Article

A critical role for FBXW8 and MAPK in cyclin D1 degradation and cancer cell proliferation. PLoS ONE 1, e128

Department of Pathology, School of Medicine, University of California San Francisco, San Francisco, California, United States of America
PLoS ONE (Impact Factor: 3.23). 02/2006; 1(1):e128. DOI: 10.1371/journal.pone.0000128
Source: PubMed

ABSTRACT

Cyclin D1 regulates G1 progression. Its transcriptional regulation is well understood. However, the mechanism underlying cyclin D1 ubiquitination and its subsequent degradation is not yet clear. We report that cyclin D1 undergoes increased degradation in the cytoplasm during S phase in a variety of cancer cells. This is mediated by phosphorylation at Thr286 through the activity of the Ras/Raf/MEK/ERK cascade and the F-box protein FBXW8, which is an E3 ligase. The majority of FBXW8 is expressed in the cytoplasm during G1 and S phase. In contrast, cyclin D1 accumulates in the nucleus during G1 phase and exits into the cytoplasm in S phase. Increased cyclin D1 degradation is linked to association with FBXW8 in the cytoplasm, and enhanced phosphorylation of cyclin D1 through sustained ERK1/2 signaling. Depletion of FBXW8 caused a significant accumulation of cyclin D1, as well as sequestration of CDK1 in the cytoplasm. This resulted in a severe reduction of cell proliferation. These effects could be rescued by constitutive nuclear expression of cyclin D1-T286A. Thus, FBXW8 plays an essential role in cancer cell proliferation through proteolysis of cyclin D1. It may present new opportunities to develop therapies targeting destruction of cyclin D1 or its regulator E3 ligase selectively.

Full-text

Available from: Hiroshi Okabe, Nov 04, 2014
A Critical Role for FBXW8 and MAPK in Cyclin D1
Degradation and Cancer Cell Proliferation
Hiroshi Okabe
1,3
, Sang-Hyun Lee
2,3
, Janyaporn Phuchareon
1,3
, Donna G. Albertson
2,3
, Frank McCormick
2,3
, Osamu Tetsu
1,3
*
1 Department of Pathology, School of Medicine, University of California San Francisco, San Francisco, California, United States of America, 2 Cancer
Research Institute, School of Medicine, University of California San Francisco, San Francisco, California, United States of America, 3 UCSF
Comprehensive Cancer Center, School of Medicine, University of California San Francisco, San Francisco, California, United States of America
Cyclin D1 regulates G1 progression. Its transcriptional regulation is well understood. However, the mechanism underlying
cyclin D1 ubiquitination and its subsequent degradation is not yet clear. We report that cyclin D1 undergoes increased
degradation in the cytoplasm during S phase in a variety of cancer cells. This is mediated by phosphorylation at Thr286
through the activity of the Ras/Raf/MEK/ERK cascade and the F-box protein FBXW8, which is an E3 ligase. The majority of
FBXW8 is expressed in the cytoplasm during G1 and S phase. In contrast, cyclin D1 accumulates in the nucleus during G1 phase
and exits into the cytoplasm in S phase. Increased cyclin D1 degradation is linked to association with FBXW8 in the cytoplasm,
and enhanced phosphorylation of cyclin D1 through sustained ERK1/2 signaling. Depletion of FBXW8 caused a significant
accumulation of cyclin D1, as well as sequestration of CDK1 in the cytoplasm. This resulted in a severe reduction of cell
proliferation. These effects could be rescued by constitutive nuclear expression of cyclin D1-T286A. Thus, FBXW8 plays an
essential role in cancer cell proliferation through proteolysis of cyclin D1. It may present new opportunities to develop
therapies targeting destruction of cyclin D1 or its regulator E3 ligase selectively.
Citation: Okabe H, Lee S-H, Phuchareon J, Albertson DG, McCormick F, et al (2006) A Critical Role for FBXW8 and MAPK in Cyclin D1 Degradation and
Cancer Cell Proliferation. PLoS ONE 1(1): e128. doi:10.1371/journal.pone.0000128
INTRODUCTION
Cyclin D1 regulates G1 progression in cancer cells and is
overexpressed in various malignant neoplasms [1]. As a result, it
is a potential target for cancer therapeutics [2]. Transcriptional
regulation of cyclin D1 has been extensively studied and is well
understood [3–5]. It is stimulated when, for example, various
mitogenic signals activate the Ras/Raf/MEK/ERK (MAPK)
cascade. After synthesis following MAPK cascade activation,
cyclin D1 associates with CDK4/6, p21 Cip1 or p27 Kip1 [6,7].
In contrast, the mechanism of cyclin D1 ubiquitination and
subsequent degradation has not been fully characterized. It is
known that cyclin D1 is polyubiquitinated and subsequently
degraded through the 26S proteasome pathway. This process
requires phosphorylating cyclin D1 at threonine (Thr)-286, which
is located near its C terminus [8]. The cyclin D1 mutant T286A is
resistant to ubiquitination in vitro and in vivo and is a highly stable
protein. Glycogen synthase kinase-3b (GSK3b) can phosphorylate
cyclin D1 at Thr286, promoting nuclear-to-cytoplasmic redistri-
bution of cyclin D1 [9,10]. However, the role of GSK3b in cyclin
D1 phosphorylation and its stability have been questioned recently
[11,12], and p38 SAPK2 has been implicated in proteasomal
degradation of cyclin D1 following osmotic shock [13].
We attempted to identify the kinase responsible for phosphory-
lating cyclin D1 at Thr286. Our work shows that cyclin D1 is destab-
ilized specifically during S phase in cancer cells and that increased
degradation is mediated by phosphorylation at Thr286 through the
activity of the Ras/Raf/MEK/MAPK signaling cascade.
The ubiquitin-protein ligase necessary for degrading cyclin D1
has not yet been identified. An F-box protein, SKP2, has been
proposed [14,15]. However, SKP2-mediated regulation of cyclin
D1 may be context- or cell line dependent, and may be indirect
[7]. Furthermore, cyclin D1 does not accumulate in SKP2
knockout mouse embryonic fibroblast (MEF) cells [16,17].
The formation of polyubiquitin-protein conjugates is well-
understood [18]. Three components participate in sequential
ubiquitin transfer reactions: E1, an activating enzyme, E2/Ubc,
a ubiquitin-conjugating enzyme, and E3, a protein ligase, which
attaches ubiquitin to a lysine residue on a target protein.
The best characterized of these enzymes are the SCF E3
ubiquitin ligases, which regulate substrate ubiquitination in
a phosphorylation-dependent manner [19–21]. These ligases form
a highly diverse family of complexes named for their components,
S-phase Kinase-associated Protein 1 (SKP1), Cullin 1 (CUL1/
Cdc53),
F-box proteins, and RBX1/ROC1. SKP1 is a crucial
adaptor subunit and selectively interacts with a scaffold protein,
either CUL1 or Cullin 7 (CUL7), to promote the ubiquitination of
targeted substrates [22,23]. Association of CUL7 with SKP1
depends on FBXW8 and forms a specific SCF-like complex
[22,23]. Our study demonstrates that the F-box protein FBXW8
specifically recognizes the cyclin D1 in a phosphorylation-de-
pendent manner and regulates its stability through the ubiquitin-
proteasome pathway.
RESULTS
Cyclin D1 protein is destabilized specifically in S
phase in cancer cells
To investigate the mechanism and importance of cyclin D1
proteolysis, we first assessed the expression profile of cyclin D1
during cell cycle progression from quiescence in three normal cell
Academic Editor: Dong-Yan Jin, Department of Biochemistry, China
Received November 7, 2006; Accepted November 23, 2006; Published December
27, 2006
Copyright: ß 2006 Okabe et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the
original author and source are credited.
Funding: This work was supported by grants from the American Cancer Society,
the Concern Foundation, the Daiichi Pharmaceuticals, the UCSF Research-
Evaluation Allocation Committee, and the V Foundation to O.T., the National
Institutes of Health (R01 CA101359) to D.G.A., and the Wood Foundation to F.M.
Competing Interests: The authors have declared that no competing interests
exist.
* To whom correspondence should be addressed. E-mail: tetsu@cc.ucsf.edu
PLoS ONE | www.plosone.org 1 December 2006 | Issue 1 | e128
Page 1
lines (NIH 3T3 & WI-38 fibroblasts, and CCD841 CoN colon
epithelium cells) and in three cancer cell lines (HCT 116 and
SW480 colon cancers and T98G glioblastomas). Normal cells
(Fig. 1A and Fig. S1 [A]) and cancer cells (Fig. 1B and Fig. S1 [B])
were released from quiescence at G0/G1 phase and cell cycle
profiles were determined by flow-cytometric cell cycle analyses. In
both cell types, cyclin D1 expression gradually increased after
re-entry into the cell cycle and reached a maximum at the G1-S
transition. In all three normal cell lines, cyclin D1 levels remained
constant during S phase (Fig. 1A and Fig. S1 [A]), although we
observed a slight decrease in cyclin D1 expression after entry into
S phase. This finding is consistent with previous observations
[24,25]. In contrast, all three cancer cell lines showed a dramatic
reduction of cyclin D1 expression during S phase (Fig. 1B and Fig.
