Content uploaded by Shiv Srivastava
Author content
All content in this area was uploaded by Shiv Srivastava on May 24, 2016
Content may be subject to copyright.
This article was downloaded by: [87.119.208.30]
On: 05 September 2015, At: 03:20
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: 5 Howick Place,
London, SW1P 1WG
Cancer Biology & Therapy
Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/kcbt20
Silencing of lactotransferrin expression by methylation
in prostate cancer progression
Syed Shaheduzzaman, Anu Vishwanath, Bungo Furusato, Jennifer Cullen, Yongmei Chen,
Lionel Bañez, Martin Nau, Lakshmi Ravindranath, Kee-Hong Kim, Ahmed Mohammed, Yidong
Chen, Mathias Ehrich, Vasantha Srikantan, Isabell A. Sesterhenn, David G. McLeod, Maryanne
Vahey, Gyorgy Petrovics, Albert Dobi & Shiv Srivastava
Published online: 11 Jul 2007.
To cite this article: Syed Shaheduzzaman, Anu Vishwanath, Bungo Furusato, Jennifer Cullen, Yongmei Chen, Lionel Bañez,
Martin Nau, Lakshmi Ravindranath, Kee-Hong Kim, Ahmed Mohammed, Yidong Chen, Mathias Ehrich, Vasantha Srikantan,
Isabell A. Sesterhenn, David G. McLeod, Maryanne Vahey, Gyorgy Petrovics, Albert Dobi & Shiv Srivastava (2007) Silencing of
lactotransferrin expression by methylation in prostate cancer progression, Cancer Biology & Therapy, 6:7, 1088-1095, DOI:
10.4161/cbt.6.7.4327
To link to this article: http://dx.doi.org/10.4161/cbt.6.7.4327
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained
in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no
representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the
Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and
are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and
should be independently verified with primary sources of information. Taylor and Francis shall not be liable for
any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever
or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of
the Content.
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any
form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://
www.tandfonline.com/page/terms-and-conditions
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
e1 Cancer Biology & Therapy 2007; Vol. 6 Issue 7
ABSTRACT
Background: Cancer cells gain selection advantages by the coordinated silencing of
protective and by the activation of cell proliferation/cell survival genes. Evaluations of
epithelial cell transcriptome of benign and malignant prostate glands by laser capture
microdissection (LCM) identified Lactotransferrin (LTF) as the most significantly downregu-
lated gene in prostate cancer (CaP) cells (p < 10
-6
). Frequent downregulation, significant
association of LTF with PSA recurrence-free survival in CaP patients and the established
anti-tumorigenic effects of LTF in experimental cancer models have provided impetus to
evaluate LTF expression features and mechanisms in CaP specimens.
Methods: LTF mRNA expression analysis was performed in LCM derived benign
and malignant prostate epithelial cells by using Affymetrix GeneChip and QRT-PCR. LTF
protein expression was assessed in tissue specimens by immunohistochemistry and in
serum samples from CaP patients compared to healthy male control by using ELISA.
Mechanism of LTF downregulation was analyzed in 5-azadeoxycytidine treated LNCaP
and LAPC4 cells using MALDI-TOF MS. Proliferation and cell cycle analysis of CaP cells
by FACS flow cytrometry was assessed in LNCaP cell cultures.
Results: Quantitative analysis of LTF mRNA expression in tumor cells revealed marked
downregulation of LTF with significant associations to decreased PSA recurrence-free
survival of CaP patients (n = 100, p ≤ 0.0322). Moreover, low levels of LTF protein
expression was observed in tumor tissues as well as in sera from CaP patients (p ≤
0.0001). LTF promoter downstream CpG island methylation was found in LNCaP and
LAPC4 cells. Furthermore, replenishing of LTF by supplementing growth media with LTF
protein resulted in reduced cell growth. Cell cycle analysis revealed robust increases in
apoptosis in response to LTF treatment.
Conclusion: This study highlights the potential for LTF in chemoprevention and to
become a biologically relevant prognostic marker of CaP, suggesting that silencing of the
LTF gene may be causally linked to CaP progression.
INTRODUCTION
While recent trends in stabilizing incidence and decreasing mortality rates are encour‑
aging, prostate cancer (CaP) remains a major health burden for American men.
1
Similar
to other cancers, prostate cancer develops through a multi‑step process of genetic changes,
each providing some type of growth advantage for cells, leading to their progressive
conversion into aggressive cancer cells. Intensive investigations on CaP‑specific genetic
alterations are beginning to define common genetic changes in CaP.
