Metab 85:2839 –2853
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.
Miner et al. Anabolic SARM with Reduced Prostate Impact Endocrinology, January 2007, 148(1):363–373 373
... SARMs have been studied in the treatment of male hypogonadism and their use is being investigated in clinical trials (6,60). Miner et al. (2007), in a rat model of sexual behavior, showed that SARMs can lead to increased sexual function. In this model treatment of male rats with 100 mg/kg of a synthetic SARM, LGD226, increased number of mounts, intromissions, and ejaculation (61). ...
... Miner et al. (2007), in a rat model of sexual behavior, showed that SARMs can lead to increased sexual function. In this model treatment of male rats with 100 mg/kg of a synthetic SARM, LGD226, increased number of mounts, intromissions, and ejaculation (61). Jones et al. demonstrated that administration of S-23 with estradiol benzoate in male rats led to inhibition in spermatogenesis and the suppression of FSH and LH levels. ...
Article
Testosterone replacement therapy is an important treatment option for men with low testosterone and symptomatic hypogonadism. Various formulations of exogenous testosterone replacement therapy exist, including oral, buccal, intramuscular, transdermal, subdermal, and nasal preparations. However, exogenous testosterone replacement therapy is a double-edged sword, posing risks to fertility due to negative feedback mechanisms on the hypothalamic-pituitary-gonadal (HPG) axis, which is the main regulator of testosterone production and spermatogenesis in males. Alternative pharmacologic therapies are being used to increase endogenous testosterone levels while attempting to preserve fertility and function of the HPG axis. These include selective estrogen receptor modulators, gonadotropins, and aromatase inhibitors. This review focuses on overviewing and comparing the currently available methods of exogenous testosterone replacement therapy, alternative treatments to increasing endogenous testosterone, and novel treatments that are currently under investigation to normalize testosterone levels while preserving the function of the HPG axis. In conclusion, reports suggest that, though Testosterone replacement therapy is an important way to restore testosterone levels and reduce symptoms associated with low testosterone, it is often difficult to decide which treatment to select for patients with testosterone deficiency. Several factors need to be considered to decide on optimal therapy option for the patient which include but are not limited to safety, efficacy, cost-effectiveness, dosing flexibility, and side effects. Alternative approaches which aim to improve endogenous testosterone production and preserve fertility are promising but still are at their initial stages of development. Ultimately, patient-centered decision making is paramount to appropriate treatment selection.
... The effects of highly selective drugs have been analyzed in several preclinical studies (72)(73)(74)(75). Among them, one study demonstrated increased gastrocnemius muscle weight, bone biomechanical properties, and bone mineral density in ovariectomized female rats that were administered SARMs (72). ...
Article
Full-text available
Sarcopenia, characterized by the excessive loss of skeletal muscle mass, strength, and function, is associated with the overall poor muscle performance status of the elderly, and occurs more frequently in those with chronic diseases. The causes of sarcopenia are multifactorial due to the inherent relationship between muscles and molecular mechanisms, such as mitochondrial function, inflammatory pathways, and circulating hormones. Age-related changes in sex steroid hormone concentrations, including testosterone, estrogen, progesterone, and their precursors and derivatives, are an important aspect of the pathogenesis of sarcopenia. In this review, we provide an understanding of the treatment of sarcopenia through the regulation of sex steroid hormones. The potential benefits and future research emphasis of each sex steroid hormone therapeutic intervention (testosterone, SARMs, estrogen, SERMs, DHEA, and progesterone) for sarcopenia are discussed. Enhanced understanding of the role of sex steroid hormones in the treatment for sarcopenia could lead to the development of hormone therapeutic approaches in combination with specific exercise and nutrition regimens.
... Regardless of structural similarity, steroid hormones mediate a variety of physiological functions in humans [5][6][7][8][9]. In the steroid hormones, their 1 H spectra are actually quite different from one another. ...
