Li Z, Dong T, Proschel C, Noble M.. Chemically diverse toxicants converge on Fyn and c-Cbl to disrupt precursor cell function. PLoS Biol 5: e35

ArticleinPLoS Biology 5(2):e35 · March 2007with36 Reads
Impact Factor: 9.34 · DOI: 10.1371/journal.pbio.0050035 · Source: PubMed
Abstract

Identification of common mechanistic principles that shed light on the action of the many chemically diverse toxicants to which we are exposed is of central importance in understanding how toxicants disrupt normal cellular function and in developing more effective means of protecting against such effects. Of particular importance is identifying mechanisms operative at environmentally relevant toxicant exposure levels. Chemically diverse toxicants exhibit striking convergence, at environmentally relevant exposure levels, on pathway-specific disruption of receptor tyrosine kinase (RTK) signaling required for cell division in central nervous system (CNS) progenitor cells. Relatively small toxicant-induced increases in oxidative status are associated with Fyn kinase activation, leading to secondary activation of the c-Cbl ubiquitin ligase. Fyn/c-Cbl pathway activation by these pro-oxidative changes causes specific reductions, in vitro and in vivo, in levels of the c-Cbl target platelet-derived growth factor receptor-alpha and other c-Cbl targets, but not of the TrkC RTK (which is not a c-Cbl target). Sequential Fyn and c-Cbl activation, with consequent pathway-specific suppression of RTK signaling, is induced by levels of methylmercury and lead that affect large segments of the population, as well as by paraquat, an organic herbicide. Our results identify a novel regulatory pathway of oxidant-mediated Fyn/c-Cbl activation as a shared mechanism of action of chemically diverse toxicants at environmentally relevant levels, and as a means by which increased oxidative status may disrupt mitogenic signaling. These results provide one of a small number of general mechanistic principles in toxicology, and the only such principle integrating toxicology, precursor cell biology, redox biology, and signaling pathway analysis in a predictive framework of broad potential relevance to the understanding of pro-oxidant-mediated disruption of normal development.

Figures

Full-text

Available from: Mark Noble
Chemically Diverse Toxicants Converge
on Fyn and c-Cbl to Disrupt Precursor Cell
Function
Zaibo Li, Tiefei Dong, Chris Pro
¨
schel, Mark Noble
*
Department of Biomedical Genetics, University of Rochester Medical Center, Rochester, New York, United States of America
Identification of common mechanistic principles that shed light on the action of the many chemically diverse toxicants
to which we are exposed is of central importance in understanding how toxicants disrupt normal cellular function and
in developing more effective means of protecting against such effects. Of particular importance is identifying
mechanisms operative at environmentally relevant toxicant exposure levels. Chemically diverse toxicants exhibit
striking convergence, at environmentally relevant exposure levels, on pathway-specific disruption of receptor tyrosine
kinase (RTK) signaling required for cell division in central nervous system (CNS) progenitor cells. Relatively small
toxicant-induced increases in oxidative status are associated with Fyn kinase activation, leading to secondary
activation of the c-Cbl ubiquitin ligase. Fyn/c-Cbl pathway activation by these pro-oxidative changes causes specific
reductions, in vitro and in vivo, in levels of the c-Cbl target platelet-derived growth factor receptor-a and other c-Cbl
targets, but not of the TrkC RTK (which is not a c-Cbl target). Sequential Fyn and c-Cbl activation, with consequent
pathway-specific suppression of RTK signaling, is induced by levels of methylmercury and lead that affect large
segments of the population, as well as by paraquat, an organic herbicide. Our results identify a novel regulatory
pathway of oxidant-mediated Fyn/c-Cbl activation as a shared mechanism of action of chemically diverse toxicants at
environmentally relevant levels, and as a means by which increased oxidative status may disrupt mitogenic signaling.
These results provide one of a small number of general mechanistic principles in toxicology, and the only such
principle integrating toxicology, precursor cell biology, redox biology, and signaling pathway analysis in a predictive
framework of broad potential relevance to the understanding of pro-oxidant–mediated disruption of normal
development.
Citation: Li Z, Dong T, Pro
¨
schel C, Noble M (2007) Chemically diverse toxicants converge on Fyn and c-Cbl to disrupt precursor cell function. PLoS Biol 5(2): e35. doi:10.1371/
journal.pbio.0050035
Introduction
Determining whether chemically diverse substances induce
similar adverse effects at the cellular and molecular level is
one of the central challenges of toxicological research. If the
structural diversity of different toxicants, and of potential
toxicants, means that each works through distinctive mech-
anisms then this creates a potentially unsolvable challenge in
developing means of screening the many tens of thousands of
different chemicals for which little or n o toxicological
information exists. In contrast, the identification of general
principles that transcend the specific chemistries of individ-
ual substances has the potential of providing broadly relevant
insights into the means by which toxicants disrupt normal
development. If such principles were found to apply to the
analysis of toxicant levels frequently encountered in the
environment, this would be of even greater potential
importance in providing efficient means of analyzing this
diverse array of chemicals.
Of all of the effects associated with toxicant exposure, one
of the few that appears to be common to multiple chemically
diverse substances is the ability of these agents to cause cells
to become more oxidized. The range of toxicants reported to
alter oxidative status is very broad, and includes metal
toxicants such as methylmercury (MeHg; e.g., [1–6], lead [Pb]
[6–9], and organo tin compo unds [1,2,5,10,11]), cadmium
[12,13], and arsenic [12,14]. Ethanol exposure also is
associated with oxidative stress [15], as is exposure to a
diverse assortment of agricultural chemicals [16], including
herbicides (e.g., paraquat [17,18]), pyrethroids [19–21], and
organophosphate and carbamate inhibitors of cholinesterase
[22–26]). Thus, the ability to cause cells to become more
oxidized is shared by many toxicants, regardless of their
chemical structure.
The observations that chemically diverse toxicants share
the property of making cells more oxidized is of particular
interest in light of the increasing evidence that oxidative
regulation is a central modulator of normal physiological
function. Although increases in oxidative status in a cell have
Academic Editor: Sally Temple, Albany Medical College, United States of America
Received March 13, 2006; Accepted December 4, 2006; Published February 6,
2007
Copyright: Ó 2007 Li et al. This is an open-access article distributed under the
terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author
and source are credited.
Abbreviations: BMP, bone morphogenetic protein; CNS, central nervous system;
EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ERK,
extracellular signal-regulated kinase; FGF-2, fibroblast growth factor-2; MeHg,
methylmercury; NT-3, neurotrophin-3; O-2A/OPC, oligodendrocyte-type-2 astrocyte
progenitor/oligodendrocyte precursor cell; PDGF, platelet-derived growth factor;
PDGFRa, platelet-derived growth factor recep tor a; PKC, protein kinase C; ppb,
parts per billion; RNAi, inhibitory RNA; RTK, rece ptor tyrosine kinases; SD, standard
deviation; siRNA, small interfering RNA; SRE, serum response element; TH, thyroid
hormone
* To whom correspondence should be addressed. E-mail: mark_noble@urmc.
rochester.edu
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350212
P
L
o
S
BIOLOGY
Page 1
been most extensively studied in the context of their adverse
effects (in particular, the induction of cell death or of cell
senescence), multiple studies have demonstrated that changes
in redox state as small as 15%–20% may be critical in
regulating such normal cellular processes as signal trans-
duction, division, differentiation, and transcription (reviewed
in, e.g., [27–31]. Although the mechanistic basis for such
regulation is frequently unclear, the importance of redox
status in modulating cell function makes convergence of
different toxicants on this physiological parameter a matter
of considerable potential interest.
Despite the observations that many toxicants share the
property of making cells more oxidized, multiple questions
exist regarding the relevance of such observations for the
understanding of toxicant function.
First, there is considerable uncertainty about the relative
importance of effects on redox state in the analysis of
individual toxicants, and it is generally believed that the
major effects of toxicants on cellular function are distinct
from any effects on oxidative status. For example, in the
context of agents analyzed in the present studies, MeHg-
mediated effects on cellular function generally are thought to
be mediated through binding to cysteine residues, thus
disrupting function of microtubules and other proteins, but
may also involve disruption of Ca
2þ
homeostasis (e.g., [32–
34]). In contrast, Pb does not bind to cysteine residues and
instead is thought to exert its functions through altering
normal calcium metabolism by mimicking calcium action
and/or by disrupting calcium homeostasis (e.g., [35,36]). This
would lead to alterations in function of multiple proteins, of
which the most extensively studied have been members of the
protein kinase C (PKC) family of enzymes (e.g., [37,38]).
A further concern is the general lack of knowledge about
whether, or where, oxidation induced by different means
would mechanistically converge. For example, MeHg has been
suggested to cause oxidative stress by a variety of mecha-
nisms, including by binding to thiols, by causing a depletion
in glutathione levels, or by impairing mitochondrial function
[39,40], whereas Pb is thought to disrupt mitochondrial
function through its effects on calcium metabolism (e.g.,
[35,36,41–45]) The organic herbicide paraquat (the third
agent examined in the present studies) is another example of
a toxic ant with pro-oxidant activities, but in this ca se,
resulting from initiation of a cyclic oxidation/reduction
process in which paraquat first undergoes one electron
reduction by NADPH to form free radicals that donate their
electron to O
2
, producing a su peroxide radical; upon
exhaustion of NADPH, superoxide reacts with itself and
produces hydroxyl free radicals (e.g., [17,18]). Whether these
different means of altering oxidative state would have
different mechanistic consequences is unknown.
A further concern regarding the hypothesis that changes in
redox state represent an important convergence point of
toxicant action is whether oxidative changes are even
associated with toxicant exposure at levels frequently
encountered in the environment. For example, although
several studies have documented the ability of MeHg to cause
cells to become more oxidized, effective exposure levels
employed in these studies have generally ranged from 1–20
lM [2–5], which is 30–600 times the upper range of average
mercury concentrations found in the bloodstream of as many
as 600,000 newborn infants in the United States alone [46].
Similar concerns apply to the analysis of multiple toxicants,
for which pro-oxidant effects have largely been studied at
exposure levels much higher than those with broad environ-
mental relevance.
In addition, a more general concern regarding the search
for general principles of toxicant action is whether such
convergence, if it exists, would occur only at exposure levels
that induce cell death or whether common mechanisms might
be relevant to the understanding of more subtle effects of
toxicant exposure, particularly during critical developmental
periods. Because development is a cumulative process, the
effects of small changes in, e.g., progenitor cell division and/
or differentiation, that are maintained over multiple cellular
generations could have substantial effects on the organism.
Such changes are poorl y understood, however, at both
cellular and molecular levels.
Our present studies have led to the discovery of a
previously unrecognized regulatory pathway on which envi-
ronmentally relevant levels of chemically diverse toxicants
converge to compromise division of a progenitor cell isolated
from the developing central nervous system (CNS). We found
that exposure of cells to low levels of MeHg, Pb, or paraquat is
sufficient to make cells more oxidized and to activate Fyn
kinase, a Src family member known to be activated by
increased oxidative status. This first step activates a pathway
wherein Fyn activates c-Cbl, a ubiquitin ligase that plays a
critical role in modulating degradation of a specific subset of
receptor tyrosine kinases (RTKs). c-Cbl activation in turn
leads to reductions in levels of target RTKs, thus suppressing
division of glial progenitor cells. The effects of all three
toxicants are blocked by co-exposure to N-acetyl-L-cysteine,
which is widely used to protect against oxidative stress. We
also provide evidence that our in vitro analyses successfully
predict previously unrecognized effects of developmental
Author Summary
Discovering general principles underlying the effects of toxicant
exposure on biological systems is one of the central challenges of
toxicological research. We have discovered a previously unrecog-
nized regulatory pathway on which chemically diverse toxicants
converge, at environmentally relevant exposure levels, to disrupt the
function of progenitor cells of the developing central nervous
system. We found that the ability of low levels of methylmercury,
lead, and paraquat to make progenitor cells more oxidized causes
activation of an enzyme called Fyn kinase. Activated Fyn then
activates another enzyme (c-Cbl) that modifies specific proteins—
receptors that are required for cell division and survival—to initiate
the proteins’ degradation. By enhancing degradation of these
receptors, their downstream signaling functions are repressed.
Analysis of developmental exposure to methylmercury provided
evidence that this same pathway is activated in vivo by environ-
mentally relevant toxicant levels. The remarkable sensitivity of
progenitor cells to low levels of toxicant exposure, and the discovery
of the redox/Fyn/c-Cbl pathway as a mechanism by which small
increases in oxidative status can markedly alter cell function, provide
a novel and specific means by which exposure to chemically diverse
toxicants might perturb normal development. In addition, the
principles revealed in our studies appear likely to have broad
applicability in understanding the regulation of cell function by
alterations in redox balance, regardless of how they might be
generated.
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350213
The Redox/Fyn/c-Cbl Pathway
Page 2
MeHg exposure at levels 90% below those previously
considered to represent low-dose exposure levels.
Results
Exposure to Environmentally Relevant Levels of MeHg
Causes Glial Progenitor Cells to Become More Oxidized
and Suppresses Their Division
The progenitor cells that give rise to the myelin-forming
oligodendrocytes of the CNS offer multiple unique advan-
tages for the study of toxicant action, particularly in the
context of analysis of toxicant effects mediated by changes in
intracellular redox sta te. These progenitor s (which are
referred to as both oligodendrocyte-type-2 astrocyte [O-2A]
progenitor cells ([47] and oligodendrocyte precursor cells,
here abbreviated as O-2A/OPCs) are o ne of the most
extensively studied of progenitor cell populations (reviewed
in, e.g., [48–52]. They also are among a small number of
primary cell types that can be analyzed as purified popula-
tions, and at the clonal level, and for which there is both
extensive information on the regulation of their development
and also evidence of their importance as targets of multiple
toxicants (including such chemically diverse substances as Pb
[38,53], ethanol [e.g., [54–57]], and triethyltin [10,58]).
Another important feature of O-2A/OPCs, in regard to the
present studies, is that their responsiveness to small (;15%–
20%) changes in the intracellular redox state provides a
central integrating mechanism for the control of their
division and differentiation [59]. O-2A/OPCs purified from
developing animals on the basis of the cell’s intracellular
redox state exhibit strikingly different propensities to divide
or differentiate. Cells that are more reduced at the time of
their isolation undergo extended division when grown in the
presence of platelet-derived growth factor (PDGF, the major
mitogen for O-2A/OPCs [60–62]), whereas those that are more
oxidized are more prone to undergo differentiation [59].
Pharmacological agents that make cells slightly more reduced
enhance self-renewal of dividing progenitors, whereas phar-
macological agents that make cells more oxidized, by as little
as 15%–20%, suppress division and induce oligodendrocyte
generation. Moreover, cell-extrinsic signaling molecules (e.g.,
neurotrophin-3 [NT-3] and fibroblast growth factor-2 [FGF-
2]) that enhance the self-renewal of progenitors dividing in
response to PDGF cause cells to become more reduced. In
contrast, signaling molecules that induce differentiation to
oligodendrocytes (i.e., thyroid hormone [TH] [63,64]) or
astrocytes (i.e., bone morp hogenetic protein-4 [BMP-4]
[65,66]) cause cells to become more oxidized [59]. The ability
of these signaling molecules to alter redox state is essential to
their mechanisms of action, because pharmacological inhib-
ition of the redox changes they induce blocks their effects on
either division or differentiation of O-2A/OPCs. Thus, multi-
ple lines of evidence have demonstrated that responsiveness
to small changes in redox status represents a central
physiological control point in these progenitor cells (as
summarized in Figure 1).
We initiated our studies of toxicant effects on O-2A/OPCs
with an examination of MeHg, which has been previously
studied for its effects on neuronal migration, differentiation,
and survival, and on astrocyte function (e.g., [67–74]). Little is
known about the effects of MeHg on the oligodendrocyte
lineage, despite the fact that there are several reports over the
past two dec ades documenting decrease s in conduction
velocity in the auditory brainstem response (ABR) of MeHg-
exposed children [75–78] and rats [79]. Such a physiological
alteration has long been considered to be indicative of
myelination abnormalities in children whose development
has been compromised by iron deficiency (see, e.g., [80,81]).
We found that exposure of O-2A/OPCs (growing in chemi-
cally defined medium supplemented with PDGF) to environ-
mentally rele vant levels of MeHg makes these cel ls
approximately 20% more oxidized (Figure 2A), a degree of
change similar to that previously associated with reductions
in progenitor cell division [59]. Exposure to MeHg inhibited
progenitor cell division as determined both by analysis of
bromodeoxyuridine (BrdU) incorporation (Figure 2B) and by
analysis of cell division in individual clones of O-2A/OPCs
(Figure 2C–2E). These oxidizing effects of MeHg were seen at
exposure levels as low as 20 nM, less than the 5.8 lg/l or more
(i.e., parts per billion [ppb]) of MeHg found in cord blood
specimens of as many as 600,000 infants in the US each year
[46] and 0.3% or less of the exposure levels previously found
to induce oxidative changes in astrocytes [4]. Exposure to 20
nM MeHg was sufficient to cause an approximately 25% drop
in the percentage of O-2A/OPCs incorporating BrdU in
response to stimulation with PDGF. When examined at the
clonal level, MeHg exposure was associated with a reduction
in the number of large clones and an increase in the number
of small clones, as seen for other pro-oxidant stimuli [59].
Increasing MeHg exposure levels above 50 nM was associated
with significant lethality, but little or no cell death was
observed at the lower concentrations used in the present
studies (unpublished data). Thus, division of O-2A/OPCs
exhibits a striking sensitivity to low concentrations of MeHg.