S1 [B]). These observations suggest that cyclin D1 turnover is
increased during S phase in these cells.
To confirm this observation, NIH 3T3 mouse fibroblast and
HCT 116 colon cancer cells were synchronized at the G0/G1
phase and released from quiescence and subjected to pulse-chase
analysis. Figs. 1C and D show pulse-chase analyses on
35
S
metabolically labeled cyclin D1 at 9 hrs (NIH 3T3) or 6 hrs (HCT
116), when most of the cells were in G1 phase, and at 21 hrs (NIH
3T3) and 15 hrs (HCT 116) when most were in S phase (Figs. 1C
and D, bottom tables). Labeled cyclin D1 levels of were estimated
by quantitative scanning (Figs. 1C and D). There was no
significant difference in the half-life of cyclin D1 during G1 and
S phases in the NIH 3T3 cells. In contrast, there was a significant
difference in the HCT 116 cells (S phase T
1/2
= 11.8 min,
compared to T
1/2
= 27.5 min in G1 phase). Thus, cyclin D1 is
destabilized specifically in S phase in HCT 116 cells.
Cyclin D1 is degraded in the cytoplasm during S
phase through the ubiquitin-proteasome pathway
in cancer cells
We next determined if cyclin D1 destabilization during S phase
was due to increased proteolysis through the ubiquitin-proteasome
pathway. We treated HCT 116 and NIH 3T3 cells with MG132,
a proteasome inhibitor, for 2 hrs prior to harvesting at each time
point during cell cycle progression (Fig. 1E). In treated HCT 116
cells, cyclin D1 accumulated significantly in S phase, with no
significant accumulation during G1 phase. In contrast, the
difference in accumulated cyclin D1 between G1 and S phase in
NIH 3T3 cells appeared to be much smaller. These findings
suggest that, in these cancer cells, cyclin D1 is destabilized during
S phase through the 26S proteasome pathway.
Figures 1F–H confirm that destabilization of cyclin D1 involves
polyubiquitination. In Fig. 1F, HCT 116 cells were transfected
with (lanes 1–3) or without (lane 4) HA-tagged ubiquitin cDNA
and then synchronized to S phase. Cells were treated with MG132
(lanes 3 and 4) or without it (lanes 1 and 2) for an hour. Lysates
were immunoprecipitated with a cyclin D1 antibody (lanes 2–4) or
control IgG (lane 1) and immunoblotted with a HA antibody. A
group of slower migrating bands was detected by the HA antibody
exclusively in the anti-cyclin D1 immunoprecipitates in the
presence of ubiquitin (lanes 2 and 3) and the reduced mobility
bands were enhanced further after exposure to MG132 (lane 3),
indicating that these bands included polyubiquitinated cyclin D1.
These observations confirmed that cyclin D1 is degraded during S
phase through the ubiquitin-proteasome pathway in HCT 116
cells. Fig. 1H shows that more than 70% of these cells were in S
phase.
To identify where cyclin D1 degradation is increased during S
phase, we extracted nuclear (N) and cytoplasmic (C) protein from
cell lysates collected in Fig. 1F lane 3 (Fig. 1G). Histone H1 was
exclusively detected in the nuclear fraction, whereas MEK1 was
totally expressed in the cytoplasmic extract, suggesting that we
successfully fractionated cell lysates (Fig. S1 [C]). The majority of
cyclin D1 was localized in the cytoplasm (Fig. S1 [C]). Nuclear and
cytoplasmic extracts were immunoprecipitated with antibodies to
cyclin D1 (Fig 1G, lanes 1 and 2) or IgG (lane 3) and immuno-
blotted with a HA antibody. Polyubiquitinated cyclin D1 bands
were predominantly detected in the cytoplasmic extracts. Further-
more, inhibition of nuclear-to-cytoplasmic localization of cyclin
D1 with Leptomycin B (LMB) did not enhance these bands
significantly in the nucleus (Fig. S1 [D]). We conclude that cyclin
D1 is degraded in the cytoplasm specifically in S phase by
a proteasome-dependent mechanism in HCT 116 cells.
MAPK interacts with cyclin D1 through a D-domain
and phosphorylates Thr286
MAPK activity is elevated in all three cancer cell lines examined
(data not shown; [ref.4]). We investigated the possibility that the
Ras/Raf/MEK/ERK MAPK signaling cascade might regulate
the phosphorylation of cyclin D1 residue Thr286, which is
followed by proline (Fig. 2A; [refs. 8, 9]).
ERK/MAPK is a proline (Pro)-directed protein kinase [26]. It
requires a kinase docking site (or D-domain) on its substrate to
increase phosphorylation efficiency (Fig. 2A; [ref. 27]). D-domains
have been found in various ERK substrates, such as Elk-1, Sap-1,
Sap-2, Ets-1 and c-Myc (Fig. 2A; [refs. 27, 28]). We searched for
a D-domain on cyclin D1 with Motif Scan software (http://
scansite.mit.edu). Through a series of stringent searches, we
identified a highly significant (within 0.041 percentile) D-domain
in amino acids 179-193 (Fig. 2A), suggesting that the Ras/Raf/
MEK/ERK MAPK signaling cascade might be responsible for
cyclin D1 phosphorylation.
To test the possibility that purified ERK/MAPK might
phosphorylate recombinant cyclin D1, purified ERK2 was surely
used to phosphorylate a glutathione S-transferase (GST)-cyclin
D1 fusion protein (Figs. 2B and C). Purified ERK2 efficiently
phosphorylated GST-full-length wild type (WT) cyclin D1 (Fig. 2B,
lane 2). In contrast, ERK2 failed to phosphorylate T286A, a cyclin
D1 mutant (Fig. 2B, lane 4), suggesting that Thr286 is the major
phosphorylation site of ERK/MAPK. Identical results were
obtained in the presence of purified CDK4/6; ERK was able to
phosphorylate cyclin D1 at Thr286, not only in the monomeric
form but also within cyclin D1-CDK4/6 complexes (data not
shown).
To determine if ERK/MAPK requires the D-domain for
efficient cyclin D1 phosphorylation at Thr286, we performed in
vitro kinase assays using a complete deletion of the D-domain (DD)
from the GST-C-terminal cyclin D1 fusion protein. This fusion
protein retains the MAPK binding site. Fig. 2C shows that purified
ERK2 effectively phosphorylated WT cyclin D1 (lane 2), but not
the T286A and DD mutants (lanes 3 and 4).
These results strongly suggest that MAPK interacts with cyclin
D1 through its D-domain to phosphorylate Thr286. To confirm
this possibility, we performed an immunoprecipitation and
immunoblotting (IP-IB) analysis following ectopic expression of
Flag-tagged ERK2 with either HA-tagged WT or DD cyclin D1 in
HCT 116 colon cancer cells (Fig. 2D). ERK2 associated well with
WT cyclin D1 (lane 2) and poorly with DD cyclin D1 (lane 3). To
establish the importance of MAPK in the phosphorylation of
cyclin D1 at Thr286 in the HCT 116 cells, we transfected the cells
with various forms of cyclin D1 expression vectors (Fig. 2E).
Ectopic expression of cyclin D1 was distinguished from endoge-
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 2 December 2006 | Issue 1 | e128
Page 2
Figure 1. Cyclin D1 is destabilized during S phase through the ubiquitin-proteasome pathway in cancer cells.
(A, B) Expression profile of cyclin D1 during cell cycle progression in cells released from quiescence. Normal cells (A) and cancer cells (B) were tested.
(A) NIH 3T3 mouse fibroblasts and CCD841 CoN normal colon epithelium. (B) HCT 116 and SW480 cells. CCD841 CoN cells were synchronized at G0/
G1 phase by treatment with ACL-4 media without EGF for 24 hrs, and then stimulated with complete ACL-4 media containing EGF. Other cells were
released from quiescence by serum stimulation. Samples were collected at indicated time points. Cell cycle distributions were determined by flow-
cytometry and percentages of each phase are indicated. Western-blots were performed with cyclin D1 and b-actin antibodies, respectively.
(C, D) Pulse-chase analysis of cyclin D1 in NIH 3T3 cells (C) and HCT 116 cells (D). Cells were released from quiescence and labeled with
35
S-methionine
for 1 hour when most of the populations were in G1 phase (9 hrs for NIH3T3 and 6 hrs for HCT 116) or in S phase (21 hrs for NIH3T3 and 15 hrs for
HCT 116). The cells were chased with cold methionine for the indicated times and then lysed. Cyclin D1 was immunoprecipitated and analyzed with
SDS-PAGE. Autoradiography was performed. Levels of metabolically labeled-cyclin D1 were estimated by quantitative scanning using Quantity One
software (Bio-Rad) and blotted on the graph to determine the half-life of cyclin D1. Cell cycle distribution is indicated below the figures.