2‑4
Chromosomal rear‑
rangements/translocations leading to activation of ETS transcription factors (ERG, ETV1
and ETV4) or methylation mediated silencing of protective genes such as GSTP1 appear
to be most common potentially causal gene alterations in CaP.
2,5
Expression alterations
of the GSTP,
1,6
DD,
3,7
AMACR
8
and the proto‑oncogene, ERG,
9
represents the most
frequent CaP associated gene expression changes.
LTF, a non‑heme iron binding glycoprotein, belongs to the transferrin gene family
and arose from an ancient intragenic duplication.
10
LTF was first discovered in milk and
was also found in a variety of secretions derived from glandular epithelium cells, such as
prostate and salivary glands, as well as in many biological secretions including tears and
semen. LTF plays an immunomodulatory role and participates in inflammatory response.
A number of reports suggested that LTF has an antitumorigenic role
11
utilizing a variety
of mechanisms including regulation of NK (Natural Killer) cell activity,
12
modulation of
expression of G
1
protein,
13
and enhancement of apoptosis.
14
LTF has anti‑tumor function
and could inhibit development of tumors in animal models.
10,15
Research Paper
Silencing of Lactotransferrin Expression by Methylation in Prostate
Cancer Progression
Syed Shaheduzzaman
1,†
Anu Vishwanath
1,†
Bungo Furusato
2
Jennifer Cullen
1
Yongmei Chen
1
Lionel Bañez
1
Martin Nau
5
Lakshmi Ravindranath
1
Kee-Hong Kim
1
Ahmed Mohammed
1
Yidong Chen
4
Mathias Ehrich
6
Vasantha Srikantan
1
Isabell A. Sesterhenn
2
David G. McLeod
3,1
Maryanne Vahey
5
Gyorgy Petrovics
1
Albert Dobi
1,
*
Shiv Srivastava
1,
*
1
Center for Prostate Disease Research, Department of Surgery; Uniformed Services
University; Rockville, Maryland USA
2
Department of Genitourinary Pathology; Armed Forces Institute of Pathology;
Washington, DC USA
3
Urology Service; Walter Reed Army Medical Center; Washington, DC USA
4
Cancer Genetics Branch; NHGRI, NIH; Bethesda, Maryland USA
5
Division of Retrovirology; WRAIR; Rockville, Maryland USA
6
SEQUENOM, Inc.; San Diego, California USA
†
These authors contributed equally to this work.
*Correspondence to: Shiv Srivastava or Albert Dobi; Center for Prostate Disease
Research; Department of Surgery; United States Military Cancer Institute;
Uniformed Services University; 1530 East Jefferson Street; Rockville, Maryland
20852 USA; Tel.: 240.453.8952; Fax: 240.453.8912; Email: SSrivastava@
cpdr.org or ADobi@cpdr.org
Original manuscript submitted: 02/01/07
Manuscript accepted: 04/20/07
This manuscript has been published online, prior to printing for Cancer Biology &
Therapy, Volume 6, Issue 7. Definitive page numbers have not been assigned. The
current citation is: Cancer Biol Ther 2007; 6(7):
http://www.landesbioscience.com/journals/cbt/abstract.php?id=4327
Once the issue is complete and page numbers have been assigned, the citation
will change accordingly.
KEY WORDS
LTF, downregulation, methylation, PSA
doubling time, chemoprevention
[Cancer Biology & Therapy 6:7, e1‑e8, EPUB Ahead of Print: http://www.landesbioscience.com/journals/cbt/abstract.php?id=4327; July 2007]; ©2007 Landes Bioscience
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
www.landesbioscience.com Cancer Biology & Therapy e2
Decreased LTF expression in Prostate Cancer
Bovine lactotransferrin (bLTF) has been found to significantly
inhibit colon, esophagus, lung, bladder and liver cancers in rats.
16‑20
Moreover, bLTF was shown to be chemopreventive in liver carcino‑
genesis induced by diethyl nitrosamine (DEN) alone or by DEN plus
2‑amino‑3, 8‑dimethylimidazo[4,5‑f]quinoxaline (MeIQx), or in
MeIQx‑induced colon carcinogenesis in rat animal models.
21
However, the role of LTF in human prostate cancer remains to
be defined. In this study, we evaluated the expression of LTF gene in
CaP specimens and assessed the prognostic value of decreased or lost
LTF expression in CaP progression. Furthermore, we investigated the
mechanism of LTF downregulation and the cell growth inhibitory
effects of LTF in prostate cancer cell model systems.
MATERIALS AND METHODS
GeneChip
®
analyses. Total RNA was isolated from LCM derived
tumor and benign epithelial cells according to protocol number
WRAMC WU# 04‑2871‑98k. The RNA was quantitated, amplified,
biotinylated, and hybridized to high‑density oligonucleotide human
genome array HG U133A (Affymetrix, Santa Clara, CA).