MeHg Exposure Reduces the Effects of PDGF from the
Nucleus Back to the Receptor
One possible explanation for the reduced division asso-
ciated with MeHg exposure would be disruption of PDGF-
mediated signaling, and molecular analysis revealed that
exposure of O-2A/OPCs to 30 nM MeHg for 24 h suppressed
PDGF-induced signaling pathway activation at multiple
points from the nucleus back to the receptor. One pathway
Figure 1. Diagrammatic Summary of the Role of Redox Regulation in
Modulating Division and Differentiation of O-2A/OPCs
Progenitor cells are induced to divide by exposure to PDGF. Induced to
divide by PDGF alone, progenitors will undergo a limited number of
divisions while asymmetrically generating oligodendrocytes. The balance
between division and differentiation is modulated, however, by the
intracellular redox state [59]. Cells that are more oxidized tend to
differentiate, whereas those that are more reduced undergo more self-
renewal. Pharmacological agents that make cells more oxidized induce
differentiation of dividing O-2A/OPCs into oligodendrocytes. Similarly,
signaling molecules that induce differentiation (e.g, TH) make cells more
oxidized as a necessary part of their mechanism of action. In contrast,
pharmacological agents that make cells more reduced promote self-
renewal, and signaling molecules that enhance self-renewal (e.g, NT-3)
make cells more reduced as a necessary part of their mechanism of
action.
doi:10.1371/journal.pbio.0050035.g001
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350214
The Redox/Fyn/c-Cbl Pathway
Page 3
stimulated by PDGF binding to t he PDGF receptor- a
(PDGFRa) leads to sequential activation of Raf-1, Raf-kinase,
and extracellular signal-regulated kinase 1 and 2 (ERK1/2),
which further leads to activation of the Elk-1 transcription
factor and up-regulation of immediate early-response gene
expression, at least in part through activation of the serum
response element (SRE) promoter sequence [82,83]. MeHg
exposure was associated with reduced expression of an SRE-
luciferase reporter gene (Figure 3A), and reduced ERK1/2
phosphorylation (Figure 3B). PDGFRa activation also stim-
ulates activity of PI-3 kinase, leading to activation of Akt and
induction of NF-jB–mediated transcription (e.g., [82,84,85]),
both of which also were inhibited by MeHg exposure.
Expression of an NF-jB-luciferase reporter gene was
decreased (Figure 3C), as was phosphorylation of Akt (Figure
3D). Phosphorylation of PDGFRa, indicating receptor acti-
vation, was also reduced in cells exposed to MeHg (Figure 3E).
Because O-2A/OPCs growing in these cultures are absolutely
dependent upon PDGF for continued division (e.g.,
[60,61,86]), the suppression of PDGF signaling would neces-
sarily cause a reduction in cell division.
Pathway-Specific Disruption of PDGF-Mediated Signaling,
and Reductions in Levels of PDGFRa, Induced by MeHg
We next found that the effects of MeHg were pathway
specific and were associated with reductions in total levels of
PDGFRa. O-2A/OPCs exposed to 30 nM MeHg exhibited no
reduction in ERK1/2 phosphorylation induced by exposure to
NT-3 (Figure 4A), and no reduction in NT-3–induced
expression from an SRE-luciferase reporter construct (un-
published data). This result suggested that the site of action of
MeHg was upstream of ERK1/2 regulation, prompting us to
look directly at the PDGFRa. We found that the reduction in
phosphorylated PDGFRa (Figure 3E) was paralleled by a
reduction in levels of the PDGFRa itself (Figure 4B). In
contrast, no reduction in levels of TrkC (the receptor for NT-
3 [87]) was caused by exposure to MeHg (Figure 4C).
Fyn and c-Cbl Activation, and Enhanced Degradation of
PDGFRa Induced by MeHg
One possible explanation for the ability of MeHg to cause a
reduction in PDGF-mediated signaling and in total levels of
PDGFRa, without affecting NT-3–mediated signaling or TrkC
levels, would be that exposure to this toxicant leads to
activation of c-Cbl, an E3 ubiquitin ligase that ubiquitylates
the activated PDGFRa [88,89], thus leading to its internal-
ization and potential lysosomal degradation [90–92]. Such a
possibility is particularly intriguing in light of multiple
reports that c-Cbl can be activated by Fyn kinase (e.g., [93–
96]), a Src family kinase that can be activated by oxidative
stress [97–100]. O-2A/OPCs are known to express Fyn, which
has been studied in these cells for its effects on regulation of
RhoA ac tivity and control of cytoskeletal organization
[101,102]. Because TrkC does not appear to be regulated by
c-Cbl, redox-modulated activation of Fyn, leading to c-Cbl
activation and enhanced PDGFRa degradation, would pro-
vide a potential mechanistic explanation integrating the
observations reported thus far.
Figure 2. MeHg Exposure Makes O-2A/OPCs More Oxidized, Suppresses BrdU Incorporation, and Decreases Cell Division in Clonal Assays
(A) Purified O-2A/OPCs were grown in the presence of 10-ng/ml PDGF overnight. Effects of MeHg on intracellular redox state were determined by
analysis of 29,79-dichlorodihydrofluorescein diacetate fluorescence emission in O-2A progenitors exposed to 20 nM MeHg for various lengths of time, as
indicated.
(B) Cells were plated in medium containing PDGF and then exposed to 20 nM MeHg for an additional 72 h. During the last 4 h of exposure, cultures
were also exposed to BrdU. Cultures were then stained with A2B5 and anti-BrdU antibodies (to recognize all progenitors and those synthesizing DNA
during the BrdU pulse, respectively). Results are presented as comparison with control cultures.
(C–E) Suppression of cell division by exposure to MeHg was studied in more detail at the clonal level. Cells were treated as for (B), except for being
plated at clonal density (as in [59,199]). Cultures were maintained for 6 d, and then 100 randomly chosen clones were analyzed for their composition (as
in [59,64,199]). Data are presented, for all clones analyzed, in three dimensions such that the x-axis equals the number of progenitors per clone, the z-
axis equals the number of oligodendrocytes (Oligo) per clone, and the y-axis equals the number of clones with any given composition. In cultures
exposed to MeHg, there was a decrease in the representation of large clones and a proportionate increase in the number of small clones and clones
containing oligodendrocytes. The effects of MeHg were prevented by co-exposure of cells to 1 mM N-acetyl-L-cysteine (NAC).
All experiments were repeated at least three times, and all numerical values represent means 6 SD for triplicate data points.
doi:10.1371/journal.pbio.0050035.g002
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350215
The Redox/Fyn/c-Cbl Pathway
Page 4
A variety of data support the hypothesis that MeHg
exposure activates Fyn, leading to activation of c-Cbl,
followed by degradation-mediated reductions in levels of
activated PDGFRa. Exposure of O-2A/OPCs to 30 nM MeHg
stimulated Fyn activation and c-Cbl phosphorylation (Figure
5A and 5B). Activation of Fyn and c-Cbl was blocked by the
Src family kinase inhibitors PP1 (Figure 5A and 5B) and PP2
(unpublished data). We next found that exposure to MeHg
enhanced ubiquitylation of PDGFRa (a predicted conse-
quence of c-Cbl activation), an increase readily observed even
in the presence of markedly reduced levels of the receptor
itself (Figure 5C). Co-exposure to ammoni um chloride
(NH
4
Cl, a lysosomotropic weak base that increases lysosomal
pH and disrupts lysosomal protein degradation [103–105])
prevented receptor degradation, and was associated with
increased levels of ubiquitylated receptor in treated O-2A/
OPCs. The increase in levels of ubiquitylated receptor was as
predicted by the lack of effect of NH
4
Cl on either Fyn
Figure 3. MeHg Suppresses PDGF-Mediated Signaling from the Nucleus Back to the Receptor
(A) Progenitors transfected with an SRE-luciferase reporter construct and exposed to 30 nM MeHg (24 h) showed significantly lower levels of reporter
activity. *, p , 0.05.
(B) Cells grown as in (A) and analyzed for phosphorylation of ERK1/2 showed reduced ERK1/2 phosphorylation.
(C) Cells transfected with an Nf-jB-luciferase reporter construct and treated as in (A) showed reduced Nf-jB transcriptional activity. **, p , 0.01.
(D) Cells grown as in (A) showed lower levels of Akt (Thr 308) phosphorylation.
(E) Cells grown as in (A) also showed decreased phosphorylation of PDGFRa (as detected with anti-PDGFRa(pY
742
) antibody). All effects of MeHg were
prevented by growth of cells in the additional presence of 1 mM NAC.
All experiments were repeated at least three times, and all numerical values represent means 6 SD for triplicate data points. The plus symbol indicates
exposure of the cells to the indicated substance.
doi:10.1371/journal.pbio.0050035.g003
Figure 4. MeHg Effects Are Pathway Specific and Are Associated with Reduced Levels of PDGFRa
(A) MeHg does not inhibit ERK1/2 phosphorylation induced by exposure to NT-3. Cells were grown as in Figure 2A, but exposed to NT-3 instead of
PDGF. As shown, MeHg exposure did not reduce the extent of ERK1/2 phosphorylation induced by exposure to NT-3, thus indicating that the site of
action of MeHg is not on the level of these kinases.
(B) Consistent with the indication from these results that effects of MeHg were mediated further upstream in the PDGF-signaling pathway, analysis of
cells treated in the same manner showed reductions in total levels of PDGFRa. The effects of MeHg on total levels of PDGFRa were prevented by co-
exposure with NAC.
(C) Exposure to MeHg was not associated with reductions in levels of TrkC, indicating that receptor loss was mediated by a mechanism that
distinguishes between PDGFRa and TrkC.
All experiments were repeated at least three times. The plus symbol indicates exposure of the cells to the indicated substance.
doi:10.1371/journal.pbio.0050035.g004
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350216
The Redox/Fyn/c-Cbl Pathway
Page 5
activation or c-Cbl phosphorylation (Figure 5A and 5B).
Treatment with PP1, which inhibits Fyn activity (Figure 5A),
was also associated with a marked reduction in the amount of
ubiquitylated PDGFRa, particularly in comparison with levels
of total receptor (compare upper and lower lanes in Figure
5C). As further confirmation that reductions in levels of
PDGFRa were due to protein degradation, exposure to MeHg
did not have any significant effects on levels of PDGFRa
mRNA, as determined by quantitative PCR analysis (Figure
S1A). In the presence of cycloheximide, an inhibitor of
protein synthesis, MeHg further accelerated receptor loss as
compared with that occur ring solely due to failure to
synthesize new protein (Figure S1B). Collectively, these results
indicate that MeHg enhances active degradation of PDGFRa,
as contrasted with reducing receptor levels as an indirect
consequence of altering transcriptional or translational
regulation of receptor levels.
Molecular confirmation of the role of Fyn and c-Cbl in the
effects of MeHg on levels of PDGFRa was obtained by
expression of dominant negative c-Cbl, or small inhibitory
RNA (RNAi) for Fyn or Cbl, in MeHg-exposed O-2A/OPCs.
Expression of the dominant-negative (DN) 70z mutant of c-
Cbl [106–108] in O-2A/OPCs prevented MeHg-induced
reductions in levels of PDGFRa (Figure 6A). Reduction in
levels of Fyn protein by introduction of Fyn-specific small
interfering RNA (siRNA) constructs (Figure 6B) also pro-
tected against MeHg-induced reductions in levels of PDGFRa
(Figure 6C), as predicted by the hypothesis that MeHg-
Figure 5. MeHg Exposure Causes Activation of Fyn, Phosphorylation of c-Cbl, and Ubiquitylation of PDGFRa Leading to Reductions in Receptor Level
(A) O-2A/OPCs exposed to 30 nM MeHg exhibited higher levels of Fyn kinase activity, as detected by analysis of immunoprecipitated Fyn from these
cells using the Universal Tyrosine Kinase Assay Kit (Takara), as described in Materials and Methods. Values (mean 6 SD) are expressed as the percent of
controls, which were defined from basal Fyn kinase activity without any stimulation. All bars with increased levels of Fyn activity differ from control
values at p , 0.001. Increased Fyn activity was blocked by pre-treatment of cells with NAC or with the src-family kinase inhibitor PP1, but not by pre-
treatment with NH
4
Cl (an inhibitor of lysosomal function).
(B) As for (A), Increased c-Cbl phosphorylation (see Materials and Methods for immunoprecipitation assay) associated with MeHg exposure was blocked
by co-exposure of cells to NAC or PP1, but was not blocked when cells were exposed to NH
4
Cl.
(C) Exposure to MeHg was associated with a marked increase in the levels of ubiquitylation of PDGFRa, with this increase being apparent even though
receptor levels were themselves reduced by toxicant exposure. NH
4
Cl treatment was associated with rescue of levels of total PDGFRa, and therefore
was associated with a still more marked increase in the amount of ubquitylated receptor detected. As predicted by the hypothesis that both receptor
ubiquitylation and receptor loss are due to activation of Fyn, co-exposure of cells to PP1 rescued receptor levels and greatly reduced the extent of
receptor ubiquitylation.
The plus symbol (þ) indicates exposure of the cells to the indicated substance. IB ¼ immunoblot; IP ¼ immunoprecipitation.
doi:10.1371/journal.pbio.0050035.g005
Figure 6. MeHg-Induced Reductions in PDGFRa Levels Were Prevented by Expression of DN(70Z) c-Cbl and by Expression of Fyn-Specific RNAi
Constructs
(A) Expression (by transfection, as described in Materials and Methods) of DN(70Z) c-Cbl prevented MeHg-induced reductions in levels of PDGFRa,an
effect not obtained with vector alone (pBabe).
(B) Expression of Fyn-specific RNAi (as described in Materials and Methods) caused a reduction in levels of Fyn protein, whereas scrambled (Scr) controls
had no effect on levels of this protein. Data are presented as comparisons with levels of Fyn protein in non-manipulated cells.
(C) Expression of Fyn-RNAi constructs, but not of Fyn-Scr-RNAi protected O-2A/OPCs from MeHg-induced reductions in levels of total PDGFRa. Fyn RNAi
constructs had no effects on levels of tubulin or on levels of c-Cbl (unpublished data).
All experiments were repeated at least three times. The plus symbol indicates exposure of the cells to the indicated substance.
doi:10.1371/journal.pbio.0050035.g006
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350217
The Redox/Fyn/c-Cbl Pathway
Page 6
induced activation of Fyn mechanistically precedes reduc-
tions in receptor levels. Similar results were obtained using
RNAi constructs for c-Cbl, but are presented later in the
paper, in the context of analysis of other toxicants.
Suppression of Fyn or c-Cbl activity, or overexpression of
PDGFRa itself, also protected against the functional effects of
MeHg exposure (Figure 7). Pharmacological inhibition of Fyn
activity with PP1 enabled analysis of O-2A/OPC division at
the clonal level, and demonstrated that PP1 blocked MeHg-
induced suppression of cell division (Figure 7A). O-2A/OPCs
expressing DN-70Z-c-Cbl and exposed to MeHg were also
protected from effects of MeHg on cell division, as analyzed
by BrdU incorporation (Figure 7B). Co-treatment of MeHg-
exposed O-2A/OPCs with PP1 or NH
4
Cl also blocked MeHg-
associated suppression of ERK1/2 phosphorylation (and
MeHg-induced reductions in levels of PDGFRa, indicating
that ERK1/2 suppression was a secondary consequence of the
effects of Fyn and c-Cbl activation (Figure 7C). Overexpres-
sion of PDGFRa in MeHg-exposed O-2A/OPCs also protected
cells from MeHg-associated reductions in ERK1/2 phosphor-
ylation (Figure 7D).
Convergence of Chemically Diverse Toxicants on
Activation of Fyn and c-Cbl, and Reductions in Levels of
PDGFRa
To determine whether effects of MeHg revealed a general
mechanism by which chemically diverse toxicants with pro-
oxidant activity could alter cellular function in similar ways,
we next examined the effects of exposure of dividing O-2A/
OPCs to Pb (a heavy metal toxicant) and paraquat (an organic
herbicide). As discussed in the Introduction, these toxicants
both make cells more oxidized, but through mechanisms that
differ between them and also from effects of MeHg.
Despite their chemical differences from MeHg, and from
each other, Pb and paraquat had apparently identical effects
as MeHg on ERK1/2 phosphorylation, activation of Fyn and c-
Cbl, and reductions in levels of phosphorylated PDGFRa and
on total levels of PDGFRa (Figure 8). O-2A/OPCs were
exposed to 1 lM Pb (equivalent to the level of 20 lg/dl that
is known to be associated with cognitive impairment, and a
level of Pb previously found to inhibit O2A/OPC division
without causing cell death [38,53,109]) or to 5 lM paraquat
(an exposure level selected as being in the lowest 0.1% of the
Figure 7. Inhibition of Fyn Activity, c-Cbl Activity, or of Lysosomal Function Rescues Cell Division and/or ERK1/2 Phosphorylation in MeHg-Treated O-
2A/OPCs
(A) Purified O-2A/OPCs were plated at clonal density and analyzed as for Figure 2. After 24 h, MeHg was added to cultures in the presence or absence of
PP1. MeHg by itself was associated with a reduction in the contribution of large clones dominated by progenitors and an increased representation of
smaller clones and of oligodendrocytes. Co-exposure to PP1 rescued cells from the effects of MeHg.
(B) Expression of DN(70Z) c-Cbl rescued purified progenitors from MeHg-associated suppression of BrdU incorporation. It was notable that expression of
DN(70Z) c-Cbl also rescued cells from the effects of 50 nM MeHg, raising the possibility that further exploration of this pathway will reveal additional
roles in cell survival (a topic to be explored in future research). *, p , 0.05; **, p , 0.01.