(E) Turnover of cyclin D1 is mediated by the ubiquitin-proteasome pathway.
NIH3T3 and HCT 116 cells were released from quiescence by serum stimulation and treated in the presence (+) or absence (2) of MG132 for 2 hrs
prior to harvesting at each time point. Western blot was performed with cyclin D1 and b-actin antibodies.
(F–H) Polyubiquitination of cyclin D1. (F) HCT 116 colon cancer cells were transfected with HA-tagged ubiquitin cDNA (lanes 1–3) or without it (lane 4)
and then synchronized to S phase through the sequential manipulation of serum starvation and stimulation. Cells were treated with 25 mM MG132
(lanes 3 and 4) or without it (lanes 1 and 2) for one hour. Lysates were immunoprecipitated with antibodies to cyclin D1 antibody (lanes 2–4) or
control IgG (lane 1) and immunoblotted with a HA antibody (upper panel) or a cyclin D1 antibody (lower panel). Asterisks indicate background non-
specific bands (F–G). (G) Nuclear (N) and cytoplasmic (C) proteins were fractionated (Fr.) from cell lysates collected in Panel F, lane 3. Nuclear and
cytoplasmic extracts were immunoprecipitated with antibodies to cyclin D1 (lanes 1 and 2) or IgG (lane 3) and immunoblotted with a HA antibody
(upper panel) or a cyclin D1 antibody (lower panel). (H) Cell cycle distributions.
doi:10.1371/journal.pone.0000128.g001
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 3 December 2006 | Issue 1 | e128
Page 3
nous expression by the reduced mobility of HA-tagged cyclin D1.
We analyzed the phosphorylation status of exogenous cyclin D1
expression at Thr286. Cyclin D1 phosphorylation was significantly
reduced by the deletion of the D-domain (lane 4). These
observations suggested that the majority of Thr286 phosphoryla-
tion in HCT 116 cells is through MAPK activity.
Figure 2. MAPK phosphorylates cyclin D1 at Thr286, which triggers subsequent ubiquitination.
(A) Identification of the D-domain in cyclin D1 (Cyc D1). The illustration of full-length human Cyc D1 shows the region of the D-domain (A.A. 179-193)
and the MAPK phosphorylation site Thr (T) 286 followed by proline (P) (solid bar and an arrow, respectively). The amino acid sequence of the D-
domain within Cyc D1 is aligned with other known MAPK-docking sites of various ERK substrates. The doublet of basic (+) and nonpolar (Q) amino
acids are conserved residues in the core D-domain motif L/I/V-X-L/I/V. Amino acid positions of the most 59 residues of the D-domains are indicated
with numbers in the left of each amino acid sequence respectively.
(B, C) p42 ERK2 in vitro kinase assays for cyclin D1 (upper panels).
(B) Wild type or T286A mutant recombinant GST- full length Cyc D1 protein was mixed with
32
P-ATP in the kinase assay reaction buffer in the
presence or absence of purified ERK2. Reactions were performed at 30uC for 30 min and stopped by adding sample loading buffer. Samples were
separated with SDS-PAGE and
32
P-uptake was detected by autoradiography. Immunoblotting (IB) analysis using antibodies to cyclin D1 is provided as
a reference to show substrate amounts.
(C) GST alone (lane 1), GST-C-terminal WT Cyc D1 fusion protein retaining the binding site of MAPK (amino acids 165-295, lane 2), T286A (lane 3) and
a complete deletion of the D-domain DD, lane 4) were used. IB analysis using antibodies to GSTs provided as a reference to show substrate amounts.
(D) Immunoprecipitation (IP) and IB analysis following ectopic expression of Flag-tagged ERK2 together with either HA-tagged WT or DD Cyc D1 in
HCT 116 colon cancer cells. A Western blot for input controls (10% total lysates) is also shown.
(E) Western blot analysis with Thr286 phosphorylated cyclin D1 (pCycD1 Thr286) and total Cyc D1 following transfection of various forms of HA-
tagged Cyc D1 expression vectors in HCT 116 colon cancer cells.
(F, G) In vitro ubiquitination assays using HeLa cell extracts Fraction II as a source of the enzymes necessary to conjugate ubiquitin to substrates and
ATP.
(F) GST-full length Cyc D1 WT, T286A, or DD were used for a reaction either with recombinant ERK2 (lanes 3–5) or without it (lanes 1–2). Samples were
separated by SDS-PAGE and immunoblotted with a cyclin D1 antibody. ATP was added to all lanes, and no ubiquitin was added to lane 1.
(G) GST-full length Cyc D1 WT was used with or without ubiquitin. After SDS-PAGE separation, immunobloting was performed with antibodies to
cyclin D1 (lanes 1, 2) or ubiquitin (lanes 3, 4).
(H, I) Pulse-chase analysis of cyclin D1 in HCT 116 cells after exposure to U0126. Exponentially growing HCT 116 cells were treated with DMSO or
10 mM U0126 for 30 min. (H) Cells were pulse-labeled with
35
S-methionine and were chased for the indicated times. Cyclin D1 was
immunoprecipitated and then analyzed with SDS-PAGE. Autoradiography was performed. (I) Levels of metabolically labeled-cyclin D1. (J) Western
blot analysis with pCycD1 Thr286, total cyclin D1, phosphorylation specific ERK (pERK), and total ERK antibodies. (K) Cell cycle distributions are shown.
doi:10.1371/journal.pone.0000128.g002
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 4 December 2006 | Issue 1 | e128
Page 4
Ras/MAPK-mediated ubiquitination and
degradation of cyclin D1 is directly linked to the
association of MAPK/ERK with cyclin D1
We next investigated whether MAPK-mediated phosphorylation
of cyclin D1 may lead ubiquitination of cyclin D1 in vitro (Figs. 2F
and G). We used a ubiquitination assay system that uses Fraction
II HeLa cell extracts as a source of the enzymes necessary to
conjugate ubiquitin to substrates and ATP [29]. Polyubiquitina-
tion of cyclin D1 (Fig 2F, lanes 1 and 2) was enhanced further by
ERK2 (Fig. 2F, lane 3 and Fig. 2G, lanes 2 and 4). Slower
migrating bands were not detected in the absence of ubiquitin
(Fig. 2G, lanes 1 and 3), suggesting that they consist of
polyubiquitinated forms of cyclin D1 (Fig. 2G, lanes 2 and 4).
We believe that polyubiquitination required direct interaction of
ERK2 with cyclin D1 and the phosphorylation of cyclin D1 at
Thr286, because ubiquitination was largely prevented in the D-
domain deletion mutant form (DD) and the alanine for Thr286
substitution (T286A) of cyclin D1 (Fig. 2F, lanes 4 and 5).
The stability of cyclin D1 protein is regulated by
ERK/MAPK activities in HCT 116 cancer cells
We also determined the contribution of ERK/MAPK to the stability
of cyclin D1 in cancer cells. We performed pulse-chase analysis on
metabolically labeled-cyclin D1 after inhibiting MAPK activities
(Figs. 2H–K; [refs. 30, 31]). Exponentially growing HCT 116 cells
were treated with U0126 for 30 min, which significantly depleted the
phosphorylated form of ERK (pERK) and cyclin D1 at Thr286
(pCyc D1 Thr286) without affecting the cell cycle profile (Figs. 2J
and K). Levels of metabolically labeled-cyclin D1 were estimated by
quantitative scanning as described above (Fig. 2I). Reducing MAPK
activity increased the half-life of cyclin D1 from 22.5 min to
54.6 min. These data indicate that the stability of cyclin D1 is
regulated by ERK/MAPK activity in cancer cells.
Cyclin D1 stability is regulated through the SCF or
the SCF-like pathway
Because of the strict specificity of E3 ligases and their substrates
[18], cyclin D1 is likely to have its own E3 ligase. We hypothesized
that cyclin D1 proteolysis is mediated by the SCF E3 ligases or an
SCF-like complex of E3 ligases, where an F-box protein
determines the specificity for its substrate. To test this idea, we
performed IP-IB analysis (Fig. 3A). Cyclin D1 from exponentially
growing HCT 116 cells was immunoprecipitated and sequentially
blotted with antibodies to cyclin D1, CDK4, SKP1, CUL1 and
CUL7. Cyclin D1 associated with SKP1, CUL1 or CUL7, and
CDK4, suggesting that its proteolysis is mediated by the SCF
(SKP1-CUL1-F-box protein) or the SCF-like (SKP1-CUL7-
FBXW8) complex of E3 ligases.
To test whether levels of cyclin D1 are mainly regulated by the
SCF or the SCF-like pathway, we performed an immunoblot
analysis 48 hrs after depleting SKP1 expression with siRNA double-
strand oligonucleotides in HCT 116 cells (Fig. 3B). siRNA for SKP1
significantly reduced SKP1 expression and resulted in accumulation
of cyclin D1. These observations strongly support the idea that cyclin
D1 stability is regulated through the SCF or the SCF-like pathway.