9
The gene
expression data from paired benign and malignant prostate epithelial
cells from 20 patients (40 GeneChips
®
) were subjected to multidi‑
mensional scaling (MDS) analysis as described previously.
9
Validation of LTF expression by QRT‑PCR. Total RNA isolated
from the LCM derived tumor and benign epithelial cells, was
converted to cDNA (Sensiscript, Qiagen, Valencia, CA). Quantitative
gene expression analysis was performed by TaqMan‑based QRT‑PCR
as described.
9
LTF copy number was determined in tumor and benign
samples (n = 100) and normalized to GAPDH copy numbers.
22
Statistical analyses were performed using the SAS software package
(version 9.0, SAS Institute Inc., Cary, NC). PSA recurrence free
survival was correlated with LTF expression ratio.
23
Northern blot analysis. Twenty micrograms of total RNA
from LNCaP and LAPC4 cells and RNA Millennium™ Markers
(Ambion Inc., TX, USA) were electrophoresed in denaturing form‑
aldehyde 1% agarose gels. Following overnight capillary transfer to
Protran Pure Nitrocellulose Transfer and Immobilization Membranes
(Schleicher & Schuell Keene, N.H., USA). Blots were probed
with LTF cDNA of 2.9 Kb in size (OriGene Technologies, Inc.,
Rockville, MD USA), GAPDH‑Mouse DECAprobe template and
Millennium Marker™ Probe Template (Ambion Inc., TX, USA),
which were radioactively labeled with a‑32p‑dCTP (GE Healthcare,
Buckinghamshire, UK) using a random‑primed DNA labeling kit
named, Amersham Rediprime™ II Random Prime Labeling Systems
(GE Healthcare, Buckinghamshire, UK). Hybridization was carried
out for approximately 18 h in NorthernMax Prehybridization/
Hybridization buffer (Ambion Inc., Tex., and USA). The membrane
was washed twice with 1x SSC and 0.1% SDS for 15 min each and
then washed twice with 0.25 x SSC and 0.1% SDS for 15 min each
and autoradiographed. Sizes of the target genes were determined
from RNA Millennium™ Markers on the autoradiograph.
Analysis of LTF protein expression by immunohistochemisrty
(IHC). All tissues were fixed in 10% neutral buffered formalin and
were paraffin embedded. Prostate tissue specimens were selected
with the criteria of having sufficient tissue within the paraffin block
to perform the immunohistochemistry (IHC). Tissue sections
(100 mm) of the radical prostatectomy derived whole‑mount
prostate specimens from 30 CaP patients were stained with H&E
and anti‑LTF by IHC.
24
Determination of LTF protein concentration in CaP patient
Serum. Serum LTF protein concentration of biopsy‑verified CaP
patients who underwent radical prostatectomy (RP) at Walter Reed
Army Medical Center (WRAMC) was compared to CaP‑free control
group with normal digital rectal examination (DRE) and a low serum
PSA (<2.5 ng/ml). Serum LTF levels were measured in a cohort
of 34 CaP patients and 35 healthy male controls using Bioxytech
Lacto‑f‑EIA (OxisResearch, Portland, OR) and a Multiskan Ascent
ELISA plate reader according to the manufacturer’s recommenda‑
tion.
Activation of LTF expression in LNCaP and LAPC4 cells by
5‑azadeoxycytidine treatment. LNCaP and LAPC4 cells were treated
with 5 mM of 5‑azadeoxycytidine DNA methyl transferase inhibitor
(Sigma‑Aldrich Co., St. Louis, MO) for 14 days at concentration of
5 mM with the change of cell culture media every two days (concentra‑
tion was optimized prior to the actual experiment to avoid toxicity).
Quantitative methylation analysis of genomic DNA from treated and
untreated LNCaP cells were performed by SequEnom
®
(San Diego,
CA) using EpiTYPER, a bisulfite‑treatment‑based MALDI‑TOF
MS method for detection and quantitation of methylation.
25
To
amplify the bisulfite modified +200 to +600 CpG‑rich region of the
LTF gene, a primer pair was designed as follows: forward primer,
5'‑GGGGTAAAGTTTTGAATAAAGGGG‑3' and reverse primer
5'‑TAAAAAACCCAACTATTCCTCC‑3'. The GSTP1 gene ‑300;
+100 region was amplified by using the following primer set:
forward 5' TGGGAAAGAGGGAAAGGTTTTTT‑3' and reverse
5'‑CCCATACTAAAAACTCTAAACCCCATC‑3'. For gene
expression analysis total RNA was extracted from untreated and
5‑azadeoxycytidine treated LNCaP and LAPC4 cells using RNeasy
Mini kit (QIAGEN
®
, Valencia, CA). The RNA was transferred on
nitrocellulose membrane to asses the expression of LTF by Northern
Blot analysis in both LNCaP and LAPC4 cells as described above.