Article
Full-text available
For decades, high-resolution 1H NMR spectroscopy has been routinely utilized to analyze both naturally occurring steroid hormones and synthetic steroids, which play important roles in regulating physiological functions in humans. Because the 1H signals are inevitably superimposed and entangled with various JH-H splitting patterns, such that the individual 1H chemical shift and associated JH-H coupling identities are hardly resolved. Given this, applications of thess information for elucidating steroidal molecular structures and steroid/ligand interactions at the atomic level were largely restricted. To overcome, we devoted to unraveling the entangled JH-H splitting patterns of two similar steroidal compounds having fully unsaturated protons, i.e., androstanolone and epiandrosterone (denoted as 1 and 2, respectively), in which only hydroxyl and ketone substituents attached to C3 and C17 were interchanged. Here we demonstrated that the JH-H values deduced from 1 and 2 are universal and applicable to other steroids, such as testosterone, 3β, 21-dihydroxygregna-5-en-20-one, prednisolone, and estradiol. On the other hand, the 1H chemical shifts may deviate substantially from sample to sample. In this communication, we propose a simple but novel scheme for resolving the complicate JH-H splitting patterns and 1H chemical shifts, aiming for steroidal structure determinations.
... In a model of gonadectomized mice, increases in the weight of levator ani muscle (a skeletal muscle with a high density of AR) and gastrocnemius muscle have been reported to occur in a dosedependent manner with the administration of LGD-3303 [51,52]. Another compound, LGD-2226, has shown similar results in muscle cells, but also in prostatic tissue associated with enhanced sexual function and motivation in a preclinical model [53]. Moreover, inguinal fat has been shown to decrease with LGD-3303, while bone mineral density, femur bending load and lumbar spine compression load were increased in female rats. ...
Article
Full-text available
Introduction Skeletal muscle wasting is a frequent clinical problem encountered in patients with chronic diseases. Its development seems to share a common pathway, characterized by increased levels of inflammatory markers, an imbalance between muscle protein synthesis and degradation, and atrophy from disuse. Although testosterone has long been proposed as a treatment for patients with muscle wasting, undesirable side effects have raised concerns about prostatic hypertrophy in men as well as virilization in women. Selective androgen receptor modulators (SARMs) have demonstrated similar results like testosterone at improving lean body mass (LBM) with less side effects on androgen-dependent tissue. Areas covered This review outlines the ongoing clinical development in the field of SARMs and their effectiveness in improving body composition and physical function. The included articles were collected at pubmed.gov and analyzed integrally. Expert opinion There is an unmet clinical need for safe and effective anabolic compounds such as SARMs. Despite the effect on LBM shown by SARMs in phase II clinical trials, results on improved physical function and muscle strength are still lacking and long-term outcomes have to be assessed in these patients. Moreover, there is a need to determine the effect of resistance exercise training and protein intake associated with SARMs in the treatment of patients with muscle wasting.
... While the sexual benefits of TTh are well established, unlike exogenous testosterone, SARMs are orally active, nonaromatizable, non-virilizing, and tissueselective, with a better side effect profile than TTh (66). Previous studies have demonstrated the potential benefit of SARMs for libido in both female and male rats (67,68). In one study, treatment of male rats with the SARM LGD2226 resulted in an increased number of mounts, intromissions, and ejaculations compared with a control group (68). ...
Article
Selective androgen receptor modulators (SARMs) are small molecule drugs that function as either androgen receptor (AR) agonists or antagonists. Variability in AR regulatory proteins in target tissues permits SARMs to selectively elicit anabolic benefits while eschewing the pitfalls of traditional androgen therapy. SARMs have few side effects and excellent oral and transdermal bioavailability and may, therefore, represent viable alternatives to current androgen therapies. SARMs have been studied as possible therapies for many conditions, including osteoporosis, Alzheimer's disease, breast cancer, stress urinary incontinence (SUI), prostate cancer (PCa), benign prostatic hyperplasia (BPH), male contraception, hypogonadism, Duchenne muscular dystrophy (DMD), and sarcopenia/muscle wasting/cancer cachexia. While there are no indications for SARMs currently approved by the Food and Drug Administration (FDA), many potential applications are still being explored, and results are promising. In this review, we examine the literature assessing the use of SARMS for a number of indications.
... e modern era started with the synthesis on nonsteroidal SARMs [40,42,[48][49][50][51]. e first generation of ligands was obtained by structural modifications of arylpropionamide analogs, bicalutamide, and hydroxyflutamide. ...