FBXW8, an F-box protein, specifically associates with
cyclin D1 in a Thr286 phosphorylation dependent
manner
We next identified the protein responsible for cyclin D1 stability.
We tested candidate human F-box protein genes to identify the
unique E3 ubiquitin ligase for cyclin D1. Substrate specificity of
SCF complexes occurs through protein-protein interaction domains
that are often tryptophan-aspartic acid (WD) 40 motifs or leucine-
rich repeats (LRR) within F-box proteins [20,21]. We searched the
NCBI databases for human F-box proteins with WD40 or LRR
motifs. We found approximately 70 potential genes. Among these, 9
had WD40 repeat motifs and 17 had LRR motifs.
We obtained these genes by first performing reverse transcrip-
tase-PCR (RT-PCR) using total RNA from HEK 293, HCT 116
or WI-38 cells. The full-length cDNAs we retrieved were cloned
into V5 or Flag epitope tag expression vectors. To address whether
any of the products of these genes could recognize cyclin D1, we
transiently transfected DNA plasmids for the V5 or Flag-tagged F-
box proteins into T98G cells with or without N-terminal HA-
tagged cyclin D1 and CDK4 expression vectors (Fig. 3C). After
24 hrs, the cells were collected and performed IP-IB analysis. The
samples were precipitated with an HA epitope tag antibody and
stained with Flag (FBXW7 and FBXL5) or V5 (others), and cyclin
D1 antibodies. Panel C shows cyclin D1 associating with two F-
box proteins, FBXW8 (lane 7) and FBXL12 (lane 15). FBXW8
possessed WD40 motifs and FBXL12 had LRR motifs.
Because F-box protein substrates must be phosphorylated [19],
we tested whether FBXW8 and FBXL12 recognize cyclin D1 in
a Thr286 phosphorylation-dependent manner. We transiently
transfected T98G cells with V5-tagged F-box protein DNA
plasmids and cyclin D1 (wild type or T286A mutant) and CDK4
expression vectors. Samples were precipitated with a HA epitope
tag antibody and blotted with V5, HA and Thr286 phosphorylated
cyclin D1 antibodies (Fig. 3D). FBXW8 was associated with both
cyclin D1 wild type and the T286A mutant, but the majority was
bound to wild type, which was mostly phosphorylated at Thr286.
In contrast, we did not see a significant difference between wild-
type cyclin D1 and the mutant in association with FBXL12. These
results suggest that FBXW8 recognizes cyclin D1 in a Thr286
phosphorylation-dependent manner, but FBXL12 does not.
Consistent with this finding, FBXL12 was not involved in cyclin
D1 polyubiquitination in vitro (Fig. 3E, lane 9). We concluded that
FBXW8 may play a role in cyclin D1 stability.
FBXW8 ubiquitinates cyclin D1 in a Thr-286
phosphorylation dependent manner
We investigated whether in vitro ubiquitination of cyclin D1
requires FBXW8 (Fig. 3E). We incubated each in vitro-translated F-
box protein with recombinant GST-cyclin D1 (Cyc D1), fraction
II HeLa cell extracts with ATP, ubiquitin and ERK2, and either in
vitro-translated SKP1, RBX1 and CUL1, or SKP1, RBX1 and
CUL7 proteins. Next, we blotted them with a cyclin D1 antibody.
Cyclin D1 ubiquitination was detected in the combinations of
FBXW8 with SKP1, CUL1, and RBX1 (lane 5), or FBXW8 with
SKP1, CUL7, and RBX1 (lane 6). However, polyubiquitinated
bands were not increased in other combinations. To confirm that
the SCF complexes were assembled properly upon in vitro
translation, we performed immmunoprecipitation with each F-
box protein in the
35
S-labeled in vitro translated samples (not
shown) and tested whether the complexes containing b-TRCP
were functional for polyubiquitination of b-catenin (Fig. S1 [E]).
Our results suggest that cyclin D1 ubiquitination involves FBXW8.
We next investigated whether in vitro ubiquitination of cyclin D1
through the SCF-like (SCFL) complex FBXW8 (SKP1-CUL7-
FBXW8-RBX1/SCFL
FBXW8
) requires phosphorylation of cyclin
D1 at Thr286 (Fig. 3F). Polyubiquitination through SCFL
FBXW8
was dramatically reduced by the depletion of ERK2 (lane 2).
Furthermore, cyclin D1 polyubiquitination was largely prevented
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 5 December 2006 | Issue 1 | e128
Page 5
by the alanine-for-Thr286 substitution (T286A, lane 3), suggesting
that phosphorylation of cyclin D1 at Thr286 is necessary for
ubiquitination by SCFL
FBXW8
. These data are in good accordance
with our observation that FBXW8 specifically associates with
cyclin D1 in a Thr286 phosphorylation-dependent manner.
Finally, we reconstituted cyclin D1 polyubiquitination in vitro using
purified E1 and E2 enzymes (Fig. 3G). SCFL
FBXW8
promotes
UbcH5C-catalyzed polyubiquitin chain assembly [22]. Consistent
with this fact, the V5 immunoprecipitates containing SCFL
FBXW8
exhibited significant E3 activities for polyubiquitination of cyclin D1
Figure 3. FBXW8 ubiquitinates cyclin D1 in a Thr286 phosphorylation-dependent manner.
(A) IP-IB analysis (left). Protein from exponentially growing HCT 116 cells was precipitated with antibodies to cyclin D1 or IgG. Immunoprecipitates
were subjected to SDS-PAGE and sequentially blotted with cyclin D1, CDK4, SKP1, CUL1 and CUL7 antibodies. IB analysis with 5% of total cell lysates
was provided as a control (right).
(B) IB analysis following depletion of SKP1 expression for 48 hrs after treatment with SKP1 siRNA double-strand oligonucleotides in HCT 116 cells.
Non-targeting siRNA (Control) and mock transfection (2) served as controls.
(C) IP-IB analysis. Twenty-six F-box full-length encoding cDNAs were cloned into V5 or Flag epitope tag expression vectors. These V5 or Flag-tagged F-
box protein DNA plasmids were transfected together with HA-tagged cyclin D1 (HA-Cyc D1) and CDK4 expression vectors into T98G cells. Cells were
collected 24 hrs later. Samples were precipitated with a HA epitope tag antibody. Immunoprecipitates were subjected to SDS-PAGE and
subsequently stained with V5 or Flag (F-box proteins), HA (Cyc D1) antibodies. IB analysis with 10% of total cell lysates was provided (bottom).
(D) IP-IB analysis (top). V5-tagged F-box protein DNA plasmids were transiently transfected together with either HA-tagged cyclin D1 (Cyc D1) wild
type (WT) or T286A mutant, and CDK4 expression vectors in T98G cells respectively. Samples were precipitated with a HA epitope-tag antibody.
Immunoprecipitates were subjected to SDS-PAGE and subsequently blotted with V5 (F-box proteins), HA (Cyc D1), and Thr286 phosphorylated cyclin
D1 (pCyc D1 Thr286) antibodies. IB analysis with 10% of total cell lysates was provided for comparison (bottom).
(E) In vitro ubiquitination assay. In vitro translated F-box proteins with recombinant GST-full-length cyclin D1 (Cyc D1) wild type, HeLa cell extracts
Fraction II with ATP, Ubiquitin and ERK2, and in vitro-translated either SKP1, RBX1 and CUL1, or SKP1, RBX1 and CUL7 proteins were incubated at 30uC
for 2 hrs. Samples were separated by SDS-PAGE and immunoblotted with a cyclin D1 antibody.
(F) In vitro polyubiquitination of cyclin D1 through the SCF-like (SCFL) complex FBXW8 (SKP1-CUL7-FBXW8-RBX1/SCFL
FBXW8
). WT or T286A GST- Cyc
D1 was incubated in the presence of purified ERK2 (lanes 1, and 3) or its absence (lane 2) at 30uC for 2 hrs. Samples were separated by SDS-PAGE and
immunoblotted with a cyclin D1 antibody. Asterisk indicates non-specific bands.
(G) Reconstitution of polyubiquitination of cyclin D1 through SCFL
FBXW8
in vitro using purified E1 and E2. GST-WT Cyc D1 was incubated with
recombinant SCFL
FBXW8
in the presence or absence of E1 and E2/UbcH5C. Samples were separated by SDS-PAGE and immunoblotted with a cyclin D1
antibody.
doi:10.1371/journal.pone.0000128.g003
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 6 December 2006 | Issue 1 | e128
Page 6
in the presence of both E1 and E2/UbcH5C (lane 3), and no activity
in the absence of E1 or both E1 and E2 (lanes 1 and 2). Taken
together, these data indicate that 1) cyclin D1 can be ubiquitinated
by FBXW8 and 2) that this process is dependent on Thr286
phosphorylation of cyclin D1 by ERK/MAPK.
Cyclin D1 levels are regulated by FBXW8
We tested whether ectopic expression of FBXW8 reduces levels of
endogenous cyclin D1 in cultured cells. We infected HCT 116
cells with retroviruses expressing FBXW8, FBXW7, or GFP as
a control (Fig. 4A and Fig. S1 [F]).