GAPDH expression was assessed as the quality control of RNA
samples.
Effects of LTF on LNCaP cell proliferation and cell cycle.
LNCaP cells (5 x 10
4
cells/well, passage 28) in RPMI medium
were plated into 12‑well plates and allowed to grow in a 5% CO
2
incubator at 37˚C for 24 hours. LTF dose response was assayed by
supplementing the media with various concentrations of LTF protein
(Sigma‑Aldrich, St. Louis, MO) from a 1000 mM stock solution to
final concentrations of 0, 10, 30 and 50 mM. Cell growth was deter‑
mined at 24, 48, 72 and 96 h. The experiment was performed in
triplicate (n = 3) and repeated twice. Cell morphology was monitored
and photographed using an inverse microscope (DMIRE2, Leica
Microsystems, Bannockburn, IL). Statistical analysis was performed
with SPSS version 12 software package. p < 0.05 values were consid‑
ered to be statistically significant. For cell cycle analysis Propidium
Iodide (PI) staining and FACS analysis was performed. The fluores‑
cent dye PI preferentially binds to double‑stranded nucleic acids and
allows fluorescent intensity to be used as an indicator of the cellular
DNA content. LNCaP cells were grown to ~70% confluence in
25‑cm
2
flasks and were treated with 10 mM of human lactoferrin for
24 h and 48 h at 37˚C. Following treatments, the adherent cells were
trypsinized and washed twice 1x PBS and then fixed with 70% cold
ethanol at ‑20˚C for 30 min. Cells were washed twice with cold PBS
following ethanol fixation. Cells were resuspended in PBS containing
10 mg/ml RNase (Boehringer Mannheim, Indianapolis, IN) and
incubated at 37˚C for 30 min to remove double stranded RNA.
Subsequently, cells were stained with PI (Boehringer Mannheim,
Indianapolis, IN) at a concentration of 50 mg/ml and stored at 4˚C
in dark until flow cytometry was performed. PI stained LNCaP
cells were analyzed using an EPICS ELITE ESP (Beckman Coulter,
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
Decreased LTF expression in Prostate Cancer
e3 Cancer Biology & Therapy 2007; Vol. 6 Issue 7
Miami, FL) flow cytometer. Cell cycle analysis of DNA histogram
is performed with ModFit LT software (Verity Software House,
Topsham, ME). Experiments were carried out in triplicates.
RESULTS
LTF mRNA and protein levels are downregulated in prostate
cancer. Evaluations of prostate epithelial cell (PEC) transcriptome
using laser capture microdissection (LCM) derived benign and tumor
epithelial cells and Affymetrix GeneChipÒ revealed LTF (down‑
regulated in tumor cells) and AMACR (upregulated in tumor cells)
as the most significant (p < 10
‑6
) malignant cell‑specific differential
expression (Fig. 1A). CaP associated LTF expression alteration was
validated at protein level. Significant downregulation of LTF protein
was noted in all 30 whole‑mount paraffin embedded
formalin fixed tissue specimens of CaP patients
analyzed by IHC (Fig. 1B). In these experiments
an average of 20% focal tumor stains for LTF was
detectable. Patients with organ‑confined CaP (n =
34) had significantly lower levels of serum LTF (p
< 0.0001) compared to control group with normal
DRE and low PSA (n = 35) as determined by ELISA
(Fig. 1C).
Quantitative assessment of LTF downregula‑
tion revealed an association with reduced PSA
recurrence‑free survival. LTF mRNA copy numbers
normalized to GAPDH copy numbers were deter‑
mined in 200 RNA specimens from laser micro‑dissected matched
tumor (T) and benign (B) prostate epithelial cells of 100 CaP
patients. Decreased LTF expression was noted in tumor cells of
74.0% CaP patients, while 21% of CaP patients had increased
LTF expression (Fig. 2A). As a quality control for the LCM‑RNA
specimens, a subset of RNAs from 20 benign and 20 tumor samples
were analyzed for AMACR and GSTP1. As expected, AMACR
overexpression (95%) and decreased GSTP1 expression (100%)
was observed in virtually all tumor specimens (Supplementary Fig.