(C) Co-exposure of cells to NH
4
Cl or PP1 together with MeHg protected cells from MeHg-induced suppression of ERK1/2 and PDGFRa phosphorylation
and reductions in total levels of PDGFRa.
(D) Overexpression of PDGFRa also rescued cells from MeHg-induced suppression of ERK1/2 phosphorylation, whereas expression of a control construct
(pBP) did not rescue ERK1/2 phosphorylation.
All experiments were repeated at least three times, and all numerical values represent means 6 SD for triplicate data points. The plus symbol (þ)
indicates exposure of the cells to the indicated substance.
doi:10.1371/journal.pbio.0050035.g007
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350218
The Redox/Fyn/c-Cbl Pathway
Page 7
range of paraquat concentrations studied by others in vitro,
which range from 8 lM–300 mM (e.g., [110–114]). Pb and
paraquat exposure at these levels did not cause cell death, but
did make O-2A/OPCs approximately 20% more oxidized, as
determined by analysis of cells with the redox-indicator dyes
dihydro-chloromethyl-rosamine or dihydro-calcein-AM (un-
published data). Both Pb and paraquat exposure were
associated with activation of Fyn (Figure 8A), increased
phosphorylation of c-Cbl (Figure 8B), reduced levels of
ERK1/2 phosphorylation, and reduced levels of phosphory-
lated and total PDGFRa (Figure 8C). As for MeHg, the effects
of Pb and paraquat on PDGFRa levels were prevented by
expression of RNAi for c-Cbl (Figure 8D), DN(70Z) c-Cbl, or
RNAi for Fyn (unpublished data).
It has previously been suggested that the effects of Pb on O-
2A/OPCs are mediated through activation of PKC [38], a
pathway that has not been implicated in the activity of MeHg
or paraquat. To determine whether PKC inhibition could
distinguish between effects of Pb versus MeHg or paraquat,
and to determine if PKC activation was relevant to the effects
of toxicants on Fyn or c-Cbl activation or reductions in
PDGFRa levels, we next examined the effects of co-exposure
of O-2A/OPCs to bisindolylmaleimide I (BIM-1, a broad-
spectrum PKC inhibitor previously used in the analysis of the
role of PKC activation in the effects of Pb on O-2A/OPCs
[38]). As shown in Figure S2, we found that co-exposure of O-
2A/OPCs to BIM-1 with Pb, MeHg, or paraquat did not
prevent toxicant-mediated activation of Fyn (Figure S2A) or
c-Cbl (Figure S2B). BIM-1 co-exposure also did not protect
against MeHg-, Pb- or paraquat-induced reductions in levels
of PDGFRa (Figure S2C).
Protection by Cysteine Pro-Drugs
If it is correct that Fyn activation, with its consequences, is
regulated by the ability of toxicants to make cells more
oxidized, then antagonizing such redox changes should
prevent Fyn activation. Previous studies have shown that an
effective means of preventing the increase in oxidative status
and the suppression of cell division caused by exposure of O-
2A/OPCs to TH is to treat cells with N-acetyl-L-cysteine
(NAC), a cysteine pro-drug that is readily taken up by cells
and converted to cysteine [59]. Cysteine is the rate-limiting
Figure 8. Pb and Paraquat Exposure Caused Activation of Fyn and c-Cbl, Suppression of ERK1/2 Phosphorylation, and Reduction in Levels of PDGFRa
(A) Purified O-2A/OPCs were treated as for analysis of MeHg, except that cells were exposed to 1 lMPbor5lM paraquat. Both toxicants caused
activation of Fyn, analyzed as in Figure 5.
(B) Pb and paraquat exposure also caused phosphorylation of c-Cbl, as detected by immunoprecipitation of total c-Cbl followed by analysis with anti-
phosphotyrosine antibody.
(C) Pb and paraquat exposure cause suppression of ERK1/2 phosphorylation and reductions in total levels of PDGFRa.
(D) Expression of c-Cbl RNAi caused a reduction in levels of c-Cbl protein and protected PDGFRa levels from effects of MeHg, Pb, and paraquat, whereas
scrambled (Scr) RNAi constructs had no levels of PDGFRa. NAC (or procysteine, a cysteine pro-drug with no intrinsic anti-oxidant activity) protected
against all effects of toxicant exposure.
All experiments were repeated at least three times. The plus symbol indicates exposure of the cells to the indicated substance.
doi:10.1371/journal.pbio.0050035.g008
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350219
The Redox/Fyn/c-Cbl Pathway
Page 8
precursor for synthesis of glutathione, one of the major
regulators of intracellular redox status (e.g., [115,116]. NAC
also possesses anti-oxidant activity, has long been used as a
protector against many typesofoxidativestress(e.g.,
[9,117,118]), and has been shown to confer protection against
a wide range of toxicants, including MeHg (e.g., [119–121]), Pb
(e.g., [9,122,123]), and paraquat (e.g., [17,124]), as well as such
other substances as aluminum [125], cadmium [126], arsenic
[127], and cocaine [128].
As predicted by the hypothesis that the pro-oxidant
activities of chemically diverse toxicants are causal in Fyn
activation, NAC was equally effective at preventing Fyn
activation—and its consequences—induced by exposure to
MeHg, Pb, or paraquat (Figures 2–5, 7, and 8). For cells grown
at the clonal level, NAC blocked the suppressive effects of
MeHg on cell division (Figure 2). NAC also blocked all effects
of MeHg on PDGF-mediated signaling, and rescued normal
level of activity o f SRE and NF-kB promoter-reporter
constructs and levels of phosphorylation of ERK1/2, Akt,
and PDGFRa (Figure 3). Consistent with the hypothesis that
Fyn is activated when cells become more oxidized [97–100],
NAC also blocked MeHg-induced activation of Fyn and
phosphorylation of c-Cbl (Figure 5), and prevented MeHg-
induced reductions in levels of PDGFR a (Figure 4). Critically,
for the hypothesis that Pb and paraquat effects also were
mediated by changes in redox state, NAC also blocked the
effects of Pb and paraquat on Fyn activation and c-Cbl
phosphorylation, and protected against effects of these
toxicants on ERK1/2 phosphorylation and levels of PDGFR
(Figure 8). Levels of PDGFRa were also protected by exposure
of O-2A/OPCs to procysteine (Figure 8), a thiazolidine-
derivative cysteine pro-drug that differs from NAC in having
no intrinsic anti-oxidant activity [129]. Although it is
conceivable that the ability of cysteine pro-drugs to protect
against the effects of MeHg, Pb, and paraquat is due to
enhanced toxicant clearance associated with elevated levels of
glutathione, analysis of Pb uptake with Leadmium Green AM
(a fluorescent indicator of Pb levels) showed no significant
difference in Pb levels between cells exposed to Pb as
compared with cells exposed to Pb and NAC (Figure S3).
The ability of NAC to block toxicant-induced activation of
Fyn raises the question of whether this is due to a true
prevention of the effects of toxicant exposure on activation
of this kinase or, alternatively, is due to an ability of NAC to
independently suppress Fyn activity to such an extent that
the apparent block of toxicant effects instead represents the
summation of two opposing influences of equivalent magni-
tude. To evaluate these two possibilities, O-2A/OPCs were
exposed to 1 mM NAC in the absence of toxicants, and Fyn
and c-Cbl activation were evaluated as in Figure 5. We found
that NAC exposure had only a slight, and nonsignificant,
effect on the levels of basal Fyn activity in O-2A/OPCs (Figure
9A). In agreement with this outcome, NAC exposure did not
have any marked effect on levels of c-Cbl phosphorylation
(Figure 9B). Thus, it appears that NAC-mediated counter-
action of the effects of toxicants on Fyn activation is far
greater in its magnitude than its direct effects on basal levels
of Fyn activity.
Toxicants Cause Reductions in Levels of Other c-Cbl
Targets
If the hypothesis is correct that exposure of O-2A/OPCs to
toxicants causes activation of the Fyn/c-Cbl pathway, then
other c-Cbl targets should be affected similarly to th e
PDGFRa. One member of the c-Cbl interactome [92] known
to be expressed by O-2A/OPCs is c-Met [130], the receptor for
hepatocyte growth factor (HGF; [131,132]). Oligodendrocytes
also have recently be en reported to be responsive to
epidermal growth factor (EGF) application with morpholog-
ical changes [133], and microarray analysis confirms that the
EGF receptor (EGFR) is expressed by O-2A/OPCs (C. Pro
¨
schel
and M. Noble, unpublished results). The EGFR is perhaps the
most extensively studied RTK target of c-Cbl [90,96,107,134–
137], but c-Met regulation by c-Cbl appears to follow similar
principles [106,138].
As shown in Figure 10, exposure of O-2A/OPCs to MeHg
was associated with reductions in levels of c-Met (Figure 10A)
and EGFR (Figure 10B). As predicted by the hypothesis that
Pb and paraquat converge with MeHg on activation of the
Fyn/c-Cbl pathway, levels of C-Met and EGFR were also
reduced in O-2A/OPCs exposed to these additional toxicants.
Consistent with the hypothesis that such changes were
associated with the ability of toxicants to make cells more
oxidized, NAC protected both c-Met and EGFR levels from
Figure 9. Exposure of O-2A/OPCs to 1 mM NAC Has Only Minimal Effects on Basal Activity of Fyn or Phosphorylation of c-Cbl
Assays of Fyn activity and c-Cbl phosphorylation were carried out as in Figure 5, except that cells were exposed only to NAC and not to MeHg.
(A) Basal Fyn activity is slightly, but not significantly, lower in cells exposed to NAC.
(B) The extent of c-Cbl phosphorylation in O-2A/OPCs exposed to NAC is similar to that seen in cells grown in the presence of PDGF only. IB ¼
immunoblot; IP ¼ immunoprecipitation
doi:10.1371/journal.pbio.0050035.g009
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350220
The Redox/Fyn/c-Cbl Pathway
Page 9
reductions associated with exposure to MeHg, Pb, or para-
quat.
Further support for the Fyn/c-Cbl hypothesis of toxicant
convergence was provided by observations that neither Pb or
paraquat caused a reduction in levels of TrkC (Figure 10C),
just as observed for MeHg (Figure 4C).
Developmental Exposure to Low Levels of MeHg in Vivo
Causes Reductions in Levels of PDGFRa and EGFR, but Not
TrkC, and Causes Reduced Division of O-2A/OPCs
Although the central goal of the present studies was the
identification of mechanistic pathways on which chemically
diverse toxicants converge, it is important to also consider
whether any aspects of our in vitro findings are predictive of
in vivo outcomes. Although detailed in vivo investigations will
be the subject of future studies, we have tested three of the
key findings of our present work for which previous studies
are not predictive of likely experimental outcomes.
The three questions we examined in vivo were whether
toxicant exposure is associated with specific reductions in
RTKs that are c-Cbl targets, whether this occurs at levels of
toxicant exposure approximating the effects of environ-
mental exposure, and whether such exposure can be shown to
cause subtle changes in O-2A/OPC function. These experi-
ments were conducted entirely with MeHg for several
reasons. First, there is already extensive evidence that Pb
exposure in vivo has adverse effects on myelination and on O-
2A/OPCs (e.g., [38,43,53,139–142]). In contrast, evidence that
MeHg exposure may have any effects on myelination thus far
comes only from observations of increased latencies in ABRs
[75–79], with no studies examining effects of this toxicant on
the function of c ells important fo r myeli nation (i.e.,
oligodendrocytes or their ancestral O-2A/OPCs). Third,
previous studies on mice have not been conducted using
levels of exposure of broad environmental relevance. Instead,
such studies have defined a low exposure range as being
exposure of animals to MeHg in their drinking water at a
concentration of one or more parts per million (e.g., [143–
147]), an exposure level considerably higher than what our
studies would predict as being necessary to affect progenitor
cells of the developing CNS. Thus, the question of whether
MeHg exposure levels of broader environmental relevance
would have any effects at all in vivo appears to be largely
unaddressed.
To test the hypothesis that environmentally relevant levels
of MeHg exposure can perturb the developing CNS in subtle
ways, we exposed SJL mice to 100 or 250 ppb MeHg in their
drinking water throughout gestation, and maintained this
exposure until sacrifice of pups at 7 and 21 d after birth. As
discussed in Materials and Methods, these exposure levels
enabled us to approximate the predicted mercury levels in
the CNS of 300,000–600,000 infants in the US. The exposure
levels examined in our studies are 75%–90% below what has
otherwise been considered to be low-dose exposure in mice.
We found that developmental exposure of mice to MeHg at
either 100 ppb or 250 ppb in the maternal drinking water was
associated with clear and significant reductions in levels of
PDGFRa and EGFR, but not of TrkC (Figure 11). Treatment
of SJL mice with 100 or 250 ppb MeHg in the drinking water
during gestation and suckling was associated with reductions
in levels of PDGFRa and EGFR in the cerebellum, hippo-
campus, and corpus callosum when brain tissue was sampled
at 7 and 21 d after birth. In contrast, levels of the NT-3
receptor TrkC were not red uced in these animals, as
predicted by our in vitro analyses. It was particularly striking
that exposure even to 100 ppb MeHg in the drinking water
was enough to have significant effects on levels of PDGFRa
and EGFR. These changes, and the lack of effect of MeHg
exposure on TrkC levels, are as predicted from our in vitro
analyses.
Analysis of BrdU incorporation revealed that these low
levels of MeHg exposure also were associated with statistically
significant reductions in the division of O-2A/OPCs in vivo. In
these experiments, postnatal day 14 (P14) animals were
treated as for analysis of receptor levels except that BrdU
was administered 2 h before sacrifice. Sections then were
analyzed with anti-BrdU antibodies to identify cells engaged
in DNA synthesis and with antibodies to olig2 to identify O-
2A/OPCs (as in [148]). Olig2 is a transcriptional regulator
expressed in oligodendrocytes and their ancestral precursor
cells (e.g., [50,149–152]. In white matter tracts of the CNS,
BrdU
þ
cells that express Olig2 are considered to be O-2A/
OPCs [153,154]). In our studies, greater than 90% of all BrdU
þ
cells in the corpus callosum were also Olig2
þ
. When we
analyzed the number of Olig2
þ
/BrdU
þ
cells found in the
corpus callosum of control and experimental animals (see
Materials and Methods for details of analysis), we found a
20% reduction in the number both of total BrdU
þ
cells and of
Olig2
þ
/BrdU
þ
cells (Figure 11), an outcome in agreement with
the results of our in vitro studies (Figure 2B).
Figure 10. Exposure to MeHg, Pb, and Paraquat Caused Reductions in Levels of c-Cbl Targets c-Me and EGFR, but Not of TrkC
Cells were analyzed as for Figure 5, but with antibodies against c-Met and EGFR. The results for the c-Cbl Targets c-Met (A), EGFR (B), and TrkC (C) are
shown. All experiments were repeated at least three times.
doi:10.1371/journal.pbio.0050035.g010
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350221
The Redox/Fyn/c-Cbl Pathway
Page 10
Discussion
Our studies demonstrate that chemically diverse toxicants
converge on activation of a previously unrecognized pathway
of cellular regulation that leads from increases in oxidative
status to reductions in levels of specific RTKs. Analysis of
effects of MeHg on O-2A/OPCs dividing in response to PDGF
first demonstrated suppression of PDGF-induced signaling,
but no reduction in NT-3–induced phosphorylation of ERK1/
2. Further analysis demonstrated that M eHg exposure
Figure 11. In Vivo Analysis Confirms That Developmental Exposure to Low Levels of MeHg Is Associated with Specific Reductions in Levels of PDGFRa
and EGFR, but Not of TrkC, and with Reductions in O-2A/OPC Division
Treatment of SJL mice with 100 or 250 ppb MeHg in the maternal drinking water during gestation and suckling was associated with reductions in levels
of PDGFRa in the cerebellum and hippocampus at postnatal day 7 (P7), and in hippocampus and corpus callosum at P21. In contrast, levels of the NT-3
receptor TrkC (which does not appear to be a c-Cbl target) were not reduced in these animals.
(A) Animals were treated with 100 ppb MeHg in the drinking water during pregnancy. Pups were sacrificed at 7 d after birth. Analysis of cerebellum and
hippocampus showed clear reductions in levels of PDGFRa, but not in TrkC.
(B) At P21, enough tissue could also be isolated from corpus callosum for analysis, and was found to have marked reductions in levels of PDGFRa, but
not TrkC.
(C) Quantitative analysis of receptor levels in P7 mice showed reductions in levels of PDGFRa and EGFR, but not TrkC. Quantitative analysis of changes in
receptor expression in tissue from P7 mice. *, p , 0.05; **, p , 0.01)
(D) Analysis of BrdU incorporation in Olig2
þ
cells reveals a reduction of approximately 20% in the number of double-positive cells in P14 animals born to
mothers receiving 100 ppb MeHg in their drinking water beginning 30 d prior to conception and continuing through weaning. The top left figure
shows combined labeling with anti-BrdU and anti-MBP antibodies, and the top right figure shows labeling with anti-olig2 antibodies. These images are
merged in the bottom left to identify BrdU
þ
/Olig2
þ
cells. Quantitative analysis of total numbers of double-positive cells reveals that developmental
exposure to 100 ppb MeHg via the maternal drinking water is associated with a subtle but significant reduction in the number of O-2A/OPCs engaged
in DNA synthesis, consistent with the effects of low-level MeHg exposure in vitro.