Article
Full-text available
Hypogonadotropic hypogonadism (HH) can be sustained by organic or functional alterations of the hypothalamic-pituitary-testicular axis. Functional HH is related to systemic alterations, such as obesity or chronic inflammatory diseases, but could contribute to a negative course of the illness. For such situation, according to results obtained in infertile women, the administration of selective estrogen receptor modulators (SERMs) has been proposed in males too, with positive results on both metabolic and sexual function. This class of medications increases gonadotropin levels via antagonism to the estrogenic receptor; similar biological effects are also exerted by aromatase inhibitors (AIs), despite different mechanism of action. After a brief review of trials regarding SERMs and AIs use in male HH, we describe the structure and function of the androgen receptor (AR) as a basis for clinical research about compounds able to bind to AR, in order to obtain specific effects (SARMs). The tissue selectivity and different metabolic fate in comparison to testosterone can potentiate anabolic versus androgenic effects; therefore, they might be a valid alternative to testosterone replacement therapy avoiding the negative effects of testosterone (i.e., on prostate, liver, and hematopoiesis). Trials are still at an early phase of investigation and, at the moment, the application seems to be more useful for chronic disease with catabolic status while the validation as replacement for hypogonadism requires further studies.
Chapter
Supraphysiologic use of exogenous hormone replacement is allowing users to greatly increase muscle strength and athletic performance in the context of an overall world decline in fitness. In part due to societal pressures, more individuals are taking exogenous testosterone for performance enhancement and pursuit of an idealized physique. This chapter primarily focuses on the illicit use of synthetic testosterone as a performance enhancer. We discuss the history and evolution of anabolic androgenic steroids (AAS) in the last few decades and review current literature on the side effect profile of supraphysiologic use of AAS.
Chapter
Male gender is a protective factor against the development of osteoporosis but men face a higher refracture risk, higher mortality risk, and a higher treatment gap. Consequently, men contribute considerably to the disease burden of osteoporosis. This chapter aims to review recent advances in our understanding of the epidemiology of male osteoporosis, the reasons why osteoporosis and fractures are less common in men, how sex steroids (androgens and estrogens) and other factors regulate male bone metabolism and contribute to skeletal sexual dimorphism, as well as the diagnosis and treatment of male osteoporosis. We focus on similarities and differences in men versus women. Our work aims to contribute to the understanding of male osteoporosis as a condition that is much more similar than different from osteoporosis in postmenopausal women.
Article
Full-text available
The history of the appearance and development of selective androgen receptor modulators (SARMs) is described. The main classes of SARMs and various approaches to their determination are considered. The use of chromatography-mass spectrometry is shown to be promising for the reliable determination of SARM traces in various samples. Well-known sample preparation and determination methods in biological materials are considered, and the metabolic pathways the best studied SARM (andarine) using cell cultures (in vitro) and laboratory animals and humans (in vivo) are compared.
Chapter
Humans who have travelled in space have used medications to ease adaptation to their new environment (like anti-nausea medications) and to prevent adaptations that could prove deleterious to their long-term well-being (e.g., anti-resorptives to maintain bone mineral density). They have also treated the ordinary illnesses that humans experience and made certain that they have medication stocks available for the treatment of medical emergencies. A medical system for any space flight will be heavily reliant on medications, since surgical treatment options may not be feasible during a mission. For exploration missions, duration is a critical consideration. Longer journey length means increased likelihood of medical events occurring, which increase the supplies required; this must be balanced against the mass and volume limits inherent in a vehicle of limited size. Stability during storage is a crucial consideration for missions longer than 1 year. More research is required to understand the degradation of pharmaceutical products over time, with special attention to minimizing harmful degradation and determining how older products might be used safely. New manufacturing methods like 3D printing or expression by bioengineered microorganisms might 1 day enable crewmembers to produce fresh new supplies during the course of their mission, but there is much research and testing required to ensure safety and efficacy of the finished products.