1). Low LTF “Tumor (T) / Benign (B)” expression (copy number)
showed a significant correlation with shorter PSA‑free survival by
Kaplan‑Meier unadjusted analysis (p value ≤0.0322; Fig. 2B). Using
chi‑square analysis, a significant association was noted between “T
/ B” LTF expression (copy number) and PSAR after RP such that
Figure 1. LTF is downregulated in prostate cancer.
(A) Gene expression signature representing LTF down-
regulation in prostate tumor (T) cells compared to matched
benign (B) epithelium. The heat map displays tumor and
benign expression of LTF in 20 CaP patients (9 with High
Risk and 11 with Moderate Risk form of CaP) based
on signals obtained by probe set 202018_s_at (Gene
Bank ID: NM_002343) on the Affymetrix GeneChip HG
U133A. The color scale from 1/86 fold to 86-fold ratio is
shown under the heat map. Gleason scores are shown in
parenthesis at the top of the heat map. Expression data
was analyzed by multidimensional scaling (MDS) using the
MATLAB package (http://arrayanalysis.nih.gov/marray.
html) from NHGRI. Genes with the most significant expres-
sion differences were selected by t-test (by lowest p-values).
(B) LTF immuno-staining of tissue sections (4 mm) of 30
whole -mount prostate specimens revealed overall high
levels of LTF protein in benign glands as compared to
malignant glands. Panel B shows LTF protein expression in
four prostate tissue sections of CaP patients by IHC using
anti-LTF goat polyclonal antibody. Black arrows indicate
strongly stained benign cells. In contrast, white arrows
indicate negative staining of tumor cells (focal staining in
less than 20% of CaP). In 30 of 30 (100%) cases, benign
glands (black arrows) adjacent to cancer areas were
highly positive for LTF. Magnification, 12. C, decreased LTF
protein level in serum of CaP Patients. Serum was drawn
from CaP patients (n = 34) undergoing their first diagnostic
prostate biopsy, and from healthy males (n = 35). A signifi-
cant two-fold decrease in mean LTF levels was observed in
sera from CaP patients compared to controls (p < 0.0001)
(ELISA). Whisker-box plot technique was used to illustrate
serum LTF concentration by patient groups (CaP vs control).
Students’ t test confirmed a significant difference in LTF
concentration between cancer and control groups (cancer
vs control: 775.71 vs 1381.6, p = 0.0001).
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
www.landesbioscience.com Cancer Biology & Therapy e4
Decreased LTF expression in Prostate Cancer
men with low T/B ratios had a greater proportion of
PSAR (p = 0.02; Fig. 2C). Similarly, multivariate Cox
proportional hazards regression demonstrated signif‑
icantly greater odds of PSAR‑free survival for men
with higher LTF T/B ratios (p = 0.04) adjusting for
relevant covariates (Supplementary Table 1). These
data suggest that low “T/B” LTF expression is a
potential biomarker of poor prognosis of CaP.
Mechanism of LTF downregulation in LNCaP
cells. To elucidate the possible mechanism of LTF gene
silencing we analyzed the LTF promoter upstream
and downstream sequences for CpG islands. The
analysis revealed a CpG island downstream to
the transcription initiation site. To assess whether
or not DNA methylation played a role in LTF
gene silencing, LNCaP and LAPC4 cells harboring
mutant or wild type AR respectively, were incubated
in the absence or presence of 5 mM 5‑azadeoxycytidi
ne(decitabine) DNA methyl transferase inhibitor for
15 days. Genomic DNA was isolated from the cells and quantitative
methylation analyses was carried out by EpiTYPER MALDI‑TOF
MS, a bisulfite‑treatment‑based method for the detection and
quantitation of DNA methylation.
25
In cells without decitabine
treatment the CpG‑rich region spanning from exon 1 to the down‑
stream intronic sequences (+200 to +600 relative to the transcription
initiation site of LTF promoter), an average of 80% methylation was
found in mutant AR expressing LNCaP cells (Fig. 3A). In contrast,
an average of 35% methylation was observed in the same region
in wild type AR expressing LAPC4 cells. (Fig. 3C). Proportional
demethylation was observed in response to 5‑aza‑deoxycytidine
treatment at CpG sites throughout the assessed region in both cell
lines. Consistent decrease in GSTP1 methylation in response to 5‑aza‑
deoxycytidine treatments confirmed that decitabine concentration
was in the subtoxic concentration range facilitating the demethyl‑
ation of CpG islands (Fig. 3, B and D). Assessment of LTF mRNA
levels by Northern blot analyses indicated robust increase in wild
type AR harboring LAPC4 cells and in a lesser extent in LNCaP in
response to decitabine (Fig. 3E). These observations were consistent
with the finding of high levels of DNA methylation in genome of
mutant AR harboring LNCaP cells (Fig. 3A).