Quantitative data are presented as mean percentage normalized to control animals (n ¼ 3 for each group). Error bars represent 6 standard error of the
mean. The plus symbol indicates exposure of the cells to the indicated substance.
doi:10.1371/journal.pbio.0050035.g011
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350222
The Redox/Fyn/c-Cbl Pathway
Page 11
enhanced degradation of PDGFRa as a consequence of the
sequential activation of Fyn and c-Cbl. As predicted by the
hypothesis that MeHg exposure activates the redox/Fyn/c-Cbl
pathway, exposure to this toxicant was also associated with
reductions in levels of EGFR and c-Met (which are c-Cbl
targets), but not in levels of TrkC (which is not a c-Cbl target).
The redox/Fyn/c-Cbl pathway was also activated by Pb and
paraquat, leading to negative modulation of RTK-mediated
signaling by regulating receptor degradation and causing
reductions in levels of PDGFRa, EGFR, and c-Met, but not of
TrkC. Developmental exposure to MeHg was also associated
with reduced levels of PDGFRa and EGFR, but not of TrkC,
consistent with the hypothesis that this same regulatory
pathway is activated in association with in vivo toxicant
exposure.
The results of our studies are novel in a number of ways,
beginning with the identification of a previously unrecog-
nized regulatory pathway activated by chemically diverse
toxicants. Although the importance of identifying general
principles that apply to chemically diverse toxicants is a
widely recognized goal of toxicology research, relatively few
such principles have been identified. For example, although
toxicants may be classified as hormonal mimetics, mutagens,
carcinogens, neurotoxins, etc., relatively few mechanistic
pathways have been identified on which chemically diverse
substances converge.
Our present studies have identified Fyn activation as a
common cellular target for the action of chemically diverse
toxicants with pro-oxidant activity. Whether oxidative
changes are by themselves sufficient to induce sequential
activation of Fyn and c-Cbl will be a subject of continued
analysis, but existing data make it difficult to imagine a
compelling alternative hypothesis to explain our results. Fyn
is well established as being activated when cells become more
oxidized [97–100], and there is no evidence for any other
unifying feature of MeHg, Pb, and paraquat that would cause
Fyn activation. Activation of Fyn, and the effects of activation
of the Fyn/c-Cbl pathway, were blocked by NAC (which
antagonizes oxidative changes in O-2A/OPCs [59]) as effec-
tively as by expression of Fyn-specific RNAi constructs or by
pharmacological inhibition of Fyn activity. NAC protects
against physiological stress in two ways, both as an anti-
oxidant itself and by providing increased levels of cysteine,
the rate-limiting precursor in glutathione biosynthesis (e.g.,
[115,116]). The ability of ProCys (which has no intrinsic anti-
oxidant properties [129]) to confer similar protection as NAC
suggests that it is through their enhancement of glutathione
production that these two cysteine pro-drugs exert their
protective effe cts. The relatively small effect of NAC
exposure by itself on basal Fyn activity in the experimental
conditions used indicates that, at least in these experiments,
NAC’s protective effect was more l ikely t o b e due to
protection against increases in oxidative status than due to
a direct suppression of Fyn activity to an extent that would
neutralize the activating effects of toxicant exposure.
Although increased glutathione levels theoretically could also
protect against the effects of toxicants by enabling enhanced
cellular export of physiological stressors (reviewed in, e.g.,
[155,156]), analysis with Leadmium Green AM (which can
detect intracellular Pb in the nM range) revealed no apparent
effect of NAC treatment on cellular levels of Pb (Figure S3).
Further support for the hypothesis that transport of xeno-
biotics is not a likely explanation for the protective effects of
NAC is also provided by ongoing studies demonstrating that
TH and BMP-4 (both of which cause O-2A/OPCs to become
more oxidized [59]) also cause activation of Fyn and c-Cbl,
with associated reductions in PDGFR a levels (Z. Li and M.
Noble, unpublished data). NAC blocks the effects of TH and
BMP on differentiation, and also prevents TH- and BMP-
mediated activation of Fyn and c-Cbl ([59]; Z. Li and M.
Noble, unpublished data). Changes in intracellular redox
state, and the predicted ability to protect with NAC, are the
common features linking the activation of Fyn with MeHg,
Pb, paraquat, TH, and BMP.
Although Fyn has multiple targets, it seems most likely that
activation of c-Cbl provides the explanation for the effects of
MeHg on PDGF-mediated signaling. Suppression of c-Cbl
activity by expression of DN(70Z) c-Cbl or RNAi protected
against the effects of MeHg on cell division and reductions in
levels of PDGFRa. Moreo ver, the induction of PDGFRa
ubiquitylation by MeHg, the lack of effects of MeHg on
PDGFRa mRNA levels, the rescue of receptor levels by
disrupting lysosomal function, and other observations all
strongly indicate the importance of c-Cbl regulation in
understanding the effects of toxicant exposure. The impor-
tance of Fyn in activation of c-Cbl is supported by the ability
of express ion of Fyn-specific RNAi, or pharmacological
inhibition of Fyn activity, to protect against the effects of
toxicant exposure. Because Fyn activation in O-2A/OPCs also
leads to activation of Rho-GTPase, leading to inhibition of
Rho kinase activity [102,157], we also examined the effects of
treatment of cells with the Rho kinase inhibitor Y23762
(Figure S4). Although this agent inhibited Rho kinase activity
in O-2A/OPCs, it neither protected against nor exacerbated
the effects of MeHg on progenitor cell division (as deter-
mined by BrdU incorporation). Thus, although it will be of
interest to examine the effects of toxicant exposure on other
Fyn targets, it currently seems that Fyn-mediated activation
of c-Cbl is central to understanding the effects of toxicants on
O-2A/OPCs.
The discovery of sequential activation of Fyn and c-Cbl by
pro-oxidants provides a new means of integrating the effects
of changes in intracellular redox state with the control of the
cell cycle. Although the ability of Fyn to be activated by
Figure 12. Diagrammatic Summary of the Fyn/c-Cbl Hypothesis of Toxicant Convergence
The results of our studies demonstrate a regulatory network in which oxidation causes activation of Fyn. Fyn then phosphorylates c-Cbl. Activation ofc-
Cbl leads to ubiquitylation of agonist-activated RTKs that are c-Cbl targets, with PDGFRa used here as an example of such a receptor. Reductions in
levels of receptor lead to reduced activation of downstream signaling cascades.
doi:10.1371/journal.pbio.0050035.g012
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350223
The Redox/Fyn/c-Cbl Pathway
Page 12
increases in oxidative status [97–100], the functional inter-
action of Fyn with c-Cbl (e.g., [93–96]), and the regulation of
degradation of specific RTKs by c-Cbl (e.g., see [88–
90,96,106,107,134–138]) have all been subjects of study by
multiple laboratories, our studies appear to provide the first
integration of all of these components into a regulatory
pathway of obvious relevance to the regulation of cel l
function by redox status. This regulatory pathway, summar-
ized in Figure 12, offers a number of clear predictions, some
of which have been tested in our present studies. Several
studies on different cell types have confirmed our own
finding [59] that making dividing cells more oxidized can
suppress division and induce differentiation [158–160], and it
will be of interest to determine the contribution of the redox/
Fyn/c-Cbl pathway in these other cell systems, as well as in
modulating other changes in cellular function that have been
attributed to increased oxidative status (e.g., [73,161–166]).
It is particularly striking that the changes we observed were
seen at environmentally relevant exposure levels for both
MeHg and Pb. As many as 600,000 newborn infants in the US
each year have cord blood mercury levels greater than 5.8
ppb [46] (i.e., ;30 nM). It is reported that the blood:brain
ratio for humans may be as high as 1:5 to 1:6.7 [167,168],
therefore, in vivo levels in brain may be still higher than those
we have studied. It is also noteworthy that levels of MeHg
exposure at which selective reduction in PDGFRa expression
was readily observed in vivo were 90% or more lower than
exposure levels generally considered to constitute low-to-
moderate exposure (e.g., [143–147]). Blood Pb levels may be of
concern at levels as low as 10 lg/dl (e.g., [169–176]), which is
equivalent to 0.4 8 lM, but which may be increased to
micromolar in the brain by mechanisms relevant to Ca
2þ
transport [171]). Even given equivalence in blood:brain Pb
levels, a concentration of 1 lM is equivalent to the
approximately 20 lg/dl blood Pb levels known to be
associated with cognitive impairment (e.g., [169–177], an
exposure level of particular concern in countries where
leaded gasoline is still used and in which mean blood lead
levels in schoolchildren may be as high as 15 lg/dl [178].
The study of environmentally relevant levels of toxicant
exposure is a great challenge, both in vitro and in vivo, and it
may be that analysis of stem and progenitor cell populations
will be critical in furthering such analysis. In vitro, O-2A/
OPCs appear to offer a particularly useful target cell for such
studies, in part due to their sensitivity to environmentally
relevant exposure levels of toxicants, but also due to the
ability to use clonal analysis in quantitative studies on the
cumulative effects of small changes in the balance between
division and differentiation [179–181]. Such studies have
shown that even such potent physiological regulators as TH
may only increase the probability of oligodendrocyte differ-
entiation at each progenitor cell cycle from approximately
0.5 to 0.65 [179]. Thus, although their cumulative effects over
time may be readily observable, analysis of subtle effects in
acute assays may fail to identify important alterations in
progenitor cell function. In addition, it will be important to
extend analysis on differentiation to other precursor cell
populations, as indicated by recent observations that neuro-
nal differentiation of neuroepithelial stem cells may be
compromised by MeHg exposure levels as low as 2.5 nM
[182]. In vivo, the 20% reduction in number of dividing O-2A/
OPCs observed in animals exposed to 100 ppb MeHg during
development was of particular interest, as such relatively
subtle changes might be predicted to reduce myelination in
ways that require equally subtle analysis to detect functional
outcomes. Analysis of conduction velocity in the auditory
system may offer one such analytical tool, and the sensitivity
of O-2A/OPCs to toxicant exposure may provide an explan-
ation for the consistency with which increases in ABR latency
suggestive of myelination abnormalities are associated with
exposure to a variety of toxicants and physiological stressors,
including MeHg [75–79], Pb [183,184]), cocaine [185,186], and
carbamazepine [187].
The general importance of the signaling pathways regu-
lated by Fyn and c-Cbl suggests that the ability of chemically
diverse toxicants to converge on this pathway may be of
broad relevance to the understanding of toxicant action.
Such c-Cbl targets as PDGFRa, EGFR, and c-Met play critical
roles in processes as diverse as cell proliferation, survival, and
differentiation, cortical neurogenesis, maintenance of the
subventricular zone, astrocyte development, development of
cortical pyramidal dendrites, motoneuron survival and
pathfinding, sympathetic neuroblast survival, and hippo-
campal neuron neurite outgrowth, as well as having extensive
effects on development of kidney, lung, breast, and other
tissues (e.g., [60,61,130,188–195]). Indeed, the range of targets
of c-Cbl [92,135] offers a rich fabric of potentially critical
regulatory molecules that would be affected by changes in
activity of this protein, with the importance of particular
proteins being dependent on the cell type and developmental
stage under consideration. In addition, Fyn regulation of the
Rho/ROC K si gnal ing pathway could be of relev ance in
understanding toxicant-mediated alterations on such cytos-
keletal functions as cell migration, neurite outgrowth, and
development of dendritic morphology (e.g., [196–198]). Our
studies predict that any toxicant that makes cells and/or
tissues more oxidized would activate Fyn, a list that includes
substances as chemically diverse as MeHg (e.g., [1–6], Pb [6–9],
and organotin compounds [1,2,5,10,11]), cadmium [12,13],
arsenic [12,14], ethanol [15,16], and various herbicides (e.g.,
paraquat [17,18], pyrethroids [19–21], and organophosphate
and carbamate inhibitors of cholinesterase [22–26]).
In summary, our studies provide a new general principle
and evidence of a new regulatory pathway that may be
relevant to the understanding of the action of a large number
of chemically diverse toxicants and other modulators of
oxidative status. Because the outcomes we have identified
occur at quite low toxicant exposure levels, they may provide
a particularly useful unifying principle for the analysis of
toxicant effects. Our present studies, combined with our
previous analysis of the central importance of intracellular
redox state in modulating progenitor cell function [59], lead
to the prediction that any toxicant with pro-oxidant activity
will exhibit these effects. Although toxicants of differing
chemical structures will also have additional activities, the
convergence of small increases in oxidative status on
regulation of the redox/Fyn/c-Cbl pathway provides a specific
means by which exposure to low levels of a wide range of
chemically diverse toxicants might have similar classes of
effects on development. Our findings also provide a strategy
for rapid identification of such effects by any of the estimated
80,000 to 150,000 chemicals for which toxicological informa-
tion is limited or nonexistent, thus enabling a preliminary
identification of compounds that would need to be examined
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350224
The Redox/Fyn/c-Cbl Pathway
Page 13
in vivo. The sensitivity of O-2A/OPCs to environmentally
relevant levels of MeHg and Pb provides a great advantage
over established cell lines and other such neural cells as
astrocytes, for which these low exposure levels may have little
effect, and the importance of understanding the effects of
toxicants on progenitor cell function provides a direct link
between our studies and the broad field of developmental
toxicology. In addition, the ability of NAC to protect
progenitor cells against the adverse effects of chemically
diverse toxicants raises the possibility that this benign
therapeutic agent may be of benefit in protecting children
known to be at increased risk from the effects of toxicant
exposure during critical developmental periods. Finally, the
principles indicated by our findings appear likely to have
broad applicability in understanding the regulation of cell
function by alterations in redox balance, regardless of how
they might be generated.
Materials and Methods
Cell isolation, culture, and treatment. O-2A/OPCs were purified
from corpus callosum of P7 CD rats as described previously to
remove type 1 astrocytes, leptomeningeal cells, and oligodendrocytes
[59,64,199]. Cells were then grown in DMEM/F12 supplemented with
1-lg/ml bovine pancreas insulin (Sigma, St. Louis, Missouri, United
States), 100-lg/ml human transferrin (Sigma), 2 mM glutamine, 25-l g/
ml gentamicin, 0.0286% (v/v) BSA pathocyte (ICN Biochemicals,
Costa Mesa, California, United States), 0.2 lM progesterone (Sigma),
0.10 lM putrescine (Sigma), bFGF-2 (10 ng/ml; PEPRO Technologies,
London, United Kingdom), and PDGF-AA (10 ng/ml; PEPRO) onto
poly-l-lysine (Sigma) coated flasks or dishes. Under these conditions,
O-2A/OPCsderivedfromthecorpuscallosumofP7ratsare
predominantly in cell division and do not generate large numbers
of oligodendrocytes during the time periods utilized in this analysis.
To generate sufficient numbers of cells for biochemical analysis,
cells were expanded through one to two passages in PDGF þ FGF-2
before replating in the presence of PDGF alone. When cells achieved
approximately 50% confluence, MeHg, Pb, or paraquat was added to
their medium at concentrations indicated in the text. Doses for the
toxicants were chosen on the basis of dose-response curves to identify
sublethal exposure levels (unpublished data), as a reflection of blood
and brain toxicant levels of these compounds and, where applicable,
on the basis of previous reports. All toxicant concentrations
examined were confirmed to cause death of less than 5% of cells
over the time course of the experiment.
For analysis of the effects of potential inhibitors of toxicant action,
cells were exposed to the blocking compound of interest 1 h before
addition of toxicant. The concentrations of inhibitors used are listed
as following: 0.5 lM BIM-1 (PKC inhibitor), 0.5 lM PP1/PP2 (Src
family kinase inhibitors), and 10 mM NH
4
Cl (lysosome inhibitor); and
the concentrations of toxicants used are listed as following, except
when mentioned specifically: MeHg (20 nM), Pb (1 lM), and paraquat
(5 lM).
To examine the degradation of PDGFRa, O-2A/OPCs were treated
with MeHg (20 nM) for different durations with or wit hout
cycloheximide (CHX; 1 lg/ml) added 1 h before MeHg. The cells
were then collected and lysed for Western blotting. For example, in
the multi-toxicant analysis of Figures 8–10, for analysis of PDGFRa,
O-2A/OPCs were exposed for 24 h to MeHg (20 nM), Pb (1 lM), and
paraquat (5 lM) for 24 h in the presence of 0.5 lM bisindolylmalei-
mide 1 (BIM-1), 0.5 lM of PP1, 1 mM NAC, or 1 mM procysteine,
which had been added 1 h prior to toxicant addition. Cells were lysed
for Western blot analysis using anti-PDGFRa(pY
742
) antibody. The
membranes were de-probed and then re-probed with antibody
against total PDGFRa and anti–b-tubulin antibody. For analysis of
Fyn activity and c-Cbl phosphorylation, progenitors were exposed to
MeHg (20 nM), Pb (1 lM), and paraquat (5 lM) for 3–4 h in the
presence of 0.5 lM BIM1, 0.5 lM PP1,or 1 mM NAC (each of which
was added 1 h before addition of toxicant).
Cell transfection and luciferase activity assay. Cells were deprived
of PDGF-AA for 5 h before re-exposure to PDGF-AA (10 ng/ml) for 1
h for Western blot or 6 h for luciferase assays of pathway activation.
Transient transfection was performed using Fugene6 (Roche, Basel,
Switzerland) transfection solution according to the manufacturer’s
protocol. For the luciferase assay, cells seeded in 12-well plates were
transfected with a reporter plasmid SRE-Luc(firefly) or NFjB-
Luc(firefly) (BD-Clontech, Palo Alto, California, United States) and
an internal control plasmid pRLSV40-LUC. Analyses of luciferase
activity were performed according to the protocol of the Dual
Luciferase Assay System (P romega, Madison, Wisconsin, United
States), which uses an internal control of Renilla luciferase for
quantification, and relative light units were measured using a
luminometer.