As Fig. 4A shows, overexpression of FBXW8 reduced
endogenous expression of cyclin D1, but did not significantly
change expression profiles of cyclin E. In contrast, FBXW7
inhibited expression of cyclin E, but not cyclin D1 (Fig. S1 [F];
[ref. 32]). Similar profiles were obtained from SW480, U-2 OS,
and T98G cells (not shown).
We also investigated whether overexpression of a dominant-
negative form of FBXW8 could cause cyclin D1 accumulation in
exponentially growing cells. The F-box deletion DF) mutant form
of FBXW8 is considered to be a dominant-negative because it can
bind to cyclin D1 but barely associates with SKP1, CUL1 and
CUL7 (Fig. 4B, lane 3), and therefore does not bring cyclin D1
into the ubiquitin-proteasome pathway. We infected HCT 116
cells with retroviruses expressing DF FBXW8 or GFP (Fig. 4C).
There was significant cyclin D1 accumulation following DF
FBXW8 expression. In contrast, an ectopically expressed domi-
nant-negative form of FBXW8 did not significantly change levels
of cyclin E (Fig 4C). Similar observations were obtained from
SW480 and T98G cells (not shown).
We confirmed this finding by determining whether siRNA-
induced depletion of endogenous FBXW8 expression could cause
cyclin D1 to accumulate in HCT 116 cells (Fig. 4D). We treated
cycling HCT 116 cells with control or FBXW8 siRNA for 48 hrs.
FBXW8 inhibition was verified RT-PCR analysis. We observed
approximately 95% inhibition of FBXW8 in comparison to the
control sample (see Fig. S1 [G]). We observed significant cyclin D1
accumulation in the sample treated with FBXW8 siRNA (Fig. 4D,
lane 3) and no effect on cyclin E levels. We concluded that cyclin
D1 levels are regulated by FBXW8 in the cancer cells tested here.
The stability of cyclin D1 is regulated through
complexes containing FBXW8
FBXW8 associates with CUL1 or CUL7 and forms a complex
with SKP1 and RBX1 (Fig. 4B lane 2; [ref. 22, 23]), suggesting
that CUL1 and CUL7 define the stability of cyclin D1 through
FBXW8. Given that depleting FBXW8 from cultured cells
increased cyclin D1 levels, reducing CUL1 or CUL7 should give
the same result. We treated HCT 116 cells with siRNA for 48 hrs
to knock down expression of CUL1 or CUL7 (Fig. 4E). In parallel,
we used RT-PCR to confirm that the siRNA transfection was
working efficiently (Fig. S1 [G]). The siRNAs for CUL1, CUL7, or
FBXW8 reduced expression of their respective genes, resulting in
accumulation of cyclin D1, which was mostly phosphorylated at
Thr286 (Fig. 4E). The effect was achieved without affecting
MAPK activities (pERK) in the first 48 hrs of siRNA treatment
(Fig. 4E). Comparable data were obtained from SW480, U-2 OS,
and T98 cells (not shown).
To confirm that cyclin D1 accumulation was due to increased
cyclin D1 stability, we performed pulse-chase analysis on
metabolically labeled-cyclin D1 after using siRNA to deprive
HCT 116 cells of FBXW8, CUL1, or CUL7 (Fig. 4F). Levels of
metabolically labeled-cyclin D1 were estimated as described
(Fig. 4G). Reducing FBXW8, CUL7 or CUL1 led to a stabilization
of cyclin D1. The half-life of cyclin D1 was 27.8 min in control
cell, and was extended by FBXW8, CUL7, or CUL1 siRNA
treatment (T
1/2
= 79.7, 58.7, or 46.2 min respectively). These data
confirmed that accumulation of cyclin D1 through depletion of
FBXW8, CUL1, or CUL7 was caused by increased cyclin D1
stability. We conclude that cyclin D1 stability is regulated by
complexes containing FBXW8, through the ubiquitin-proteasome
pathway.
Increased cyclin D1 degradation in cancer cells is
linked to increased cyclin D1-E3 ligase association
We demonstrate that cyclin D1 undergoes increased degradation
in the cytoplasm during S phase in a variety of cancer cells. We
hypothesized that enhanced cyclin D1 degradation in S phase is
associated with an increase in the association of E3 ligase with
cyclin D1. To test this hypothesis, we determined the subcellular
localizations of FBXW8 and cyclin D1 during the cell cycle in
cancer cells (Figs. 4H and I). HCT 116 cells were transfected with
V5 epitope-tagged FBXW8. The cells were rendered quiescent
24 hours later by serum starvation for a period lasting a further
24 hours, and then stimulated by adding medium containing
serum. This process allowed synchronization of cell cycle
progression. Cell cycle profiles were determined by flow cytometry
(Fig. 4I). At times corresponding to the G1 and S phases, cells were
fixed and labeled with fluorescent V5 epitope tags and cyclin D1
antibodies (Fig. 4H). The majority of FBXW8 was expressed in the
cytoplasm during G1 and S phase. In contrast, cyclin D1
accumulated in the nucleus during G1 phase and exited into the
cytoplasm in S phase, in agreement with previous reports [8,9,25].
The separation of FBXW8 and cyclin D1 during G1 phase
suggested that ubiquitination and degradation of cyclin D1 is
prevented in G1. Conversely, their colocalization during S phase
demonstrated that cyclin D1 proteolysis could be increased in the
cytoplasm as cells proceed into S phase (Fig. 1G).
FBXW8-mediated cyclin D1 degradation in the
cytoplasm is required for cancer cell proliferation
A recent report suggested that cyclin D1 degradation is necessary
for efficient DNA synthesis in NIH 3T3 cells [33]. We examined
the biological significance of enhanced cyclin D1 degradation in
the cytoplasm during S phase in HCT 116 cells. We inhibited
cyclin D1 proteolysis in the cytoplasm by using siRNA to knock
down E3 ligase components such as FBXW8, CUL1, or CUL7
and counted cells for five days (Fig. 5A). siRNA for FBXW8,
CUL1, or CUL7 significantly reduced cell numbers. These data
indicate that rapid turnover of cyclin D1 is required for HCT 116
proliferation.
A recent study demonstrated that cytoplasmically expressed
cyclin D1 competes with nuclear cyclin D1 and translocates
CDK4 from the nucleus to the cytoplasm [34]. The consequence
is a growth arrest. We tested whether reduced cell proliferation
due to knocking down FBXW8 expression is caused by cyclin D1
accumulation and subsequent cytoplasm sequestration of CDK1
(Fig. 5B). We treated HCT 116 cells with control (Cont) or
FBXW8 (W8) siRNA for 48 hrs. Inhibition of FBXW8 expression
was verified by a RT-PCR. We subsequently fractionated nuclear
and cytoplasmic proteins. Fig. 5B shows that depleting FBXW8
caused cytoplasmic cyclin D1 accumulation. Cyclin D1 was mostly
phosphorylated at Thr286, suggesting that cyclin D1 degradation
is linked to enhanced phosphorylation of cyclin D1 by MAPK (see
Figs. 2H–K). This process resulted in relocalization of CDK1 from
the nucleus to the cytoplasm. This caused a dramatic reduction of
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 7 December 2006 | Issue 1 | e128
Page 7
the nuclear CDK1 kinase activities, as assessed by a CDK1-
associated Histone H1 in vitro kinase assay (Fig. 5B bottom). These
observations indicated that inhibiting rapid turnover of cyclin D1
induced growth arrest.
We examined whether constitutive expression of the nuclear
protein cyclin D1 T286A could abrogate the block to cell
proliferation caused by siRNA against FBXW8 (Figs. 5C–E). We
tested this cyclin D1 mutant because it is resistant to polyubiqui-
tination, and also prevents the nuclear export of cyclin D1 during
S phase resulting in constitutive nuclear localization [9].
Importantly, this mutant is functional: ectopically expressed
T286A assembled with CDK4 in cultured cells and showed
similar levels of kinase activities to wild type cyclin D1 (data not
shown; [ref. 7]).
We generated a cyclin D1 ecdysone-inducible (IND) system in
HCT 116 cells. Ponasterone A (Pon A) induced ectopic expression
Figure 4. The stability of cyclin D1 is regulated by FBXW8 complexes through the ubiquitin-proteasome pathway.
(A, C) IB analysis. HCT 116 cells were infected with a retrovirus expressing FBXW8 (A), a DF mutant form (DF FBXW8, Panel C) or a control retrovirus
expressing GFP (A, C). Forty-eight hours later, cells were harvested and Western blot analysis was performed with antibodies to cyclin D1, cyclin E,
Flag (FBXW8 and DF FBXW8), GFP and b-actin.
(B) IP–IB analysis. Empty (mock) or Flag-tagged WT FBXW8, and DF FBXW8 DNA plasmids were transiently transfected in T98G cells. Samples were
precipitated with a Flag epitope tag antibody. Immunoprecipitates were subjected to SDS-PAGE and subsequently blotted with antibodies to cyclin
D1, SKP1, CUL1, CUL7, RBX1 and Flag (F-box proteins).