26
LTF protein inhibits the growth of prostate cancer cells.
Numerous studies have demonstrated the negative effect of LTF
protein supplementation on the growth of various cancer cells.
Therefore, we evaluated the effect of LTF on prostate cancer cell
growth. LNCaP cells were treated with various concentrations
of LTF for 48 to 96 h. During initial dose response and time
course experiments it was determined that 10 mM of LTF for
Figure 2. LTF expression and its significant associa-
tion with PSA recurrence free survival of CaP patients.
(A) Relative expression levels of LTF gene in epithelial
cells of paired tumor (T) and benign (B) cells from 100
patients: Y-axis is gene copy number T/B ratios (log scale)
measured in LCM derived paired tumor and benign cells
by TaqMan-QRT-PCR. The relative gene copy number repre-
senting LTF expression level is presented as fold change =
2 (CT benign - CT tumor) of tumor versus matched benign
cells, where DCT means normalized CT value of target
gene copy normalized to GAPDH; X-axis: CaP patients
analyzed. B, LTF expression level significantly correlates
with PSA recurrence status (n = 97). Kaplan-Meier unad-
justed analysis shows that low LTF T/B expression correlates
with shorter PSA recurrence-free survival (Log rank p-value
≤0.0322). For this analysis, LTF expression data were
dichotomized using the median split of log-transformed LTF
copy number ratio (T/B) data, resulting in the following
strata: ≤ -1.861 (“Low”) versus > -1.861 (“High”). C, PSA
recurrence after radical prostatectomy (RP) in CaP patients
is significantly higher among men with low T/B LTF expres-
sion in RP specimens (N = 107). PSAR was defined as
a single, post-operative PSA value of 0.2 ng/ml at ≥ 2
months post-RP. LTF expression data were dichotomized
using the median split of log-transformed LTF copy number
ratio (T/B) data, resulting in the following strata: ≤ -1.861
(“Low”) versus > -1.861 (“High”). Chi-square analysis
revealed that 88% of PSAR events in the study sample
were observed in men with low LTF expression (Chi-square
= 5.32, df = 1, p = 0.02).
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
Decreased LTF expression in Prostate Cancer
e5 Cancer Biology & Therapy 2007; Vol. 6 Issue 7
48 h of incubation was sufficient to reach
the cytostatic range of LTF treatment (Fig.
4A and B). We noted that cell number
was not reduced within the first 24 hours
of LTF treatment (data not shown). After
48 hours the number of LNCaP cells was
significantly reduced in response to 10 mM
LTF treatment (Fig. 4A). While 10 mM
LTF concentration was cytostatic (p < 0.01
for each pair), ≥30 mM LTF appeared to
be cytotoxic (Fig. 4B). Both cytostatic and
cytotoxic effects of LTF on LNCaP cells
were evident by the observed changes in cell
morphology.
LTF induces apoptosis and growth
arrest at the G
1
phase of the cell cycle. To
assess the effects of LTF treatment on cell
cycle regulation LNCaP cells were treated
with 10 mM of human lactoferrin for 24
and 48 h and were compared to untreated
cells by FACS analysis. Robust apoptosis
(G
0
) and growth arrest at the G
1
phase
was observed in the 24 and 48 h groups
in response to 10 mM LTF treatment (Fig.
5). Furthermore, reduction in S‑phase of
the cell cycle was apparent in all treatment
groups. Longer treatment or higher concen‑
trations of LTF appeared to be cytotoxic
(data not shown).
DISCUSSION
Detection of the frequently downregu‑
lated LTF in CaP may provide a valuable
tool for monitoring disease progression.
Association of LTF downregulation with
decreased PSA recurrence‑free survival of
CaP patients suggests that LTF may be
suitable for disease prognosis. Consistent
with the LTF mRNA expression data,
LTF protein downregulation was observed
both in tumor tissue and in serum (p <
0.0001). In quantitative gene expression
evaluation of LCM‑selected cells, down‑
regulation of LTF mRNA expression was
observed in 74% of the samples. IHC
results of whole‑mount prostates from
30 patients suggested absence of LTF
expression in approximately 80% of tumors.
Interestingly, specimens with increased LTF
expression showed better prognosis (longer
PSA recurrence free survival) of CaP that
may reflect the preventive function of LTF
in these patient group.
The cell growth inhibitory effect of LTF
protein on CaP cells is intriguing and indi‑
cates protective functions for LTF in CaP.