Antibodies and immunoblotting. Anti-phosphorylated ERK mono-
clonal, anti-ERK monoclonal, anti-TrkC polyclonal, anti-Fyn poly-
clonal, anti-EGFR polyclonal, anti–c-Met polyclonal, anti–phospho-
tyrosine monoclonal, and anti-PDGFRa polyclonal antibodies were
obtained from Santa Cruz Biotechnology (Santa Cruz, California,
United States). Anti–c-Cbl monoclonal antibody was obtained from
BD PharMingen (San Diego, California, United States). Anti-
phosphorylated Akt monoclonal and anti-Akt polyclonal antibodies
were obtained from Cell Signaling Technology (Beverly, Massachu-
setts, United States). Anti-phosphorylated PDGFRa polyclonal anti-
body was obtained from Biosource (Carlsbad, California, United
States). The cell culture samples were collected and lysed in RAPI
buffer, whereas dissected tissue samples were sonicated in RAPI
buffer. Samples were resolved on SDS-PAGE gels and transferred to
PVDF membranes (PerkinElmer Life Science, Wellesley, Massachu-
setts, United States). After being blocked in 5% skim milk in PBS
containing 0.1% Tween 20, membranes were incubated with a
primary antibody, followed by incubation with an HRP-conjugated
secondary antibody (Santa Cruz Biotechnology). Membranes were
visualized using Western Blotting Luminol Reagent (Santa Cruz
Biotechnology). All analyses of signaling pathway components were
conducted in the presence of ligand for the receptor pathway under
analysis (either PDGF-AA for PDGFRa, NT-3 or TrkC, HGF for c-Met,
or EGF for EGFR).
In vitro BrdU incorporation assay. Cell proliferation was assessed
by bromodeoxyuridine (BrdU) incorporation and by using the mouse
anti-BrdU mAb IgG
1
(1:100; Sigma) to label dividing cells. Stained
cells on coverslips were rinsed two times in 13 PBS, counterstained
with 496-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene,
Oregon, United States) and mounted on glass slides with Fluoro-
mount (Molecular Probes). Staining against surface proteins was
performed on cultures of living cells or on cells fixed with 2%
paraformaldehyde. Staining with intracellular antibodies was per-
formed by permeabilizing cells with ice-cold methanol for 4 min or
by using 0.5% Triton for 15 min on 2% paraformaldehyde–fixed
cells. Antibody binding was detected with appropriate fluorescent
dye–conjugated secondary antibodies at 10 lg/ml (Southern Biotech,
Birmingham, Alabama, United States) or Alexa Fluor–coupled anti-
bodies at a concentration of 1 lg/ml (Molecular Probes), applied for
20 min. Anti-BrdU monoclonal antibody was obtained from Sigma.
Intracellular reactive oxygen species measurement and analysis of
Pb uptake. Cells were plated in 96-well microplates and grown to
about 60% confluence. Prior to treatment, cells were washed twice
with Hank’s buffered saline solution (HBSS), loaded with 20 lM
H2DCFDA (in HBSS 100 ll/well), and incubated at 37 8C for 30 min.
Cells were then washed once with HBSS and growth medium to
remove free probe. Then, fresh growth medium was added and a
baseline fluorescence reading was taken prior to treatment. For NAC
pre-treatment, NAC was added into media 1 h before further
addition of MeHg, and both compounds remained in the medium
during the incubation period with H2DCFDA. Fluorescence was
measured in a Wallac 1420 Victor
2
multilabel counter (PerkinElmer)
using excitation and emission wavelengths of 485 nm and 535 nm,
respectively, at different time courses as indicated in the figures.
Results are presented as the value change from baseline by the
formula (Ft
exp
Ft
base
)/Ft
base
normalized with the control group,
where Ft
exp
¼ fluorescence at any given time during the experiment
in a give well and Ft
base
¼ baseline fluorescence of the same well.
We further determined whether pre-treatment with NAC altered
levels of intracellular Pb by analysis with the Leadmium Green AM
dye (Molecular Probes), according to the manufacturer’s instructions.
In five separate experiments, we found no significant difference
between O-2A/OPCs treated with 1 lM Pb versus [Pb þ NAC]
(unpaired t-test), and the values for both Pb-treated samples were
several-fold higher than control values. All of these data strongly
support the hypothesis that the major effect of NAC is to antagonize
cellular oxidation.
Immunoprecipitation assay. For the co-immunoprecipitation
assay, anti-c-Cbl monoclonal antibody (BD PharMingen) or anti-
PDGFRa polyclonal antibody (Santa Cruz Biotechnology) was added
to the pre-cleared cell lysates (250 lg of total protein), and the
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350225
The Redox/Fyn/c-Cbl Pathway
Page 14
mixtures were gently rocked for 2 h at 4 8C. A total of 30 ll of protein
A/G agarose was then added to the mixture followed by rotating at 4
8C overnight. The protein A/G agarose was then spun down and
washed thoroughly three times. The precipitates were resolved on an
8% SDS-PAGE gel and then were subjected to Western blot analysis
using an anti-p-Tyr (for c-Cbl phosphorylation assay) or ubiquitin
(for PDGFR ubiquitination assay) antibody (Santa Cruz Biotechnol-
ogy).
Fyn kinase assay. Fyn kinase activity was quantified using the
Universal Tyrosine Kinase Assay Kit (Takara, Madison, Wisconsin,
United States). O-2A/OPCs exposed to different treatments were
solubilized with an equal volume of the extraction buffer provided
with the kit for 15 min, and the resulting lysates were centrifuged at
13,000 3 g for 15 min at 4 8C; 250 lg of total cell lysates were
immunoprecipitated with anti-Fyn antibody (Santa Cruz Biotechnol-
ogy). Following immunoprecipitation, Fyn immune complexes were
washed four times with extraction buffer, and then Fyn kinase
activities of each sample were assayed using the kit according to the
manufacturer’s instructions.
Rho kinase assay. Rho kinase activity was quantified using the
CycLex Rho-Kinase Assay kit (MBL International, Woburn, Massa-
chusetts, United States) as described. Cells were lysed and about 500
lg of total cell lysates were immunoprecipitated with anti-ROCK1
antibody (Sigma), and the precipitates were re-suspended with kinase
reaction buffer provided in the kit. Rho kinase activities of each
sample were assayed using the kit according to the manufacturer’s
instructions.
DNA vector-based RNA interference. siRNA target sites were
selected by scanning the cDNA sequence for AA dinucleotides via
siRNA target finder (Ambion, Austin, Texas, United States). Those 19-
nucleotide segments that start with G immediately downstream of AA
were recorded and then analyzed by BLAST search to eliminate any
sequences with significant similarity to other genes. The siRNA
inserts, containing selected 19-nucleotide coding sequences followed
by a 9-nucleotide spacer and an inverted repeat of the coding
sequences plus 6 Ts, were made to double-stranded DNAs with ApaI
and EcoRI sites by primer extension, and then subcloned into
plasmid pMSCV/U6 at the ApaI/EcoRI site. The corresponding
oligonucleotides for the Fyn and c-Cbl RNAi’s are listed in Table 1.
Several nonfunctional siRNAs, which contain the scrambled nucleo-
tide substitutions at the 19-nucleotide targeting sequence of the
corresponding RNAi sequence, were constructed as negative controls.
All of these plasmids were confirmed by complete sequencing.
Viral packaging, cell infection, and selection. pJEN/neo-HA-70z-c-
Cbl plasmids were generously provided by Dr. Wallace Langdon. The
pBabe(puro)-HA-70z-c-Cbl plasmids were constructed by transfer-
ring the BamH1-digested HA-70z-c-Cbl from pJEN/neo-HA-70z-c-Cbl
into the BamH1 digested pBabe(puro) vector. The pBabe(puro)-HA-
70z-c-Cbl, pMSCV/U6-Fyn-RNAi, pMCV/U6-c-Cbl-RNAi, and the
corresponding scrambled RNAi plasmids and the empty plasmids
were transfected into Pheonix Ampho cells by Fugene6 (Roche)
transfection solution according to the manufacturer’s protocol.
Twenty-four hours aft er transfection, medium was changed to
DMEM/F12(SATO, but with no TH) supplemented with 10-ng/ml
PDGF-AA and bFGF. Virus supernatant was collected 48 h post-
transfection, filtered through 0.45-lm filter to remove non-adherent
cells and cellular debris, frozen in small aliquots on dry ice, and
stored at 80 8C. Twenty-four hours prior to infection, O-2AOPCs
were seeded. The following day, the culture medium was aspirated
and replaced with virus supernatant diluted 1:1 in the O-2A growth
media. Medium was then changed into O-2A/OPC growth medium
after 8 h or overnight. Twenty-four hours after infection, the cells
were collected by trypsinization and reseeded in the selective medium
(growth medium þ 200-ng/ml puromycin). By the next day, all
noninfected cells were floating and presumably dead or dying. The
infected cells were allowed to proliferate for 2 d, and then collected
and re-seeded for the following experiments.
RNA isolation and real-time RT-PCR. Total RNA was isolated
using TRIZOL reagent (Invitrogen, Carlsbad, California, United
States) according to the manufacturer’s protocol. A total of 1 lgof
RNA was subjected to reverse transcription using Superscript II
(Invitrogen). The reactions were incubated at 42 8C for 50 min. The
FAM-labeled probe mixes for rat PDGFRa and Fyn, and the VIC-
labeled GAPDH probe mix were purchased from Applied Biosystems
(Foster City, California, United States). For multiplex real-time PCR,
reactions each containing 5 ll of 10-fold–diluted reverse tran-
scription product, 1 ll of interest gene probe mix, 1 ll of GAPDH
probe mix, and 10 ll of TaqMan Universal PCR Master Mix were
performed on an iCycler iQ multicolor real-time PCR system (Bio-
Rad, Hercules, California, United States) and cycling condition was 50
8C for 2 min and 95 8C for 10 min, followed by 40 cycles of 95
8C for
15 sec and 60 8C for 1 min. Each sample was run in triplicate. Data
were analyzed by iCycler iQ software (Bio-Rad).
Clonal analysis. O-2A/OPCs purified from P7 rat optic nerve were
plated in poly-L-lysine–coated 25-cm
2
flasks at clonal density with
DMEM medium in the presence of 10-ng/ml PDGF as previously
described [59,64,199]. After 24-h recovery, cells were treated with
different toxicants, each for 3 d, until visual inspection and
immunostaining was performed. NAC was added 1 h before exposure
to other toxicants for NAC pretreatment, and NAC co-exists
throughout the culture period. The numbers of O-2A/OPCs and
oligodendrocytes in each clone were determined by counting under
fluorescent microscope. The three-dimensional graph shows the
number of clones containing O-2A/OPC cells and oligodendrocytes.
Experiments were performed in triplicate in at least two independent
experiments.
Animal treatment. Six-week-old female SJL mice were treated with
MeHg in their drinking water at a concentration of 100 or 250 ppb
for 30–60 d prior to mating, and then throughout pregnancy and
gestation. This is a level of treatment that is 75%–90% below levels
generally considered to be low to moderate and is below levels that
have been associated with gross defects in adult or developing
animals (e.g., [143–147]).
The exposure levels used in our studies were first determined as
candidate exposures from the results of two different previous
studies on the relationship between MeHg exposure and levels of
toxicant in the brain. Studies by Weiss and colleagues [ 143]
demonstrated that mice exposed to MeHg in their drinking water
for up to 14 mo have brain mercury levels roughly equivalent to that
in the water. In these studies, mice exposed to MeHg in their drinking
Table 1. Oligonucleotide Sequences for siRNAs
Name Oligo Sequence
Fyn-RNAi-1113-forward 59-GTTTGCTCGACTTCTTAAA TTCAAGAGA TTTAAGAAGTCGAGCAAACTT TTTT-39
Fyn-RNAi-1113-reverse 59-AATTAAAA AAGTTTGCTCGACTTCTTAAA TCTCTTGAA TTTAAGAAGTCGAGCAAAC
GGCC-39
c-Cbl-RNAi-732-forward 59-GTGCATCCCATCAGTTCTG TTCAAGAGA CAGAACTGATGGGATGCACTT TTTT-39
c-Cbl-RNAi-732-reverse 59-AATTAAAA AAGTGCATCCCATCAGTTCTG TCTCTTGAA CAGAACTGATGGGATG-
CAC GGCC-39
Fyn-Scr-RNAi-1113-forward 59-CCCGGGTTTCAATATATTT CTCAAGAGA AAATATATTGAAACCCGGGTT TTTT-39
Fyn-Scr-RNAi-1113-reverse 59-AATTAAAA AACCCGGGTTTCAATATATTT TCTCTTGAG AAATATATTGAAACCCGGG
GGCC-39
c-Cbl-Scr-RNAi-732-forward 59-TTTAAACCCGGCCCTTTGG TTCAAGAGA CCAAAGGGCCGGGTTTAAATT TTTT-39
c-Cbl-Scr-RNAi-732-reverse 59-AATTAAAA AATTTAAACCCGGCCCTTTGG TCTCTTGAA CCAAAGGGCCGGGTT-
TAAA GGCC-39
Oligonucleotide sequences for the Fyn and c-Cbl RNAi’s used in experiments of Figures 6 and 8. In addition, nonfunctional siRNAs, which contain the scrambled nucleotide substitutions at
the 19-nucleotide targeting sequence of the corresponding RNAi sequence, were constructed as negative controls. All plasmids were confirmed by complete sequencing.
doi:10.1371/journal.pbio.0050035.t001
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350226
The Redox/Fyn/c-Cbl Pathway
Page 15
water from conception at a concentration of one part per million
(ppm) had brain levels of MeHg of 1.20 mg/kg (i.e., ppm) at 14 mo of
age, whereas those exposed to MeHg at a concentration of 3 ppm had
brain levels of 3.66 mg/kg at this age. It has also been shown, however,
that mercury levels in the brain of pre-weanling animals exposed to
MeHg via the mother’s drinking water throughout gestation and
suckling drop rapidly to one-fifth of the levels found at birth,
presumably due to reduced MeHg transfer in milk [200]. As an
estimated 300,000 to 600,000 infants in the US have blood cord
mercury levels of 5.8 lg/l or more [46], and because the human brain
concentrates MeHg 5- to 6.7-fold over the concentration occurring in
the bloodstream, our goal was to achieve postnatal brain mercury
levels of 30 ppb (i.e., ng/g) or less.
In practice, we found that exposure of female mice to MeHg in
their drinking water at a concentration of 250 ppb prior to
conception, and maintenance of this exposure during suckling, was
associated with brain mercury levels in the offspring (examined at
P14) of 50 ng/g, a fall that was precisely in agreement with predictions
based on prior studies on the fall of mercury levels occurring during
this period in suckling mice [200]. In offspring of dams exposed to
MeHg at a concentration of 100 ppb in the drinking water, brain
mercury was below the levels of detection of the Mercury Analytical
Laboratory of the University of Rochester Medical Center. The
exposure levels of 100 and 250 ppb are 75%–90% below what has
otherwise been considered to be low-dose exposure in mice.
Tissue preparation. At the time of sacrifice, mice were anesthetized
using Avertin (tribromoethanol, 250 mg/kg, 1.2% solution; Sigma)
and were perfused transcardially with 4% paraformaldehyde in
phosphate buffer (pH 7.4) following the removal of the blood by
saline solution washing. The brains were removed and stored in 4%
paraformaldehyde for 1 d, and then changed to 25% sucrose in 0.1 M
phosphate buffer. Brains were cut coronally as 40-lm sections with a
sliding microtome (SM/2000R; Leica, Heidelberg, Germany) and
stored at 20 8C in cryoprotectant solution (glycerol, ethylene glycol,
and 0.1 M phosphate buffer[ pH 7.4], 3:3:4 by volume). All animal
experiments were conducted in accordance with National Institutes
of Health guidelines for the humane use of animals.
In vivo BrdU incorporation assay, BrdU labeling, and olig2 co-
labeling for BrdU detection. To analyze DNA synthesis in vivo, mice
were injected with a single dose of 5-BrdU (50 mg/kg body weight),
dissolved in 0.9% NaCl, filtered (0.2 lm), and applied intraperito-
neally 2 h prior to perfusion. After removal and sectioning of brains,
40-lm free-floating sections were incubated for 2 h in 50%
formamide/23 SSC (0.3 M NaCl and 0.03 M sodium citrate) at 65
8C, rinsed twice for 5 min each in 23 SSC, incubated for 30 min in 2N
HCl at 37 8C, and rinsed for 10 min in 0.1 M boric acid (pH 8.5) at
room temperature. Several rinses in TBS were followed by incubation
in TBS/0.1% Triton X-100/3% donkey serum (TBS-plus) for 30 min.
Sections were then incubated with monoclonal r at anti-BrdU
antibody (1:2,500; Harlan Sera-Lab, Loughborough, United Kingdom)
and polyclonal rabbit anti-Olig2 (a generous gift from Dr. David H.
Rowitch) in TBS-plus for 48 h at 4 8C. Sections were rinsed several
times in TBS-plus and incubated for 1 h with donkey anti-rat FITC
and donkey anti-rabbit TRITC (Jackson ImmunoResearch Laborato-
ries, West Grove, Pennsylvania, United States). After several washes in
TBS, sections were mounted on gelatin-coated glass slides using
Fluoromount-G mounting solution (Southern Biotech).
Quantification of BrdU
þ
cells was accomplished with unbiased
counting methods by confocal microscopy. BrdU immunoreactive
nuclei were counted in one focal plane to avoid oversampling. In
corpus callosum, BrdU
þ
cells were counted in every sixth section (40
lm) from a coronal series between interaural AP þ 5.2 mm and AP þ
3.0 mm in the entire extension of the rostral and medial part of the
corpus callosum. Quantitative data are presented as mean percentage
normalized to control animals. Error bars represent 6 the standard
error of the mean.