(D) IB analysis following depletion of FBXW8 expression for 48 hrs through siRNA in HCT 116 cells. Non-targeting siRNA (Control) and mock
transfection (2) were controls.
(E–G) Knockdown of FBXW8 or its partner CUL1 or CUL7 through siRNA stabilizes cyclin D1 expression in HCT 116 cells.
(E) IB analysis following depletion of CUL1, CUL7 or FBXW8 expression for 48 hrs through siRNA or mismatch (MM) oligonucleotides in HCT 116 cells.
Non-targeting siRNA (Control) and mock transfection (2) were controls.
(F, G) Pulse-chase analysis of cyclin D1 following depletion of CUL1, CUL7 or FBXW8 expression for 48 hrs through siRNA in HCT 116 cells. Control cells
were treated with non-targeting siRNA. Cells were pulse-labeled with
35
S-methionine for an hour, chased with cold methionine as indicated, and then
lysed. Cyclin D1 was immunoprecipitated and analyzed via SDS-PAGE. (G) Levels of metabolically labeled-cyclin D1 were estimated by quantitative
scanning using Quantity One software and plotted graphically to determine the half-life of cyclin D1.
(H, I) Immunofluorescence. Nuclei were visualized with Hoechst dye. Subcellular localization of E3 ligase. HCT 116 cells were transfected with V5
epitope-tagged FBXW8 pcDNA3. Cells were synchronized 24 hrs later by sequential manipulation of serum starvation and stimulation. At 6 hrs (G1
phase) or 15 hrs (S phase), cells were fixed. Immunofluorescence was performed with a V5 epitope tag antibody followed by Alexa Fluor 488-
conjugated anti-mouse IgG antibody (green) and a rabbit cyclin D1 polyclonal antibody followed by Alexa Fluor 594-conjugated anti-rabbit IgG
antibody (red). (I) Cell cycle distributions.
doi:10.1371/journal.pone.0000128.g004
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 8 December 2006 | Issue 1 | e128
Page 8
Figure 5. Cyclin D1 degradation in the cytoplasm is essential for cell proliferation.
(A) Viable HCT 116 cells after siRNA-mediated knockdown of FBXW8, CUL1, or CUL7 expression. siRNAs were transfected on days 0, 1, 2, and 4. Cells
were collected as indicated, stained with trypan blue, and counted with a haemocytometer.
(B) Western blot analysis with total and fractionated nuclear proteins. Protein blotting was performed with total cyclin D1 (Cyc D1), pCyc D1 Thr286,
CDK1, Histone H1, and MEK1 antibodies. HCT 116 cells were treated with control siRNA (Cont) or FBXW8 siRNA (W8) for 48 hrs. Samples were then
fractionated into nuclear or cytoplasmic proteins, or prepared as total cell lysates. The bottom panel shows a CDK1-associated Histone H1 in vitro
kinase assay using nuclear protein.
(C) Generation of cyclin D1 ecdysone-inducible (IND) system in HCT 116 cells. Ectopic expression of HA-tagged T286A was induced in by 10 mM
Ponasterone A (Pon A).
(D) Viable cells after T286A cyclin D1 induction. T286A IND HCT 116 cells were cultured in the presence of Pon A (T286A) or its absence, and control
(Cont) or FBXW8 siRNA.
(E) Colony formation assay. One hundred single T286A IND HCT 116 cells were cultured in the presence of Pon A (+) or its absence (2), and control
siRNA (Cont) or FBXW8 siRNA. Cells were cultured for 2 weeks, and stained with 0.5% crystal violet containing 20% ethanol.
(F) A model of cyclin D1 ubiquitination mediated by the complex containing FBXW8. FBXW8 recognizes cyclin D1 through a WD40 repeat motif in an
ERK/MAPK-mediated Thr286 phosphorylation-dependent manner. SKP1 interacts with FBXW8 together with CUL1 or CUL7 via a domain in the N-
terminus of FBXW8, called F-box. CUL1 or CUL7 recruits RBX1, which in turn conscripts E2, a ubiquitin-conjugating enzyme, to add a multiubiquitin
chain to cyclin D1.
doi:10.1371/journal.pone.0000128.g005
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 9 December 2006 | Issue 1 | e128
Page 9
of HA-tagged T286A in physiological levels (Fig. 5C). We
subsequently counted viable cell numbers for five days (Fig. 5D)
and performed a colony formation assay for 2 weeks (Fig. 5E) in
the presence (+) or absence (2) of Pon A, and control (Cont) or
FBXW8 siRNA. Cell colonies were stained with crystal violet.
Figs. 5D and E show that ectopically expressed physiological levels
of nuclear protein cyclin D1 T286A dramatically rescued cells
from growth arrest. Thus, FBXW8-mediated cyclin D1 degrada-
tion is essential for proliferation of HCT 116 cells.
DISCUSSION
This study has shown that the Ras/Raf/MEK/ERK MAPK
signaling cascade promotes cyclin D1 phosphorylation at Thr286,
resulting in ubiquitination and degradation of cyclin D1 (Fig. 5F).
ERK/MAPK is a proline (Pro)-directed serine or threonine (Ser/
Thr) protein kinase [26]. Many proteins contain Ser/Thr-Pro
sequences; however, most of them are not phosphorylated by
ERK, suggesting that there is a strict relationship in ERK
substrate specificity [28]. MAPK requires D-domains on the
substrate to increase the efficiency of phosphorylation [27]. In this
report, we identified a stringent D-domain at amino acids 179-193
of cyclin D1. Deleting this domain significantly reduced
phosphorylation of cyclin D1 in cultured cells and dramatically
inhibited ubiquitination of cyclin D1 in vitro (Figs. 2E and F), again
demonstrating that ERK/MAPK plays a significant role in cyclin
D1 regulation, as GSK3b, another proline-directed protein kinase
responsible for cyclin D1 phosphorylation at Thr286, should not
require the MAPK D-domain for phosphohrylation of its
substrates. This possibility suggests that high levels of MAPK
activity in cancer cells may make the requirement of GSK3b
redundant for cyclin D1 phosphorylation at Thr286. We also
found that similar D-domain sequences were conserved in cyclin
D1s from mouse, rat, chicken, xenopus, and zebrafish. Alignment
of cyclin D1 with other D-type cyclins has shown that Thr286 in
cyclin D1 corresponds to Thr280 in cyclin D2 and Thr283 in
cyclin D3 in their proximity to the carboxyl termini immediately
followed by prolines [8,9]. In addition, we found very similar
sequences of D-domains in the equivalent sites of cyclin D2 and
cyclin D3. We therefore suggest that all D-type cyclins can be
classified as ERK/MAPK substrates. In fact, cyclin D3 protein
shows a very similar expression profile to cyclin D1 during cell
cycle progression in colon cancer cells released from quiescence
(Figs. S1 [H] and [I]).
We have also demonstrated that ERK/MAPK-mediated cyclin
D1 degradation through FBXW8 is required for proliferation of
cancer cells (Fig. 5F). Our discoveries therefore suggest that the
Ras/MAPK pathway may play an important role in neoplastic
transformation through two distinct effects on cyclin D1
expression: the pathway turns on transcription in response to
oncogenic signals via the MAPK signaling cascade, leading to
accumulation of cyclin D1 and its assembly with CDK4/6.
Progression into S phase requires removing cyclin D1 through
relocalization and degradation. This process is initiated by
sustained MAPK signaling, a feature unique to cancer cells. Thus,
our results provide a better understanding of the roles of MAPK
and cyclin D1 in cell cycle regulation.
MATERIALS AND METHODS
Cell culture, vectors, and site-directed mutagenesis
Cell lines were obtained from the American Type Culture
Collection. CMV-HA tagged ubiquitin, CUL1, CKS1, and Flag
tagged CUL7 DNA expression vectors were gifts from Drs. M.
Pagano and Z. Q. Pan. pcDNA3 cyclin D1 T286A and cyclin D1
DD mutants, as well as F-box deletion (DF) mutant forms of
FBXW8 and SKP2 were generated by using site-directed
mutagenesis (QuickChange and ExSite, Stratagene).
Small interfering (si) RNAs
The following siRNA oligonucleotides were selected to knock
down endogenous expression of FBXW8, SKP1, CUL1, and
CUL7: FBXW8 (AAGAUGUGCACAGGUGAGCAA), CUL1
(AAUAGACAUUGGGUUCGCCGU), and CUL7 (AAGGAU-
GAGAUCUAUGCCAAC). Mismatch oligonucleotides for
FBXW8, CUL1, and CUL7 are 8 bp nucleotides different from
their target sequences respectively. The siRNAs for SKP1 were
from Dharmacon’s SMART pool. siRNAs were transfected using
Oligofectamine or Lipofectamine (Gibco, Invitrogen). Relative
gene expression following siRNA treatment was measured by RT-
PCR (UCSF Cancer Center Genome Core Facility) using
TaqMan assays (Applied Biosystems).