Although, further studies will be necessary
to assess possible mechanisms
27
leading to
cell growth inhibitory properties of LTF in
Figure 3. Detection and quantitation of LTF gene methylation in LNCaP and LAPC4 cells: mechanism
of LTF downregulation. Methylation analysis of genomic DNA from 5-azadeoxycytidine treated and
untreated LNCaP and LAPC4 cells were performed at SEQUENOM using EpiTYPER MALDI-TOF MS,
which is a bisulfite-treatment-based method for the detection and quantitation of DNA methylation.
Blue bars indicate % methylation. Red bars mark % of methylation after 5-azadeoxycytidine treatment.
(A) In the analyzed CpG island of LTF gene, +200; +600 relative to the transcription initiation site,
74 to 97% methylation was detected in LNCaP cells. (B) 71 to 100% methylation of the analyzed CpG
sites was detected in the -300; +100 region of GSTP1 gene in LNCaP cells. (C) In LAPC4 cells modest
methylation of the LTF gene, +200; +600 region was further decreased in response to 5-azadeoxycyti-
dine treatment. (D), an approximately 40% of methylation of the GSTP1 gene -300; +100 region in
LAPC4 showed further decrease in 5-azadeoxycytidine treated cells. (E) 5-azadeoxycytidine dose depen-
dent expression of LTF mRNA is pronounced in LAPC4 as opposed to LNCaP cells as shown in Northern
blot assays. GAPDH mRNA blots are shown as controls.
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
www.landesbioscience.com Cancer Biology & Therapy e6
Decreased LTF expression in Prostate Cancer
prostate cells. It has been reported before that LTF expression might
be silenced by promoter hypermethylation in CaP.
10
Furthermore,
we previously shown that CaP cells harboring wild type or mutant
alleles of AR are different in their genomic DNA methylation levels
and in their response to inhibition of DNA methyl transferases.
26
Therefore, we addressed the question of whether or not silencing
of LTF promoter is affected by the allelic status of AR in CaP cell
culture models. Indeed, in mutant AR harboring LNCaP cells the
LTF promoter downstream CpG island was heavily methylated, and
LTF expression was undetectable. In contrast, analysis of wild type
AR expressing LAPC4 cells indicated modest methylation within
the promoter downstream CpG island and detectable levels of LTF
expression. Inhibition of DNA methyl transferases by decitabine
resulted in robust activation of LTF expression in LAPC4 and in to
a lesser extent activation of LTF in LNCaP cells. These data together
indicate that methylation silencing of LTF may mirror the functional
status of androgen receptor. Although, methylation silencing of LTF
gene closely resembles the silencing of the protective GSTP1 gene
that is an early event in CaP,
5
LTF methylation may be intimately
linked to the chromatin changes associated with AR functions in
prostate cancer.
Early recurrence of CaP after RP is detectable by a rise in serum
PSA level
23
and PSA recurrence develops in a significant number
of patients who undergo RP, which is commonly considered as an
early indication of progressive disease. Prognostic molecular markers
of CaP progression predicting PSA recurrence and disease‑specific
survival have been extensively evaluated in CaP tissues.
28
Expression
features of genes such as p53,
17
BCL2,
28
EZH2,
29
AMACR
8
and ERG1
9
appear to be associated with PSA recurrence after RP.
Significant association of LTF downregulation with PSA recurrence
also suggests that LTF may play protective roles in the prostate
epithelium.
Use of natural compounds such as lactoferrin in chemoprevention
and chemotherapy may become a useful strategy in suppressing and
inhibiting tumor growth and carcinogenesis. Interestingly, growth
inhibition of LNCaP cells by LTF protein suggests potential anti‑
tumorigenic activity of LTF in CaP. We evaluated changes in the
cell cycle of prostate cancer cells in response to lactoferrin treatment
to assess underlying mechanisms of the lactoferrin‑mediated anti‑
tumorigenic activity. Robust apoptotic response (G
0
), growth arrest
at G
1
and reduced S phase was observed in response to lactoferrin
treatment suggesting a role for specific cell cycle regulatory mecha‑
nisms in LTF‑mediated cell growth inhibition. Similar observations
were reported in Head and Neck cancer cell,
30
hepatocyte
31
and
breast cancer
32
cell models. Numerous reports suggested that LTF
has antitumorigenic activity in animal models in various cancer
types. These studies have shown that LTF can inhibit development
of tumors in experimental models.
15,33
Our data warrants similar
investigations for LTF in prostate cancer.