Images, data processing, and statistics. Digital images were
captured using a confocal laser scanning microscope (Leica TCS
SP2). Photomicrographs were processed on a Macintosh G4 and
assembled with Adobe Photoshop 7.0 (Adobe Systems, Mountain
View, California, United States). Unpaired, two-tailed Student t-test
was used for statistical analysis.
Supporting Information
Figure S1. MeHg-Induced Reductions in Levels of PDGFRa Are Not
Dependent upon Changes in Transcription of PDGFRa mRNA and
Exceed Normal Levels of Receptor Loss in Untreated Cells
Cells were grown as for Figure 5.
(A) Despite the reduction in levels of PDGFRa associated with MeHg
exposure, this toxicant had no apparent effect on levels of PDGFRa
mRNA, as detected by quantitative PCR analysis.
(B) Inhibition of protein synthesis with cycloheximide (CHX) was
associated with reductions in levels of PDGFRa, but the level of
receptor loss occurring when MeHg was also present was markedly
more severe. All results are as predicted by the hypothesis that the
primary cause of reduced levels of PDGFRa result from activation of
c-Cbl, leading to enhanced degradation of activated PDGFR. All
experiments were repeated at least three times.
Found at doi:10.1371/journal.pbio.0050035.sg001 (243 KB TIF).
Figure S2. The Effects of MeHg, Pb, and Paraquat Were Not
Overridden by BIM-1, a Broad-Spectrum PKC Inhibitor
O-2A/OPCs were exposed to MeHg (20 nM), Pb (1 lM), or paraquat (5
lM) for 24 h with the presence of 0.5 lM of bisindolylmaleimide 1
(BIM-1) or 0.5 lM of PP1.
(A) Toxicant-induced increases in Fyn activity were prevented by co-
exposure to PP1, but not to BIM-1.
(B) BIM-1 co-exposure did not protect against Pb- or paraquat-
induced increases in c-Cbl phosphorylation.
(C) Toxicant-induced reductions in levels of PDGFRa were prevented
by co-exposure of cells to PP1, but not by co-exposure to BIM-1. All
experiments were repeated at least three times, and all numerical
values represent means 6 standard deviation (SD) for triplicate data
points. *, p , 0.05; **, p , 0.01.
Found at doi:10.1371/journal.pbio.0050035.sg002 (391 KB TIF).
Figure S3. Analysis with Leadmium Green AM Demonstrates That
NAC Did Not Reduce the Levels of Pb in O-2A/OPCs
Cells were incubated in the presence of 1 lM Pb, 1 mM NAC, both
together, or neither as for Figure 8. Over five separate experiments,
we found no significant difference between O-2A/OPCs treated with 1
lM Pb versus [Pb þ NAC] (unpaired t-test), and the values for both Pb-
treated samples were several-fold higher than control values.
Found at doi:10.1371/journal.pbio.0050035.sg003 (43 KB PDF).
Figure 4. Inhibition of Rho Kinase Does Not Alter MeHg-Associated
Suppression of BrdU Incorporation
Cells were treated as for analysis of effects of MeHg on PDGF-
mediated signaling.
(A) The addition of Rho kinase inhibitor Y27632 did not alter the
effects of MeHg on O-2A/OPC proliferation.
(B) The concentration of Y27632 used successfully inhibited Rho
kinase activity.
Found at doi:10.1371/journal.pbio.0050035.sg004 (85 KB PDF).
Acknowledgments
It is a pleasure to acknowledge the insightful discussions with our
colleagues on these studies, and in particular discussions with
Margot Mayer-Pro
¨
schel, Lisa Opanashuk, Hartmut Land, and Dirk
Bohmann.
Author contributions. ZL, CP, and MN conceived and designed the
experiments. ZL and TD performed the experiments. ZL, TD, CP, and
MN analyzed the data. MN wrote the paper.
Funding. This work was supported by grants from the National
Institutes of Health to MN (HD39702 and ES012708) and a generous
fellowship from the James P. Wilmot Foundation to ZL.
Competing interests. The authors have declared that no competing
interests exist.
References
1. Yonaha M, Saito M, Sagai M (1983) Stimulation of lipid peroxidation by
methyl mercury in rats. Life Sci 32: 1507–1514.
2. Sarafian T, Verity MA (1991) Oxidative mechanisms underlying methyl
mercury neurotoxicity. Int J Dev Neurosci 9: 147–153.
3. Shanker G, Aschner M (2003) Methylmercury-induced reactive oxygen
species formation in neonatal cerebral astrocytic cultures is attenuated
by antioxidants. Mol Brain Res 110: 85–91.
4. Shanker G, Aschner JL, Syversen T, Aschner M (2004) Free radical
formation in cere bral c ortical astrocytes in culture induced by
methylmercury. Mol Brain Res 128: 48–57.
5. Ali SF, LeBel CP, Bondy SC (1992) Reactive oxygen species formation as a
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350227
The Redox/Fyn/c-Cbl Pathway
Page 16
biomarker of methylmercury and trimethyltin neurotoxicity. Neuro-
toxicology 13: 637–648.
6. Thompson SA, White CC, Krejsa CM, Eaton DL, Kavanagh TJ (2000)
Modulation of glutathione and glutamate-L-cysteine ligase by methyl-
mercury during mouse development. Toxicol Sci 57: 141–146.
7. Ding Y, Gonick HC, Vaziri ND (2000) Lead promotes hydroxyl radical
generation and lipid peroxidation in cultured aortic endothelial cells.
Am J Hypertens 13: 552–555.
8. Hsu P, Liu M, Hsu C, Chen L, Guo Y (1997) Lead exposure causes
generation of reactive oxygen species and functional impairment in rat
sperm. Toxicology 122: 133–143.
9. Ercal N, Treratphan P, Hammond TC, Mathews RH, Grannemann NH, et
al. (1996) In vivo indices of oxidative stress in lead exposed C57BL/6 mice
are reduced by treatment with meso-2,3-dimercaptosuccinic acid or N-
acetyl cysteine. Free Radic Biol Med 21: 157–161.
10. Stahnke T, Richter-Landsberg C (2004) Triethyltin-i nduced stress
responses and apoptotic cell death in cultured oligodendrocytes. Glia
46: 334–344.
11. Jenkins SM, Barone S (2004) The neurotoxicant trimethyltin induces
apoptosis via caspase activation, p38 protein kinase, and oxidative stress
in PC12 cells. Toxicol Lett 147: 63–72.
12. Fowler BA, Whittaker MH, Lipsky M, Wang G, Chen XQ (2004) Oxidative
stress induced by lead, cadmium and arsenic mixtures: 30-day, 90-day,
and 180-day drinking water studies in rats: an overview. Biometa ls 17:
567–568.
13. Souza V, Escobar Mdel C, Bucio L, Hernandez E, Gutierrez-Ruiz MC
(2004) Zinc pretreatment prevents hepatic stellate cells from cadmium-
produced oxidative damage. Cell Biol Toxicol 20: 241–251.
14. Hei TK, Filipic M (2004) Role of oxidative damage in the genotoxicity of
arsenic. Free Radic Biol Med 37: 574–581.
15. McDonough KH (2003) Antioxidant nutrients and alcohol. Toxicology
189: 89–97.
16. Abdollahi M, Ranjbar A, Shadnia S, Nikfar S, Rezale A (2004) Pesticides
and oxidative stress: A review. Med Sci Monit 10: RA141–147.
17. Suntres ZE (2002) Role of antioxidants in paraquat toxicity. Toxicology
180: 65–77.
18. Smith LL, Rose MS, Wyatt I (1978) The pathology and biochemistry of
paraquat. Ciba Found Symp 65: 321–341.
19. Giray B (2001) Cypermethrin-induced oxidative stress in rat brain and
liver is prevented by vitamin E or allopurinol. Toxicol Lett 118: 139–146.
20. Gupta A (1999) Effect of pyrethroid-based liquid mosquito repellent
inhalation on the blood-brain barrier function and oxidative damage in
selected organs of developing rats. J Appl Toxicol 19: 67–72.
21. Kale M, Rathore N, John S, Bhathagar D (1999) Lipid peroxidative
damage on pyrethroid exposure and alteration in antioxidant status in
rat erythrocytes. A possible involvement of reactive oxygen species.
Toxicol Lett 105: 197–205.
22. Gultekin F (2000) The effect of organophosphate insecticide chlorpyr-
ifos-ethyl on lipid peroxidation and antioxidant enzymes (in vitro). Arch
Toxicol 74: 533–538.
23. Gupta RC (2001) Depletion of energy metabolites following acetylcho-
linesterase inhibitor-induced status epilepticus: Protection by antiox-
idants. Neurotoxicology 22: 271–282.
24. Akhgari M, Abdollahi M, Kebryaeezadeh A, et al. (2003) Biochemical
evidence for free radical-induced lipid peroxidation as a mechanism for
subchronic toxicity of malathion in blood and liver of rats. Hum Exp
Toxicol 22: 205–211.
25. Banerjee BD, Seth V, Bhattacharya A, Pasha ST, Chakraborty AK (1999)
Biochemical effects of some pesticides on lipid peroxidation and
freeradical scavengers. Toxicol Lett 107: 33–47.
26. Ranjbar A, Pasalar P, Abdollahi M (2002) Induction of oxidative stress
and acetylcholinesterase inhibition in organophosphorous pesticide
manufacturing workers. Hum Exp Toxicol 21: 179–182.
27. Noble M, Mayer-Proschel M, Proschel C (2005) Redox regulation of
precursor cell function: Insights and paradoxes. Antioxid Redox Signal 7:
1456–1467.
28. Nathan C (2003) Specificity of a third kind: Reactive oxygen and nitrogen
intermediates in cell signaling. J Clin Invest 111: 769–778.
29. Droge W (2006) Redox regulation in anabolic and catabolic processes.
Curr Opin Clin Nutr Metab Care 9: 190–195.
30. Cerdan S, Rodrigues TB, Sierra A, Benito M, Fonseca LL, et al. (2006) The
redox switch/redox coupling hypothesis. Neurochem Int 48: 523–530.
31. Squier TC (2006) Redox modulation of cellular metabolism through
targeted degra dation of signaling proteins by the proteasome. Antioxid
Redox Signal 8: 217–228.
32. Sager PR, Doherty RA, Olmsted JB (1983) Interaction of methylmercury
with microtubules in cultured cells and in vitro. Exp Cell Res 146: 127–
137.
33. Lopachin RM, Barber DS (2006) Synaptic cysteine sulfhydryl groups as
targets of electrophilic neurotoxicants. Toxicol Sci 94: 240–255.
34. Denny MF, Atchison WD (1996) Mercurial-induced alterations in neuro-
nal divalent cation homeostasis. Neurotoxicology 17: 47–61.
35. Goldstein GW (1993) Evidence that lead acts as a calcium substitute in
second messenger metabolism. Neurotoxicology 14: 97–102.
36. Simons TJB (1993) Lead-calcium interactions in cellular lead toxicity.
Neurotoxicology 14: 77–86.
37. Costa LG, Guizzetti M, Lu H, Bordi F, Vitalone A, et al. (2001)
Intracellular signal transduction pathways as targets for neurotoxicants.
Toxicology 160: 19–26.
38. Deng W, Poretz RD (2002) Protein kinase C activation is required for the
lead-induced inhibition of proliferation and differentiation of cultured
oligodendroglial progenitor cells. Brain Res 929: 87–95.
39. Choi BH, Yee S, Robles M (1996) The effects of glutathione glycoside in
methylmercury poisoning. Toxicol Appl Pharmacol 141: 357–364.
40. Shenker BJ, Guo TL O. I, Shapiro IM (1999) Induction of apoptosis in
human T-cells by methyl mercury: Temporal relationship between
mitochondrial dysfunction and loss of reductive reserve. Toxicol Appl
Pharmacol 157: 23–35.
41. Anderson AC, Puerschel SM, Linakis JG (1996) Pathophysiology of lead
poisoning. In: Pueschel SM, Linakis JG, Anderson AC, editors. Lead
poisoning in children. Baltimore: P.H. Brookes. pp. 75–96.
42. He L, Poblenz AT, Medrano CJ, Fox DA (2000) Lead and calcium produce
rod photoreceptor cell apoptosis by opening the mitochondrial perme-
ability transition pore. J Biol Chem 275: 12175–12184.
43. Tiffany-Castiglioni E, Sierra EM, Wu J-N, Rowles TK (1989) Lead toxicity
in neuroglia. Neurotoxicol 10: 417–443.
44. Bressler JP, Goldstein GW (1991) Mechanisms of lead neurotoxicity.
Biochem Pharmacol 41: 479–484.
45. Pounds JG (1984) Effect of lead intoxication on calcium homeostasis and
calcium-mediated cell function: A review. NeuroToxicology 5: 295–332.
46. Trasande L, Landrigan PJ, Schechter C (2005) Public health and
economic consequences of methyl mercury toxicity to the developing
brain. Environ Health Perspect 113: 590–596.
47. Raff MC, Miller RH, Noble M (1983) A glial progenitor cell that develops
in vitro into an astrocyte or an oligodendrocyte depending on the culture
medium. Nature 303: 390–396.
48. Barres BA, Hart IK, Coles HS, Burne JF, Voyvodic JT, et al. (1992) Cell
death in the oligodendrocyte lineage. J-Neurobiol 23: 1221–1230.
49. Noble M, Mayer-Proschel M, Miller RH (2005) The oligodendrocyte. In:
Rao MS, Jacobson M, editors. Developmental neurobiology. New York:
Kluwer Academic/Plenum. 424 p.
50. Noble M, Pro
¨
schel C, Mayer-Proschel M (2004) Getting a GR(i)P on
oligodendrocyte development. Dev Biol 265: 33–52.
51. Levine JM, Reynolds R, Fawcett JW (2001) The oligodendrocyte precursor
cell in health and disease. TINS 24: 39–47.
52. Miller RH (2002) Regulation of oligodendrocyte development in the
vertebrate CNS. Prog Neurobiol 67: 451–467.
53. Deng W, McKinnon RD, Poretz RD (2001) Lead exposure delays the
differentiation of oligodendroglial progenitors in vitro, and at higher
doses induces cell death. Toxicol Appl Pharmacol 174: 235–244.
54. Bichenkov E, Ellingson JS (2001) Ethanol exerts different effects on
myelin basic protein and 29,39-cyclic nucleotide 39-phosphodiesterase
expression in differentiating CG-4 oligodendrocytes. Brain Res Dev Brain
Res 128: 9–16.
55. Zoeller RT, Butnariu OV, Fletcher DL, Riley EP (1994) Limited postnatal
ethanol exposure permanently alters the expression of mRNAS encoding
myelin basic protein and myelin-associated glycoprotein in cerebellum.
Alcohol Clin Exp Res 18: 909–916.
56. Harris SJ, Wilce P, Bedi KS (2000) Exposure of rats to a high but not low
dose of ethanol during early postnatal life increases the rate of loss of
optic nerve axons and decreases the rate of myelination. J Anat 197: 477–
485.
57. O
¨
zer E, Saraioglu S, Gu
¨
re A (2000) Effect of prenatal ethanol exposure on
neuronal migration, neurogenesis and brain myelination in the mice
brain. Clin Neuropathol 19: 21–25.
58. O’Callaghan JP, Miller DB (1983) Acute postnatal exposure to triethyltin
in the rat: effects on specific protein composition of subcellular fractions
from developing and adult brain. J Pharmacol Exp Ther 224: 466–472.
59. Smith J, Ladi E, Mayer-Pro
¨
schel M, Noble M (2000) Redox state is a
central modulator of the balance between self-renewal and differ-
entiation in a dividing glial precursor cell. Proc Natl Acad Sci U S A 97:
10032–10037.
60. Noble M, Murray K, Stroobant P, Waterfield MD, Riddle P (1988) Platelet-
derived growth factor promotes division and motility and inhibits
premature differentiation of the oligodendrocyte/type-2 astrocyte
progenitor cell. Nature 333: 560–562.
61. Richardson WD, Pringle N, Mosley M, Westermark B, Dubois-Dalcq M
(1988) A role for platelet-derived growth factor in normal gliogenesis in
the central nervous system. Cell 53: 309–319.
62. Calver A, Hall A, Yu W, Walsh F, Heath J, et al. (1998) Oligodendrocyte
population dynamics and the role of PDGF in vivo. Neuron 20: 869–882.
63. Barres BA, Lazar MA, Raff MC (1994) A novel role for thyroid hormone,
glucocorticoids and retinoic acid in timing oligodendrocyte develop-
ment. Development 120: 1097–1108.
64. Ibarrola N, Mayer-Proschel M, Rodriguez-Pena A, Noble M (1996)
Evidence for the existence of at least two timing mechanisms that
contribute to oligodendrocyte generation in vitro. Dev Biol 180: 1–21.
65. Grinspan JB, Edell E, Carpio DF, Beesley JS, Lavy L, et al. (2000) Stage-
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350228
The Redox/Fyn/c-Cbl Pathway
Page 17
specific effects of bone morphogenetic proteins on the oligodendrocyte
lineage. J Neurobiol 43: 1–17.
66. Mabie P, Mehler M, Marmur R, Papavasiliou A, Song Q, et al. (1997) Bone
morphogenetic proteins induce astroglial differentiation of oligoden-
droglial-astroglial progenitor cells. Neurosci 17: 4112–4120.