Immunoblotting, and immunoprecipitation and
immunoblotting (IP-IB) analyses
Total protein preparation, SDS-PAGE, immunoprecipitation and
immunoblotting analysis and enhanced chemiluminescence were
carried out as described [3,4]. NE-PER nuclear and cytoplasmic
extraction reagents (Pierce) were used for fractionation. The
following monoclonal and polyclonal primary and secondary
antibodies were used: cyclin D1 (A-12, M-20, Santa Cruz), cyclin
D3 (Transduction Laboratory), cyclin E (Ab-1, Calbiochem),
ERK1/2 (Promega), phospho-ERK1/2 (E-4, Santa Cruz), CDK1
(Transdcution Laboratory), CDK4 (Transduction Laboratory, or
H-303, Santa Cruz), SKP1 (55893, PharMingen), CUL1 (ZL18,
Zymed), CUL7 (BL653, Bethyl Laboratories), RBX1 (Ab-1,
NeoMarkers), Ubiquitin (P4D1, Santa Cruz), GST (B-14, Santa
Cruz), GFP (FL, Santa Cruz), MEK1 (Transduction Laboratory),
Histone H1 (AE-4, Santa Cruz), b-actin (Sigma), HA (12CA5,
Roche), Flag (M2, Sigma), V5 (Invitrogen), Sheep anti-mouse IgG
HRP and Donkey anti-rabbit IgG HRP (Amersham).
Generation of a cyclin D1 phosphorylation specific
antibody
Phospho-specific antibody against Thr286 of cyclin D1 was raised
using KLH-conjugated phospho-peptide KDLAC-pT-PTDVR as
an antigen in collaboration with Zymed Inc. Rabbits were
immunized three times with the peptides and serum was collected
after 3 months, and subjected to affinity-purification using affinity
gel coupled with phosphorylated peptide. Anti-nonphosphorylated
cyclin D1 antibodies were eliminated by affinity-absorption using
gel coupled with unphosphorylated peptide (Zymed).
Immunoprecipitation and immunoblotting analysis
The following antibodies were used for immunoprecipitation;
cyclin D1 (A-12 Agarose-conjugated, Santa Cruz), CDK1 (C-19,
Santa Cruz), Flag (M2 Agarose-conjugated, Sigma), and HA (Y-11
Agarose-conjugated, Santa Cruz).
In vitro
protein kinase assay
Glutathione S-transferase (GST) fusion proteins GST-cyclin D1,
GST-cyclin D1-CDK4/6 (Cell Signaling) or Histone H1 (Santa
Cruz) were used for in vitro kinase assays. Reactions were
performed at 30uC for 30 min with kinase buffer (50 mM Tris-
HCl [pH 8.0]) and 1 mM DTT containing 30 mM ATP and 10
mCi c-
32
P ATP in the presence of 10 ng recombinant MEK1
activated GST-ERK2 (14-550, Upstate) or CDK1 immune-
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 10 December 2006 | Issue 1 | e128
Page 10
complexes from cultured cells. Reactions were stopped with
sample loading buffer. Samples were separated by SDS-PAGE
and
32
P uptake was detected by autoradiography.
Reconstitution of cyclin D1 polyubiquitination
in
vitro
Recombinant SCFL
FBXW8
were prepared from transfected
HEK293 cells. Equal amounts of SCFL
FBXW8
immune-complexes
were mixed with 1 mg GST-full-length Cyc D1 WT protein in the
presence of 30 ng recombinant active ERK2 (Upstate) and
0.5 mM ATP for 30 min on ice to allow binding. To the mixture
was added 50 ng E1, 100 ng E2 (UbcH5c), 2 mg ubiquitin, and
1 mg ubiquitin aldehyde (all from BostonBiochem). Reactions were
performed with a buffer containing 50 mM Tris-HCl (pH 8.0),
1 mM DTT, 5 mM MgCl
2
, 0.5 mM EDTA, 1.5 mM ATP in the
presence of 10% glycerol at 30uC for 1 hour and terminated by
boiling for 5 min with SDS sample loading buffer. Samples were
separated by SDS-PAGE and immunoblotted with cyclin D1
antibody (A-12, Santa Cruz).
SUPPORTING INFORMATION
Figure S1 (A, B) Expression profile of cyclin D1 during cell cycle
progression after release from quiescence. WI-38 cells (A) and
T98G cells (B). (C) Western blot analysis using nuclear (N) and
cytoplasmic (C) fraction (Fr.) proteins extracted from cell lysates
collected in Figure 1F, lane 3. The membrane was stained with
histone H1, MEK1, and cyclin D1. (D) Immunoprecipitation-
immunoblot analysis. HCT 116 cells were transfected with
ubiquitin cDNA and synchronized to S phase through sequential
manipulation of serum starvation and stimulation. Cells were
treated with Leptomycin B (LMB) for 3 hours to inhibit nuclear-
to-cytoplasmic localization of cyclin D1 and treated with MG132
for 1 hour before harvesting. Nuclear protein (N) was fractionated
and immunoprecipitated with a cyclin D1 antibody and
immunoblotted with a HA antibody (upper panel) or a cyclin
D1 antibody (lower panel). Asterisk: background non-specific
bands. (E) In vitro ubiquitination assay. In vitro translated F-box
proteins with recombinant GST-b-catenin (Upstate), HeLa cell
extracts Fraction II with ATP, Ubiquitin and GSK3b, and in vitro-
translated SKP1, RBX1 and CUL1 were incubated at 30u C for
2 hours. Samples were separated by SDS-PAGE and immuno-
blotted with a b-catenin antibody. (F) Immunoblot analysis. HCT
116 cells were infected with a retrovirus expressing FBXW7/
CDC4 or a control retrovirus expressing GFP. Cells were
harvested 48 hrs and Western blot analysis was performed with
antibodies to cyclin D1, cyclin E, Flag (FBXW7), GFP and CDK4.
(G) Summary of RT-PCR following depletion of CUL1, CUL7 or
FBXW8 expression for 48 hrs through siRNA or mismatch (MM)
oligonucleotides in HCT 116 cells (see Fig. 4E). Non-targeting
siRNA was provided as control. Relative gene expression is shown.
(H, I) Expression profile of cyclin D3 protein during cell cycle
progression after release from quiescence. WI-38 cells (H) and
HCT 116 cells (I).
Found at: doi:10.1371/journal.pone.0000128.s001 (2.44 MB TIF)
ACKNOWLEDGMENTS
The authors gratefully acknowledge Drs. Allan Balmain, Mike Fried, Eiji
Hara, Demetris Iacovides, Anthony Karnezis, Haruhiko Koseki, Valerie
Natale, David Stokoe and Thea Tlsty for their valuable suggestions and
critical discussions.
Author Contributions
Conceived and designed the experiments: OT HO. Performed the
experiments: OT HO SL JP. Analyzed the data: FM OT HO SL JP.
Contributed reagents/materials/analysis tools: FM DA OT HO. Wrote
the paper: OT.
REFERENCES
1. Malumbres M, Barbacid M (2001) To cycle or not to cycle: A critical decision in
cancer. Nature Reviews Cancer 1: 222–231.
2. Yu Q, Geng Y, Sicinski P (2001) Specific protection against breast cancers by
cyclin D1 ablation. Nature 411: 1017–21.
3. Tetsu O, McCormick F (1999) b-Catenin regulates expression of cyclin D1 in
colon carcinoma cells. Nature 398: 422–6.
4. Tetsu O, McCormick F (2003) Proliferation of cancer cells despite CDK2
inhibition. Cancer Cell 3: 233–45.
5. Sherr CJ, Roberts JM (2004) Living with or without cyclins and cyclin-
dependent kinases. Genes Dev 18: 2699–711.
6. LaBaer J, Garrett MD, Stevenson LF, Slingerland JM, Sandhu C, et al. (1997)
New functional activities for the p21 family of CDK inhibitors. Genes Dev 11:
847–62.
7. Cheng M, Olivier P, Diehl JA, Fero M, Roussel MF, et al. (1999) The p21(Cip1)
and p27(Kip1) CDK ‘inhibitors’ are essential activators of cyclin D-dependent
kinases in murine fibroblasts. EMBO J 18: 1571–83.
8. Diehl JA, Zindy F, Sherr CJ (1997) Inhibition of cyclin D1 phosphorylation on
threonine-286 prevents its rapid degradation via the ubiquitin-proteasome
pathway. Genes Dev 11: 957–72.
9. Diehl JA, Cheng M, Roussel MF, Sherr CJ (1998) Glycogen synthase kinase-3b
regulates cyclin D1 proteolysis and subcellular localization. Genes Dev 12:
3499–511.
10. Alt JR, Cleveland JL, Hannink M, Diehl JA (2000) Phosphorylation-dependent
regulation of cyclin D1 nuclear export and cyclin D1-dependent cellular
transformation. Genes Dev 14: 3102–14.
11. Shao J, Sheng H, DuBois RN, Beauchamp RD (2000) Oncogenic Ras-mediated
cell growth arrest and apoptosis are associated with increased ubiquitin-
dependent cyclin D1 degradatio n. J Biol Chem 275: 22916–24.