Article
The concept of a female androgen insufficiency syndrome, although not new, remains somewhat controversial. Androgens are quantitatively the predominant sex steroid in women, circulating in the micromolar and nanomolar concentration range, compared with picomolar levels of oestrogens. The most significant biologically active androgen is testosterone (T), which circulates bound tightly to sex-hormone-binding globulin (SHBG) and loosely to albumin. It is generally held that the non-SHBG-bound fraction is the bioavailable moiety. Hence, clinically useful T measurements require data on total concentrations as well as SHBG level. Testosterone insufficiency occurs in a number of circumstances, including hypopituitarism, premature ovarian failure, adrenal failure, exogenous corticosteroid use and oral oestrogen therapy (causing elevation of SHBG and suppression of gonadotrophins). Clinical symptoms of androgen insufficiency include loss of libido, diminished well-being, fatigue and blunted motivation and have been reported to respond well to T replacement, generally without significant side-effects.
Article
A new nonsteroidal antiandrogenic pharmacophore has been discovered using cell-based cotransfection assays with human androgen receptor (hAR). This series of AR antagonists is structurally characterized by a linear tricyclic 1,2-dihydropyridono[5,6-g]quinoline core. Analogues inhibit AR-mediated reporter gene expression and bind to AR as potently as or better than any known AR antagonists. Several analogues also showed excellent in vivo activity in classic rodent models of AR antagonism, inhibiting growth of rat ventral prostate and seminal vesicles, without accompanying increases in serum gonadotropin and testosterone levels, as is seen with other AR antagonists. Investigations of structure-activity relationships surrounding this pharmacophore resulted in molecules with complete specificity for AR, antagonist activity on an AR mutant commonly observed in prostate cancer patients, and improved in vivo efficacy. Molecules based on this series of compounds have the potential to provide unique and effective clinical opportunities for treatment of prostate cancer and other androgen-dependent diseases.
Article
A new nonsteroidal antiandrogenic pharmacophore has been discovered using cell-based cotransfection assays with human androgen receptor (hAR). This series of AR antagonists is structurally characterized by a linear tricyclic 1,2-dihydropyridono[5,6-g]quinoline core. Analogues inhibit AR-mediated reporter gene expression and bind to AR as potently as or better than any known AR antagonists. Several analogues also showed excellent in vivo activity in classic rodent models of AR antagonism, inhibiting growth of rat ventral prostate and seminal vesicles, without accompanying increases in serum gonadotropin and testosterone levels, as is seen with other AR antagonists. Investigations of structure−activity relationships surrounding this pharmacophore resulted in molecules with complete specificity for AR, antagonist activity on an AR mutant commonly observed in prostate cancer patients, and improved in vivo efficacy. Molecules based on this series of compounds have the potential to provide unique and effective clinical opportunities for treatment of prostate cancer and other androgen-dependent diseases.
Article
The effects of castration on bone histomorphometry and mineral homeostasis were compared in male and female rats. Measurements were performed 4 weeks after sham operation or gonadectomy. Orchiectomy produced increases in serum calcium and decreases in serum testosterone and androstenedione, whereas ovariectomy produced decreases in serum estradiol and testosterone. Orchiectomy did not alter static bone histomorphometric measurements of the tibial diaphysis, whereas ovariectomy increased cross-sectional and medullary areas, lowered endosteal tetracycline-labeled surface length, and markedly increased endosteal nonlabeled surface length. Orchiectomy decreased mean periosteal bone formation rate and mean periosteal bone apposition rate, whereas ovariectomy increased both measurements. Orchiectomy and ovariectomy markedly diminished trabecular area and trabecular surface length at the tibial metaphysis. Orchiectomy did not alter the number of osteoclasts per mm trabecular surface or the percentage of trabecular surface covered by osteoclasts, whereas ovariectomy increased both measurements. These findings indicate that gonadal hormones produce separate and distinct effects on bone metabolism as determined by histomorphometry in male and female rats.
Article
Pyridinoline is an amino acid isolated from collagen and probably serves as a crosslink in collagen fiber. This compound was isolated on a large scale from bovine bone and investigated by 1H-nmr and 13C-nmr spectroscopy, mass spectroscopy and chemical degradation. The structure is proposed on the basis of these data.
Article
Nonsteroidal androgens have not been reported. During studies to identify affinity ligands for the androgen receptor in our laboratory, we synthesized several electrophilic nonsteroidal ligands for the androgen receptor and examined their receptor binding affinity and ability to stimulate receptor-mediated transcriptional activation. We found that three of these ligands (1) bound the androgen receptor with affinity similar to that of dihydrotestosterone (the endogenous ligand) and (2) mimicked the effects of dihydrotestosterone on receptor-mediated transcriptional activation (i.e., they were receptor agonists). These studies demonstrate that nonsteroidal ligands can be structurally modified to produce agonist activity. These ligands thus represent the first members of a novel class of androgens with potential therapeutic applications in male fertility and hormone replacement therapy.