67. Castoldi AF, Barni S, Turin I, Gandini C, Manzo L (2000) Early acute
necrosis, delayed apoptosis and cytoskeletal breakdown in cultured
cerebellar granule neurons exposed to methylmercury. J Neurosci Res 60:
775–787.
68. Park ST, Lim KT, Chung YT, Kim SU (1996) Methylmercury induced
neurotoxicity in cerebral neuron culture is blocked by antioxidants and
NMDA receptor antagonists. Neurotoxicology 17: 37–46.
69. Aschner M, Yao CP, Allen JW, Tan KH (2000) Methylmercury alters
glutamate transport in astrocytes. Neurochem Int 37: 199–206.
70. Markowski VP, Flaugher CB, Baggs RB, Rawleigh RC, Cox C, et al. (1998)
Pren atal and lactatio nal exposure to methylmercury affects select
parameters of mouse cerebellar development. Neurotoxicology 19: 879–
892.
71. Peckham NH, Choi BH (1988) Abnormal neuronal distribution within the
cerebral cortex after prenatal methylmercury intoxication. Acta Neuro-
pathol 76: 222–226.
72. Kakita A, Inenaga C, Sakamoto M, Takahashi H (2002) Neuronal
migration disturbance and consequent cytoarchitecture in the cerebral
cortex following transplacental administration of methylmercury. Acta
Neuropathol (Berl) 104: 409–417.
73. Faustman EM, Ponce RA, Ou YC, Mendoza MA, Lewandowski T, et al.
(2002) Investigations of methylmercury-induced alterations in neuro-
genesis. Environ Health Perspect 110: 859–864.
74. Choi BH (1986) Methylmercury poisoning of the developing nervous
system: I. Pattern of neuronal migration in the cerebral cortex.
Neurotoxicology 7: 591–600.
75. Murata K, Budtz-Jorgensen E, Grandjean P (2002) Benchmark dose
calculations for methylmercury-associated delays on evoked potential
latencies in two cohorts of children. Risk Anal 22: 465–474.
76. Murata K, Weihe P, Araki S, Budtz-Jorgensen E, Grandjean P (1999)
Evoked potentials in Faroese children prenatally exposed to methylmer-
cury. Neurotoxicol Teratol: 471–472.
77. Murata K, Weihe P, Budtz-Jorgensen E, Jorgensen PJ, Grandjean P (2004)
Delayed brainstem auditory evoked potential latencies in 14-year-old
children exposed to methylmercury. J Pediatr 144: 177–183.
78. Hamada R, Yoshida Y, Kuwano A, Mishima I, Igata A (1982) Auditory
brainstem responses in fetal organic mercury poisoning (in Japanese).
Shinkei-Naika 16: 282–285.
79. Nakamura K, Houzawa J, Uemura T (1986) Auditory brainstem responses
in rats with methylmercury poisoning. Audiol Jpn 29: 445–446.
80. Algarin C, Peirano P, Garrido M, Pizarro F, Lozoff B (2003) Iron
deficiency anemia in infancy: Long–lasting effects on auditory and visual
system functioning. Pediatr Res 53: 217–223.
81. Roncagliolo M, Garrido M, Walter T, Peirano P, Lozoff B (1998) Evidence
of altered central nervous system development in infants with iron
deficiency anemia at 6 mo: Delayed maturation of auditory brainstem
responses. Am J Clin Nutr 68: 683–690.
82. Heldin CH, Ostman A, Ronnstrand L (1998) Signal transduction via
platelet-derived growth factor receptors. Biochim Biophys Acta 1378:
F79–113.
83. Rupprecht HD, Sukhatme VP, Lacy J, Sterzel RB, Coleman DL (1993)
PDGF-induced Egr-1 expression in rat mesangial cells is mediated
through upstream serum response elements. Am J Physiol 265: F351–360.
84. Franke TF, Yang SI, Chan TO, Datta K, Kazlauskas A, et al. (1995) The
protein kinase encoded by the Akt proto-oncogene is a target of the
PDGF-activated phosphatidylinositol 3-kinase. Cell 81: 727–736.
85. Choudhury GG (2001) Akt serine threonine kinase regulates platelet-
derived growth factor-induced DNA synthesis in glomerular mesangial
cells: Regulation of c-fos AND p27(kip1) gene expression. J Biol Chem
276: 35636–35643.
86. Raff MC, Lillien LE, Richardson WD, Burne JF, Noble MD (1988) Platelet-
derived growth factor from astrocytes drives the clock that times
oligodendrocyte development in culture. Nature 333: 562–565.
87. Lamballe F, Klein R, Barbacid M (1991) trkC, a new member of the trk
family of tyrosine protein kinases, is a receptor for neurotrophin-3. Cell
66: 967–979.
88. Miyake S, Mullane-Robinson KP, Lill NL, Douillard P, Band H (1999) Cbl-
mediated negative regulation of platelet-derived growth factor receptor-
dependent cell proliferation. A critical role for Cbl tyrosine kinase-
binding domain. J Biol Chem 274: 16619–16628.
89. Miyake S, Lupher MLJ, Druke B, Band H (1998) The tyrosine kinase
regulator Cbl enhances the ubiquitination and degradation of the
platelet-derived growth factor receptor alpha. Proc Natl Acad Sci U S
A 95: 7927–7932.
90. Duan L, Miura Y, Dimri M, Majumder B, Dodge IL, et al. (2003) Cbl-
mediated ubiquitinylation is required for lysosomal sorting of epidermal
growth factor receptor but is dispensable for endocytosis. J Biol Chem
278: 28950–28960.
91. Rosenkranz S, Ikuno Y, Leong FL, Klinghoffer RA, Miyake S, et al. (2000)
Src fami ly kinases negatively regulate platelet-derived growth factor
alpha receptor-dependent signaling and disease progression. J Biol Chem
275: 9620–9627.
92. Schmidt MH, Dikic I (2005) The Cbl interactome and its functions. Nat
Rev Mol Cell Biol 6: 907–919.
93. Tsygankov AY, Mahajan S, Fincke JE, Bolen JB (1996) Specific association
of tyro sine-phosphorylated c-Cbl with Fyn tyrosine kinase in T cells. J
Biol Chem 271: 27130–27137.
94. Hunter S, Burton EA, Wu SC, Anderson SM (1999) Fyn associates with
Cbl and phosphorylates tyrosine731inCbl,abindingsitefor
phosphatidylinositol 3-kinase. J Biol Chem 274: 2097–2106.
95. Feshchenko EA, Langdon WY, Tsygankov AY (1998) Fyn, Yes, and Syk
phosphorylation sites in c-Cbl map to the same tyrosine residues that
become phosphorylated in activated T cells. J Biol Chem 273: 8223–8331.
96. Kassenbrock CK, Hunter SF, Garl P, Johnson GL, Anderson SM (2002)
Inhibition of Src family kinases blocks epidermal growth factor (EGF)-
induced activation of Akt, phosphorylation of c-Cbl, and ubiquitination
of the EGF receptor. J Biol Chem 277: 24967–24975
97. Abe J, Berk BC (1999) Fyn and JAK2 mediate ras activation by reactive
oxygen species. J Biol Chem 274: 21003–21010.
98. Abe J, Okuda M, Huang Q, Yoshizumi M, Berk BC (2000) Reactive oxygen
species activate p90 ribosomal S6 kinase via Fyn and Ras. J Biol Chem
275: 1739–1748.
99. Sanguinetti AR, Cao H, Corley Mastick C (2003) Fyn is required for
oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of
caveolin-1. Biochem J 376: 159–168.
100. Hehner SP, Breitfreutz R, Shubinsky G, Unsoeld H, Schulze-Osthoff K, et
al. (2000) Enhancement of T cell receptor signaling by a mild oxidative
shift in the intracellular thiol pool. J Immunol 165: 4319–4328.
101. Osterhout DJ, Wolven A, Wolf RM, Resh MD, Chao MV (1999)
Morphological differentiation of oligodendrocytes requires activation
of Fyn tyrosine kinase. J Cell Biol 145: 1209–1218.
102. Wolf RM, Wilkes JJ, Chao MV, Resh MD (2001) Tyrosine phosphorylation
of p190 RhoGAP by Fyn regulates oligodend rocyte differentiation. J
Neurobiol 49: 62–78.
103. Poole B, Ohkuma S (1981) Effect of weak bases on the intralysosomal pH
in mouse peritoneal macrophages. J Cell Biol 90: 665–669.
104. Brown WJ, Goodhouse J, Farquhar MG (1986) Mannose-6-phosphate
receptors for lysosomal enzymes cycle between the Golgi complex and
endosomes. J Cell Biol 103: 1235–1247.
105. Laing JG, Tadros PN, Green K, Saffitz JE, Beyer EC (1998) Proteolysis of
connexin43-containing gap junctions in normal and heat-stressed
cardiac myocytes. Cardiovasc Res 38: 711–718.
106. Taher TE, Tjin EP, Beuling EA, Borst J, Spaargaren M, et al. (2002) c-Cbl is
involved in Met signaling in B cells and mediates hepatocyte growth
factor-induced receptor ubiquitination. J Immunol 169: 3793–3780.
107. Thien CB, Langdon WY (2005) Negative regulation of PTK signalling by
Cbl proteins. Growth Factors 23: 161–167.
108. van Leeuwen JE, Paik PK, Samelson LE (1999) The oncogenic 70Z Cbl
mutation blocks the phosphotyrosine binding domain-dependent neg-
ative regulation of ZAP-70 by c-Cbl in Jurkat T cells. Mol Cell Biol 19:
6652–6664.
109. Deng W, Poretz RD (2003) Oliogodendroglia in developmental neuro-
toxicity. Neurotoxicol 24: 161–178.
110. Hausburg MA, Dekrey GK, Salmen JJ, Palic MR, Gardiner CS (2005)
Effects of paraquat on development of preimplantation embryos in vivo
and in vitro. Reprod Toxicol 20: 239–246.
111. McCarthy S, Somayajulu M, Sikorska M, Borowy-Borowski H, Pandey S
(2004) Paraquat induces oxidative stress and neuronal death; neuro-
protection by water-soluble Coenzyme Q10. Toxicol Appl Pharmacol
201: 21–31.
112. Matsuda S, Gomi F, Katayama T, Koyama Y, Tohyama M, et al. (2006)
Induction of connective tissue growth factor in retinal pigment
epithelium cells by oxidative stress. Jpn J Ophthalmol 50: 229–234.
113. Kim SJ, Kim JE, Moon IS (2004) Paraquat induces apoptosis of cultured
rat cortical cells. Mol Cells 17.
114. Shimizu K, Matsubara K, Ohtaki K, Shiono H (2003) Paraquat leads to
dopaminergic neural vulnerability in organotypic midbrain culture.
Neurosci Res 46: 523–532.
115. Aruoma OI, Halliwell B, Hoey BM, Butler J (1989) The antioxidant action
of N-acetylcysteine: Its reaction with hydrogen peroxide, hydroxyl
radical, superoxide and hypochlorous acid. Free Radic Biol Med 6:
593–597.
116. Meister A, Anderson ME, Hwang O (1986) Intracellular cysteine and
glutathione delivery systems. J Am Coll Nutr 5: 137–151.
117. Hoffer E, Avidor I, Benjamino v O, Shenker L, Tabak A, et al. (1993) N-
acetylcysteine delays the infiltration of inflammatory cells into the lungs
of paraquat-intoxicated rats. Toxicol Appl Pharmacol 120: 8–12.
118. Mayer M, Noble M (1994) N-acetyl-L-cysteine is a pluripotent protector
against cell death and enhancer of trophic factor-mediated cell survival
in vitro. Proc Natl Acad Sci U S A 91: 7496–7500.
119. Chen YW, Huang CF, Tsai KS, Yang RS, Yen CC, et al. (2006) The role of
phosphoinositide 3-kinase/Akt signaling in low-dose mercury-induced
mouse pancreatic fbetag-cell dysfunction in vitro and in vivo. Diabetes
55: 1614–16124.
120. Ballatori N, Lieberman MW, Wang W (1998) N-acetylcysteine as an
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350229
The Redox/Fyn/c-Cbl Pathway
Page 18
antidote in methylmercury poisoning. Environ Health Perspect 106: 267–
271.
121. Shanker G, S yversen T, Aschner M (2005) Modulatory effect of
glutathione status and antioxidants on methylmercury-induced free
radical formation in primary cultures of cerebral astrocytes. Brain Res
Mol Brain Res 137: 11–22.
122. Nehru B, Kanwar SS (2004) N-acetylcysteine exposure on lead-induced
lipid peroxidative damage and oxidative defense system in brain regions
of rats. Biol Trace Elem Res 101: 257–264.
123. Neal R, Copper K, Gurer H, Ercal N (1998) Effects of N-acetyl cysteine
and 2,3-dimercaptosuccinic acid on lead induced oxidative stress in rat
lenses. Toxicology 130: 167–174.
124. Yeh ST, Guo HR, Su YS, Lin HJ, Hou CC, et al. (2006) Protective effects of
N-acetylcysteine treatment post acute paraquat intoxication in rats and
in human lung epithelial cells. Toxicology 223: 181–190.
125. Satoh E, Okada M, Takadera T, Ohyashiki T (2005) Glutathione depletion
promotes aluminum-me diated cell death of PC12 cells. Biol Pharm Bull
28: 941–946.
126. Tandon SK, Singh S, Prasad S, Khandekar K, Dwivedi VK, et al. (2003)
Reversal of cadmium induced oxidative str ess by chelating agen t,
antioxidant or their combination in rat. Toxicol Lett 145: 211–217.
127. Flora SJ (1999) Arsenic-induced oxidative stress and its reversibility
following combined administration of N-acetylcysteine and meso 2,3-
dimercaptosuccinic acid in rats. Clin Exp Pharmacol Physiol 26: 865–869.
128. Zaragoza A, Diez-Fernandez C, Alvarez AM, Andres D, Cascales M (2001)
Mitochondrial involvement in cocaine-treated rat hepatocytes: effect of
N-acetylcysteine and deferoxamine. Br J Pharmacol 132: 1063–1070.
129. Roberts J, Nagasawa H, Zera R, Fricke R, Goon D (1987) Prodrugs of L-
cysteine as protective agents against acetaminophen-induced hepatotox-
icity. 2-(Polyhydroxyalkyl)- and 2-(polyacetoxyalkyl)thiazolidine-4(R)-car-
boxylic acids. J Med Chem 30: 1891–1896.
130. Yan H, Rivkees SA (2002) Hepatocyte growth factor stimulates the
proliferation and migration of oligodendrocyte progenitor cells. J
Neurosci Res 69: 597–606.
131. Bottaro DP, Rubin JS, Faletto DL, Chan AM, Kmiecik TE, et al. (1991)
Identification of the hepatocyte growth factor receptor as the c-met
proto-oncogene product. Science 251: 802–804.
132. Naldini L, Vigna E, Narsimhan RP, Gaudino G, Zarnegar R, et al. (1991)
Hepatocyte growth factor (HGF) stimulates the tyrosine kinase activity of
the receptor encoded by the proto-oncogene c-MET. Oncogene 6: 501–
504.
133. Knapp PE, Adams MH (2004) Epidermal growth factor p romotes
oligodendrocyte process formation and regrowth after injury. Exp Cell
Res 296: 135–144.
134. Levkowitz G, Klapper LN, Tzahar E, Freywald A, Sela M, et al. (1996)
Coupling of the c-Cbl protooncogene product to ErbB-1/EGF-receptor
but not to other ErbB proteins. Oncogene 12: 1117–1125.
135. Rubin C, Gur G, Yarden Y (2005) Negative regulation o f receptor tyrosine
kinases: Unexpected links to c-Cbl and receptor ubiquitylation. Cell Res
15: 66–71.
136. de Melker AA, van der Horst G, Borst J (2004) c-Cbl directs EGF receptors
into an endocytic pathway that involves the ubiquitin-interacting motif
of Eps15. J Cell Sci 117: 5001–5012.
137. Ravid T, Heidinger JM, Gee P, Khan EM, Goldkorn T (2004) c-Cbl-
mediated ubiquitinylation is required for epidermal growth factor
receptor exit from the early endosomes. J Biol Chem 279: 37153–37162.
138. Garcia-Guzman M, Larsen E, Vuori K (2000) The proto-oncogene c-Cbl is
a positive regulator of Met-induced MAP kinase activation: a role for the
adaptor protein Crk. J Immunol 19: 4058–4065.
139. Tiffany-Castiglioni E (1993) Cell culture models for lead toxicity in
neuronal and glial cells. Neurotoxicol 14: 513–536.
140. Krigman MR, Druse MJ, Traylor TD, Wilson MH, Newell LR, et al. (1974)
Lead encephalopathy in the developing rat: Effect on myelination. J
Neuropathol Exp Neurol 33: 58–73.
141. Dabrowska-Bouta B, Sulkowski G, Bartosz G, Walski M, Rafalowska U
(1999) Chro nic lead intoxication affects the myelin membrane status in
the central nervous system of adult rats. J Mol Neurosci 13: 127–139.
142. Deng W, Poretz RD (2001 ) Chronic dietary lead exposure affects
galactolipid metabolic enzymes in the developing rat brain. Toxicol
Appl Pharmacol 172: 98–107.
143. Weiss B, Stern S, Cox C, Balys M (2005) Perinatal and lifetime exposure to
methylmercury in the mouse: Behavioral effects. Neurotoxicology 26:
675–690.
144. Stern S, Cox C, Cernichiari E, Balys M, Weis s B (2001) Perinatal and
lifetime exposure to methylmercury in the mouse: Blood and brain
concentrations of mercury to 26 mont hs of age. Neurotoxicology 22: 467–
477.