12. Guo Y, Yang K, Harwalkar J, Nye JM, Mason DR, et al. (2005) Phosphorylation
of cyclin D1 at Thr 286 during S phase leads to its proteasomal degradation and
allows efficient DNA synthesis. Oncogene 24: 2599–612.
13. Casanovas O, Miro F, Estanyol JM, Itarte E, Agell N, et al. (2000) Osmotic
stress regulates the stability of cyclin D1 in a p38SAPK2-dependent manner. J
Biol Chem 275: 35091–7.
14. Russell A, Thompson MA, Hendley J, Trute L, Armes J, et al. (1999) Cyclin D1
and D3 associate with the SCF complex and are coordinately elevated in breast
cancer. Oncogene 18: 1983–91.
15. Ganiatsas S, Dow R, Thompson A, Schulman B, Germain D (2001) A splice
variant of Skp2 is retained in the cytoplasm and fails to direct cyclin D1
ubiquitination in the uterine cancer cell line SK-UT. Oncogene 20: 3641–50.
16. Nakayama K, Nagahama H, Minamishima YA, Matsumoto M, Nakamichi I,
et al. (2000) Targeted disruption of Skp2 results in accumulation of cyclin E
and p27 (Kip1), polyploidy and centrosome overduplication. EMBO J 19:
2069–81.
17. Nakayama K, Nagahama H, Minamishima YA, Miyake S, Ishida N, et al.
(2004) Skp2-mediated degradation of p27 regulates progression into mitosis. Dev
Cell 6: 661–72.
18. Hershko A, Ciechanove A (1998) The ubiquitin system. Annu Rev Biochem 67:
425–79.
19. Deshaies RJ (1999) SCF and Cullin/Ring H2-based ubiquitin ligases. Annu Rev
Cell Dev Biol 15: 435–67.
20. Cardozo T, Pagano M (2004) The SCF ubiquitin ligase: insights into a molecular
machine. Nat Rev Mol Cell Biol 5: 739–51.
21. Jin J, Cardozo T, Lovering RC, Elledge SJ, Pagano M, et al. (2004) Systematic
analysis and nomenclature of mammalian F-box proteins. Genes Dev 18:
2573–80.
22. Dias DC, Dolios G, Wang R, Pan ZQ (2002) CUL7: A DOC domain-
containing cullin selectively binds Skp1.Fbx29 to form an SCF-like complex.
Proc Natl Acad Sci U S A 99: 16601–6.
23. Arai T, Kasper JS, Skaar JR, Ali SH, Takahashi C, et al. (2003) Targeted
disruption of p185/Cul7 gene results in abnormal vascular morphogenesis. Proc
Natl Acad Sci U S A 100: 9855–60.
24. Matsushime H, Roussel MF, Ashmun RA, Sherr CJ (1991) Colony-stimulating
factor 1 regulates novel cyclins during the G1 phase of the cell cycle. Cell 65:
701–13.
25. Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta G (1993) Cyclin D1 is
a nuclear protein required for cell cycle progression in G1. Genes Dev 7:
812–21.
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 11 December 2006 | Issue 1 | e128
Page 11
26. Macdonald SG, McCormick F (1997) The Ras/Raf/ERK signaling trans-
duction pathway, Oncogenes and Tumor Suppressors, Peters G, Vousden KH,
eds. Oxford, UK: Oxford University Press. pp. 121–153.
27. Sharrocks AD, Yang SH, Galanis A (2000) Docking domains and substrate-
specificity determination for MAP kinases. Trends Biochem Sci 25: 448–53.
28. Bardwell AJ, Flatauer LJ, Matsukuma K, Thorner J, Bardwell L (2001) A
conserved docking site in MEKs mediates high-affinity binding to MAP kinases
and cooperates with a scaffold protein to enhance signal transmission. J Biol
Chem 276: 10374–86.
29. Montagnoli A, Fiore F, Eytan E, Carrano AC, Draetta GF, et al. (1999)
Ubiquitination of p27 is regulated by Cdk-dependent phosphorylation and
trimeric complex formation. Genes Dev 13: 1181–9.
30. Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, et al. (1998)
Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J
Bio Chem 273: 18623–32.
31. Davies SP, Reddy H, Caivano M, Cohen P (2000) Specificity and mechanism of
action of some commonly used protein kinase inhibitors. Biochem J 351:
95–105.
32. Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, et al. (2001)
Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7
ubiquitin ligase. Science 294: 173–7.
33. Guo Y, Yang K, Harwalkar J, Nye JM, Mason DR, et al. (2005) Phosphorylation
of cyclin D1 at Thr 286 during S phase leads to its proteasomal degradation and
allows efficient DNA synthesis. Oncogene 24: 2599–612.
34. Diehl JA, Sherr CJ (1997) A dominant-negative cyclin D1 mutant prevents
nuclear import of cyclin-dependent kinase 4 (CDK4) and its phosphorylation by
CDK-activating kinase. Mol Cell Biol 17: 7362–74.
Cyclin D1 Is Degraded by FBXW8
PLoS ONE | www.plosone.org 12 December 2006 | Issue 1 | e128
Page 12
  • Source
    • "Therefore, cyclin D1 proteasomal degradation by NAR may result from its threonine-286 phosphorylation. Phosphorylation-dependent degradation of cyclin D1 can be regulated by ERK1/2 and p38 (Okabe et al., 2006; Thoms et al., 2007). This study is the fi rst to show that NAR activates p38 and the inactivation of p38 blocks NAR-mediated cyclin D1 degradation. "
    [Show abstract] [Hide abstract] ABSTRACT: Naringenin (NAR) as one of the flavonoids observed in grapefruit has been reported to exhibit an anti-cancer activity. However, more detailed mechanism by which NAR exerts anti-cancer properties still remains unanswered. Thus, in this study, we have shown that NAR down-regulates the level of cyclin D1 in human colorectal cancer cell lines, HCT116 and SW480. NAR inhibited the cell proliferation in HCT116 and SW480 cells and decreased the level of cyclin D1 protein. Inhibition of proteasomal degradation by MG132 blocked NAR-mediated cyclin D1 downregulation and the half-life of cyclin D1 was decreased in the cells treated with NAR. In addition, NAR increased the phosphorylation of cyclin D1 at threonine-286 and a point mutation of threonine-286 to alanine blocked cyclin D1 downregulation by NAR. p38 inactivation attenuated cyclin D1 downregulation by NAR. From these results, we suggest that NAR-mediated cyclin D1 downregulation may result from proteasomal degradation through p38 activation. The current study provides new mechanistic link between NAR, cyclin D1 downregulation and cell growth in human colorectal cancer cells.
    Full-text · Article · Jul 2015 · Biomolecules and Therapeutics
  • Source
    • "Otherwise, ERK and p38 activation were also observed during ophiobolin O treatment. The p38 SAPK2 and ERK2 have been shown to regulate G1 transition through interaction with cyclin D1 stability by phosphorylating T286 in some reports161718. However, here we declare that AKT/GSK3β/cyclin D1 signaling is responsible for ophiobolin O-induced cyclin D1 degradation and G1 arrest. "
    [Show abstract] [Hide abstract] ABSTRACT: Ophiobolin O is a member of ophiobolin family, which has been proved to be a potent anti-tumor drug candidate for human breast cancer. However, the anti-tumor effect and the mechanism of ophiobolin O remain unclear. In this study, we further verified ophiobolin O-induced G1 phase arrest in human breast cancer MCF-7 cells, and found that ophiobolin O reduced the phosphorylation level of AKT and GSK3β, and induced down-regulation of cyclin D1. The inverse docking (INVDOCK) analysis indicated that ophiobolin O could bind to GSK3β, and GSK3β knockdown abolished cyclin D1 degradation and G1 phase arrest. Pre-treatment with phosphatase inhibitor sodium or thovanadate halted dephosphorylation of AKT and GSK3β, and blocked ophiobolin O-induced G1 phase arrest. These data suggest that ophiobolin O may induce G1 arrest in MCF-7 cells through interaction with AKT/GSK3β/cyclin D1 signaling. In vivo, ophiobolin O suppressed tumor growth and showed little toxicity in mouse xenograft models. Overall, these findings provide theoretical basis for the therapeutic use of ophiobolin O.
    Full-text · Article · Jan 2015 · Marine Drugs
  • Source
    • "Taken together, the emerging genetic evidence has strongly suggested a pivotal role for the CUL7 E3 ligase in growth control. CUL7 may have additional functions that include transformation mediated by simian virus-40 (SV40) large T antigen (Kohrman and Imperiale, 1992; Daud et al., 1993; Kasper et al., 2005), apoptosis (Tsai et al., 2000; Kim et al., 2007), p53 regulation (Andrews et al., 2006; Dowell et al., 2007; Kaustov et al., 2007; Jung et al., 2007), and the degradation of cyclin D1 (Okabe et al., 2006). "
    Full-text · Dataset · Jan 2015
Show more