Article
Nuclear receptors are ligand-inducible transcription factors which mediate the physiological effects of steroid, thyroid and retinoid hormones. By regulating the assembly of a transcriptional preinitiation complex at the promoter of target genes, they enhance the expression of these genes in response to hormone. Recent evidence suggests that nuclear receptors act in part by recruiting multiple coregulator proteins which may have specific functions during transcriptional initiation. Liganded receptors recruit members of the SRC family, a group of structurally and functionally related transcriptional coactivators. Receptors also interact with the transcriptional cointegrators p300 and CBP, which are proposed to integrate diverse afferent signals at hormone-regulated promoters. p300/CBP and members of the SRC coactivator family have intrinsic histone acetyltransferase activity which is believed to disrupt the nucleosomal structure at these promoters. Other nuclear receptor coactivators include a member of the SWI/SNF complex, BRG-1, which couples ATP hydrolysis to chromatin remodelling, and the E3 ubiquitin-protein ligases E6-AP and RPF-1. Finally, nuclear receptor coactivators appear to be organized into preformed subcomplexes, an arrangement that may facilitate their efficient assembly into diverse higher order configurations.
Article
Prepuberally castrated male rats were injected with estrone (1 or 5 μg), estradiol (1 or 5 μg) or estriol (1, 5, or 25 μg) either alone or in combination with dihydrotestosterone, (0.5 mg). Each of these steroids, when given alone, had no or only weak stimulatory effects on male sexual behavior. When combined with dihydrotestosterone all estrogens stimulated full copulatory behavior, the order of potency being estradiol, estrone, and estriol. Lordosis behavior in response to male mounting or manual stimulation was facilitated by all estrogens. All estrogens caused a slight weight increase of the seminal vesicles, ventral prostate and glans penis.
Article
Transient co-transfection of receptor cDNA and suitable reporter genes was used to study human glucocorticoid receptor (hGR) function in a neutral mammalian cell background. A variety of natural and synthetic steroids were analyzed for their ability to activate gene expression through the hGR and to bind to extracts of cells expressing the hGR cDNA. There was very good correlation between these two in vitro parameters for these compounds. Furthermore, correlation of these data with reported in vivo anti-inflammatory potencies was surprisingly close, with two exceptions. The in vitro data suggest an explanation for the discrepant compounds, consistent with published data on their metabolic fate in vivo. The co-transfection assay has utility as a quantitative predictor of in vivo glucocorticoid pharmacology.
Article
This report describes histomorphometric evidence for an important role of androgens in maintaining cancellous bone balance at a remodeling site in vivo. Rats were orchiectomized (ORX) at 7 weeks of age and received either androgens or vehicle 1 week later (testosterone, 1-dehydrotestosterone, or 5-dihydrotestosterone) by subcutaneous pellet, producing controlled release of the drug for 3 weeks. Intact male rats and untreated ORX animals served as controls. After 4 weeks untreated ORX resulted in undetectable serum testosterone levels and marked atrophy of seminal vesicles compared with intact controls. Histomorphometry revealed severe cancellous osteopenia in the secondary spongiosa of the proximal tibial metaphysis. The length of bone surface lined by apparently "active" osteoblasts and number of osteoclasts per length of cancellous bone surface were increased following ORX. Testosterone treatment at 5 mg (per 21 days) produced subphysiologic serum testosterone levels. In contrast, 10 and 25 mg pellets resulted in serum testosterone ORX, and the degree of protection was dose dependent. 1-Dehydro- and 5-dihydrotestosterones displayed a bone-protective effect similar to that of testosterone. The results demonstrate that gonadal insufficiency results in a cancellous osteopenia that is preventable by testosterone treatment. Further, because a similar protective action was achieved using the nonaromatizable androgen 5-dihydrostestosterone, the results suggest that this bone-sparing effect is mediated by androgen rather than by metabolism of the androgen to an estrogen.