145. Goulet S, Dore FY, Mirault ME (2003) Neurobehavioral changes in mice
chronically exposed to methylmercury during fetal and early post-natal
development. Neurotoxicol Teratol 25: 335–347.
146. Sakamoto M, Kakita A, de Oliveira RB, Pan HS, Takahashi H (2004) Dose-
dependent effects of methylmercury administered during neonatal brain
spurt in rats. Dev Brain Res 152: 171–176.
147. Barone S Jr, Haykal-Coates N, Parran DK, Tilson HA (1998) Gestational
exposure to methylmercury alters the developmental pattern of trk-like
immunoreactivity in the rat brain and results in cortical dysmorphology.
Brain Res Dev Brain Res 109: 13–31.
148. Dietrich J, Han R, Yang Y, Mayer-Pro
¨
schel M, Noble M (2006) CNS
progenitor cells and oligodendrocytes are targets of chemotherapeutic
agents in vitr o and in vivo. J Biol 5: 22.
149. Rowitch DH, Lu RQ, Kessaris N, Richardson WD (2002) An ‘oligarchy’
rules neural development. Trends Neurosci 25: 417–422.
150. Takebayashi H, Nabeshima Y, Yoshida S, Chisaka O, Ikenaka K, et al.
(2002) The basic helix-loop-helix factor olig2 is essential for the
development of motoneuron and oligodendrocyte lineages. Curr Biol
12: 1157–1163.
151. Zhou Q, Choi G, Anderson DJ (2001) The bHLH transcription factor
Olig2 promotes oligodendrocyte differentiation in collaboration with
nkx2.2. Neuron 31: 791–807.
152. Mukouyama YS, Deneen B, Lukaszewicz A, Novitch BG, Wichterle H, et
al. (2006) Olig2
þ
neuroepi thelial motoneuron pr o genitors are not
multipotent stem cells in vivo. Proc Natl Acad Sci U S A 103: 1551–1556.
153. Fancy SP, Zhao C, Franklin RJ (2004) Increased expression of Nkx2.2 and
Olig2 identifies reactive oligodendrocyte progenitor cells responding to
demyelination in the adult CNS. Mol Cell Neurosci 27: 247–254.
154. Talbott JF, Loy DN, Liu Y, Qiu MS, Bunge MB, et al. (2005) Endogenous
Nkx2.2
þ
/Olig2
þ
oligodendrocyte precursor cells fail to remyelinate the
demyelinated adult rat spinal cord in the absence of astrocytes. Exp
Neurol 192: 11–24.
155. Homolya L, Varadi A, Sarkadi B (2003) Multidrug resistance-associated
proteins: Export pumps for conjugates with glutathione, glucuronate or
sulfate. B iofactors 17: 103–114.
156. Leslie EM, Deeley RG, Cole SP (2001) Toxicological relevance of the
multidrug resistance protein 1, MRP1 (ABCC1) and related transporters.
Toxicology 167: 3–23.
157. Liang X, Draghi NA, Resh MD (2004) Signaling from integrins to Fyn to
Rho Family GTPases regulates morphologic differentiation of oligoden-
drocytes. J Neurosci 24: 7140–7149.
158. Tsatmali M, Walcott EC, Crossin KL (2005) Newborn neurons acquire
high levels of reactive oxygen species and increased mitochondrial
proteins upon differentiation from progenitors. Brain Res 1040: 137–150.
159. Goldsmit Y, Erlich S, Pinkas-Kramarski R (2001) Neure gulin induces
sustained reactive oxygen species generation to mediate neuronal
differentiation. Cell Mol Neurobiol 211: 753–769.
160. Puceat M (2005) Role of Rac-GTPase and reactive oxygen species in
cardiac differentiation of stem cells. Antioxid Redox Signal 7: 1435–1439.
161. McGrath SA (1998) Induction of p21WAF/CIP1 during hyperoxia. Am J
Respir Cell Mol Biol 18: 179–187.
162. McGrath-Morrow SA, Cho C, Soutiere S, Mitzner W, Tuder R (2004) The
effect of neonatal hyperoxia on the lung of p21Waf1/Cip1/Sdi1-deficient
mice. Am J Respir Cell Mol Biol 30: 635–640.
163. Seomun Y, Kim JT, Kim HS, Park JY, Joo CK (2005) Induction of
p21Cip1-mediated G2/M arrest in H2O2-treated lens epithelial cells. Mol
Vis 11: 764–774.
164. Esposito F, Russo L, Chirico G, Ammendola R, Russo T, et al. (2001)
Regulation of p21waf1/cip1 expression by intracellular redox conditions.
IUBMB Life 52: 67–70.
165. Barnouin K, Dubuisson ML, Child ES, Fernandez De Mattos S, Glassford J,
et al. (2002) H2O2 induces a transient multi-phase cell cycle arrest in
mouse fibroblasts through modulating cyclin D and p21Cip1 expression. J
Biol Chem 277: 13761–13770.
166. Hu Y, Wang X, Zeng L, Cai DY, Sabapathy K, et al. (2005) ERK
phosphorylates p66shcA on Ser36 and subsequently regulates p27kip1
expression via the Akt-FOXO3a pathway: implication of p27kip1 in cell
response to oxidative stress. Mol Biol Cell 16: 3705–3718.
167. WHO (1990) Environmental health criteria 101: Methylmercury. Geneva:
World Hea lth Or ganization. Available : http://www.inch em.org/
documents/ehc/ehc/ehc101.htm. Accessed 15 December 2006.
168. Cernichiari E, Brewer R, Myers GJ, Marsh DO, Lapham LW, et al. (1995)
Monitoring methylmercury during pregnancy: Maternal hair predicts
fetal brain exposure. Neurotoxicology 16: 705–710.
169. Goyer RA (1993) Lead toxicity: Current concerns. Environ Health
Perspect 100: 177–187.
170. Banks EC, Ferretti LE, Shucard DW (1997) Effects of low level lead
exposure on cognitive function in children: A review of behavioral,
neuropsychological and biological evidence. Neurotoxicology 18: 237–
282.
171. Lidsky TI, Schneider JS (2003) Lead neurotoxicity in children: Basic
mechanisms and clinical correlates. Brain 126: 5–19.
172. Needleman HL, Gatsonis CA (1990) Low level lead exposure and the IQ
of children. A meta-analysis of mode rn studies. JAMA 263: 673–678.
173. Finkelstein Y, Markowitz ME, Rosen JF (1998) Low-level lead-induced
neurotoxicity in children: An update on central nervous system effects.
Brain ResBrain Res Rev 27: 168–176.
174. Ballinger D, Leviton A, Waternoux C, Needleman H, Rabinowitz P (1987)
Longitudinal analysis of prenatal and postnatal lead exposure and early
cognitive development. N Engl J Med 316: 1037–1043.
175. Winneke G, Brockhaus A, Ewers U, Kra
¨
mer U, Neuf M (1990) Results
from the European Multicenter Study on lead neurotoxicity in children:
Implications for risk assessment. Neurotox Teratol 12: 553–559.
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350230
The Redox/Fyn/c-Cbl Pathway
Page 19
176. Bellinger D, Needleman HL (1992) Neurodevelopmental effects of low-
level lead exposure in children. In: Needleman H, editor. Human lead
exposure. Boca Raton (Florida): CRC Press. pp. 191–208.
177. WHO (1995) Environmental health criteria 165: Inorganic lead. Geneva:
World Health Organization. Available: http://ww w.inchem.org/
documents/ehc/ehc/ehc165.htm. Accessed 15 December 2006.
178. Kaiser R, Henderson AK, Daley WR, Naughton M, Khan MH, et al. (2001)
Blood lead levels of primary school children in Dhaka, Bangladesh.
Environ Health Perspect 109: 563–566.
179. Yakovlev AY, Boucher K, Mayer-Pro
¨
schel M, Noble M (1998) Quantitative
insight into proliferation and differentiation of O-2A progenitor cells in
vitro: The clock model revisited. Proc Natl Acad Sci U S A 95: 14164–
14167.
180. Hyrien O, Mayer-Proschel M, Noble M, Yakovlev A (2005) Estimating the
life-span of oligodendrocytes from clonal data on their development in
cell culture. Math Biosci 193: 255–274.
181. Hyrien O, Mayer-Proschel M, Noble M, Yakovlev A (2005) A stochastic
model to analyze clonal data on multi-type cell populations. Biometrics
61: 199–207.
182. Tamm C, Duckworth J, Hermanson O, Ceccatelli S (2006) High
susceptibility of neural stem cells to methylmercury toxicity: Effects on
cell survival and neuronal differentiation. J Neurochem 97: 69–78.
183. Rothenberg SJ, Poblano A, Schnaas L (2000) Brainstem auditory evoked
response at five years and prenatal and postnatal blood lead. Neuro-
toxicol Teratol 22: 503–510.
184. Bleecker ML, Ford DP, Lindgren KN, Scheetz K, Tiburzi MJ (2003)
Association of chronic and current measures of lead exposure with
different components of brainstem auditory evoked potentials. Neuro-
toxicology 24: 625–631.
185. Lester BM, Lagasse L, Seifer R, Tronick EZ, Bauer CR, et al. (2003) The
Maternal Lifestyle Study (MLS): Effects of prenatal cocaine and/or opiate
exposure on auditory brain response at one month. J Pediatr 142: 279–285.
186. Tan-Laxa MA, Sison-Switala C, Rintelman W, Ostrea EMJ (2004)
Abnormal auditory brainstem response among infants with prenatal
cocaine exposure. Pediatrics 113: 357–360.
187. Poblano A, Belmont A, Sosa J, Ibarra J, Rosas Y, et al. (2002) Effects of
prenatal exposure to carbamazepine on brainstem auditory evoked
potentials in infants of epileptic mothers. J Child Neurol 17: 364–368.
188. Fruttiger M, Karlsson L, Hall A, Abramsson A, Calver A, et al. (1999)
Defective oligodendrocyte development and severe hypomyelination in
PDGF-A knockout mice. Development 126: 457–467.
189. Hoch RV, Soriano P (2003) Roles of PDGF in animal development.
Development 130: 4769–4784.
190. Betsholtz C (2004) Insight into the physiological functions of PDGF
through genetic studies in mice. Cytokine Growth Factor Rev 15: 215–
228.
191. Wong RWC, Guillaud L (2004) The role of epidermal growth facto r and
its receptors in mammalian CNS. Cytokine Growth Factor Rev 15: 147–
156.
192. Xian CJ, Zhou XF (2004) EGF family of growth factors: Essential roles and
functional redundancy in the nerve system. Front Biosci 9: 85–92.
193. Holbro T, Hynes NE (2004) ErbB receptors: Directing key signaling
networks throughout life. Annu Rev Pharmacol Toxicol 44: 195–217.
194. Gutierrez H, Dolcet C, Tolcos M, Davies A (2004) HGF regulates the
development of cortical pyramidal dendrites. Development 131: 3717–
3726.
195. Birchmeier C, Gherardi E (1998) Developmental role of HGF/SF and its
receptor, the c-Met tyrosine kinase. Trends Cell Biol 8: 404–410.
196. Morita A, Yamashita N, Sasaki Y, Uchida Y, Nakajima O, et al. (2006)
Regulation of dendritic branching and spine maturation by semaphor-
in3A-Fyn signaling. J Neurosci 26: 2971–2980.
197. He J, Nixon K, Shetty AK, Crews FT (2005) Chronic alcohol exposure
reduces hippocampal neurogenesis and dendritic growth of newborn
neurons. Eur J Neurosci 21: 2711–2720.
198. Newey SE, Velamoor V, Govek E-E, Van Aeist L (2005) Rho GTPases,
dendritic structure, and mental retardation. J Neurobiol 64: 58–74.
199. Power J, Mayer-Proschel M, Smith J, Noble M (2002) Oligodendrocyte
precursor cells from different brain regions express divergent properties
consistent with the differing time courses of myelination in these regions.
Dev Biol 245: 362–375.
200. Sakamoto M, Kakita A, Wakabayashi K, Takahashi H, Nakano A, et al.
(2002) Evaluation of changes in methylmercury accumulation in the
developing rat brain and its effects: A study with consecutive and
moderate dose exposure throughout gestation and lactation periods.
Brain Res 949: 51–59.
PLoS Biology | www.plosbiology.org February 2007 | Volume 5 | Issue 2 | e350231
The Redox/Fyn/c-Cbl Pathway
Page 20

Supplementary resources

    • "Exposure to environmental toxicants has been implicated in a wide variety of disorders. Toxicants, such as heavy metals, pesticides and chemicals, can damage cells by converging on similar biochemical pathways to produce adverse effects, via oxidative stress, depleting glutathione and impairing cellular signaling (Li et al., 2007). During a systemic inflammatory response, it is feasible that ROS act as signaling molecules leading to modulation of crucial events including phagocytosis, gene expression, and apoptosis, resulting in dysregulation of the immune system (Fialkow et al., 2007). "
    [Show abstract] [Hide abstract] ABSTRACT: Deoxynivalenol (DON) is a Fusarium toxin that causes a variety of toxic effects with symptoms such as diarrhoea and low weight gain. To date, no review has addressed the toxicity of DON in relation to oxidative stress. The focus of this article is primarily intended to summarize the information associated with oxidative stress as a plausible mechanism for DON-induced toxicity. The present review shows that over the past two decades, several investigators have documented the generation of reactive oxygen species (ROS) and reactive nitrogen species (RNS) in oxidative stress as a result of DON treatment and have correlated them with various types of toxicity. The evidence for induction of an oxidative stress response resulting from DON exposure has been more focused on in vitro models and is relatively lacking in in vivo studies. Hence, more emphasis should be laid on in vivo investigations with doses that are commonly encountered in food products. Since DON is commonly found in food and feed, the cellular effects of this toxin in relation to oxidative stress, as well as effective measures to combat its toxicity, are important aspects to be considered for future studies.
    Full-text · Article · Jul 2014 · Food and Chemical Toxicology
    • "In vitro studies show that oligodendrocytes are susceptible to oxidative stress due to their high metabolic activity and iron content combined with low antioxidant levels (Back et al., 1998; Baud et al., 2004; Fragoso et al., 2004). Furthermore, the intracellular redox state controls the proliferation and differentiation of oligodendrocytes (Smith et al., 2000; Li et al., 2007; Do et al., 2012 ), and low GSH levels affect oligodendrocyte maturation (French et al., 2009). Peripubertal Gclm KO mice (which have low brain GSH content) present a deficit in myelinassociated proteins and mature oligodendrocytes in the ACC (Monin et al., 2014). "
    [Show abstract] [Hide abstract] ABSTRACT: Accumulating evidence points to altered GABAergic parvalbumin-expressing interneurons and impaired myelin/axonal integrity in schizophrenia. Both findings could be due to abnormal neurodevelopmental trajectories, affecting local neuronal networks and long-range synchrony and leading to cognitive deficits. In this review, we present data from animal models demonstrating that redox dysregulation, neuroinflammation and/or NMDAR hypofunction (as observed in patients) impairs the normal development of both parvalbumin interneurons and oligodendrocytes. These observations suggest that a dysregulation of the redox, neuroimmune, and glutamatergic systems due to genetic and early-life environmental risk factors could contribute to the anomalies of parvalbumin interneurons and white matter in schizophrenia, ultimately impacting cognition, social competence, and affective behavior via abnormal function of micro- and macrocircuits. Moreover, we propose that the redox, neuroimmune, and glutamatergic systems form a "central hub" where an imbalance within any of these "hub" systems leads to similar anomalies of parvalbumin interneurons and oligodendrocytes due to the tight and reciprocal interactions that exist among these systems. A combination of vulnerabilities for a dysregulation within more than one of these systems may be particularly deleterious. For these reasons, molecules, such as N-acetylcysteine, that possess antioxidant and anti-inflammatory properties and can also regulate glutamatergic transmission are promising tools for prevention in ultra-high risk patients or for early intervention therapy during the first stages of the disease.
    Full-text · Article · Jul 2014 · Schizophrenia Research
    • "P < 0.05 for pairwise comparisons except: GRP versus GDA CNTF for GDNF, BDNF, IGF1 and GRP versus GDA BMP for Neurturin ). Expression of GCLC (Lab Vision, Fremont, CA) and GPx (Abcam , Cambridge, UK) were measured by Western blot analysis (Li et al, 2007). "
    [Show abstract] [Hide abstract] ABSTRACT: In addition to dopaminergic neuron loss, it is clear that Parkinson disease includes other pathological changes, including loss of additional neuronal populations. As a means of addressing multiple pathological changes with a single therapeutically-relevant approach, we employed delayed transplantation of a unique class of astrocytes, GDAs(BMP), that are generated in vitro by directed differentiation of glial precursors. GDAs(BMP) produce multiple agents of interest as treatments for PD and other neurodegenerative disorders, including BDNF, GDNF, neurturin and IGF1. GDAs(BMP) also exhibit increased levels of antioxidant pathway components, including levels of NADPH and glutathione. Delayed GDA(BMP) transplantation into the 6-hydroxydopamine lesioned rat striatum restored tyrosine hydroxylase expression and promoted behavioral recovery. GDA(BMP) transplantation also rescued pathological changes not prevented in other studies, such as the rescue of parvalbumin(+) GABAergic interneurons. Consistent with expression of the synaptic modulatory proteins thrombospondin-1 and 2 by GDAs(BMP), increased expression of the synaptic protein synaptophysin was also observed. Thus, GDAs(BMP) offer a multimodal support cell therapy that provides multiple benefits without requiring prior genetic manipulation.
    Full-text · Article · Apr 2014 · EMBO Molecular Medicine
Show more

Similar publications

Discover more