Taken together, this study has established LTF as a frequently
downregulated gene in CaP. As the magnitude of LTF mRNA
downregulation in prostate tumor cells is significantly associated
with PSA recurrence after RP, quantitative features of LTF expression
have prognostic utility in disease progression. Reduced levels of LTF
protein in tumor specimens and blood samples hold the promise for
providing alternative strategies for assessing the prognostic value of
LTF in the serum of CaP patients. Finally, the observed cell growth
inhibitory effects of this natural milk product, warrants future experi‑
ments evaluating the anti‑tumorigenic effects of LTF in prostate
cancer in the context of chemoprevention.
Figure 4. LTF protein inhibits LNCaP cell growth. (A) LTF dose response of
LNCaP cell growth. Effect of LTF at 10 mM, 30 mM and 50 mM concentra-
tions on cell growth was determined at 48, 72, and 96 h using CellTiter
96 Aqueous One Soutin (Promega, Madison, WI). (B) Inhibition of LNCaP
cell growth by LTF. Cytostatic effect of 10 mM LTF (upper right panel: 10
mM) was noted in LNCaP cells after 48 h of incubation (p < 0.01 for each
pair). LTF treatment at ≥30 mM appeared to be cytotoxic for the cells (lower
left panel: 30 mM, lower right panel: 50 mM). Non-treated cells (upper
left panel: 0 mM), were attached and proliferated throughout the surface.
(C) Quantification of growth inhibition data from (B) of 10 mM LTF treated
LNCaP cells for 48 h with error bars. Data represent the mean for three rep-
licates ± SD. Columns, mean of three independent replicates; bars, STD.
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
Decreased LTF expression in Prostate Cancer
e7 Cancer Biology & Therapy 2007; Vol. 6 Issue 7
Acknowledgements
The authors would like to thank Dr. Chen Sun and Dr. Hongyun
Li for helping in the cell cycle analysis and Dr. Katsuaki Masuda for
providing 5‑azadeoxycytadine treated LNCaP cells. The authors also
thank Mr. Stephen Doyle, Graphics Designer, for his assistance in
preparing the figures. The opinions and assertions contained herein
are the private views of the authors and are not to be construed as
reflecting the official views of the US Army or the Department of
Defense.
Note
Financial disclosure. This work was funded by the CPDR through
an ongoing grant from the US Army Medical Research and Material
Command, and by NIH Grant RO1 DK065977.
Ethics statement. Prostate tissue specimens used in this study
were obtained under an IRB‑approved protocol at Walter Reed Army
Medical Center. Informed consent was obtained from each subject.
Competing financial interests statement. The authors declare
that they have no competing financial interests. Mathias Ehrich is an
employee of the Sequenom Inc., San Diego, California.
References
1. Jemal A, Siegel R, Ward E, Murray T, Xu J, and Thun MJ. Cancer statistics CA. Cancer J
Clin 2007; 57:43‑66.
2. Tomlins SA, Rhodes DR, Perner S, et al. Recurrent fusion of TMPRSS2 and ETS transcrip‑
tion factor genes in prostate cancer. Science 2005; 310:644‑8.
3. Isaacs W, Kainu T. Oncogenes and tumor suppressor genes in prostate cancer. Epidemiol
Rev 2001; 23:36‑41.
4. Moul JW, Merseburger AS, Srivastava S. Molecular markers in prostate cancer: The role in
preoperative staging. Clin Prostate Cancer 2002; 1:42‑50.
5. Nelson WG, De Marzo AM, Isaacs WB. Prostate cancer. N Engl J Med 2003;
349:366‑81.
6. Lee WH, Morton RA, Epstein JI, et al. Cytidine methylation of regulatory sequences near
the pi‑class glutathione S‑transferase gene accompanies human prostatic carcinogenesis.
Proc Natl Acad Sci USA 1994; 91:11733‑7.
7. Bussemakers MJ, van Bokhoven A, Verhaegh GW, et al. DD3: A new prostate‑specific gene,
highly overexpressed in prostate cancer. Cancer Res 1999; 59:5975‑9.
8. Rubin MA, Zhou M, Dhanasekaran SM, et al. alpha‑Methylacyl coenzyme A racemase as a
tissue biomarker for prostate cancer. Jama 2002; 287:1662‑70.
9. Petrovics G, Liu A, Shaheduzzaman S, et al. Frequent overexpression of ETS‑related gene‑1
(ERG1) in prostate cancer transcriptome. Oncogene 2005; 24:3847‑52.
10. Teng CT. Lactoferrin gene expression and regulation: An overview. Biochem Cell Biol 2002;
80:7‑16.
11. Brock JH. The physiology of lactoferrin. Biochem Cell Biol 2002; 80:1‑6.
12. Damiens E, Mazurier J, el Yazidi I, et al. Effects of human lactoferrin on NK cell cyto‑
toxicity against haematopoietic and epithelial tumour cells. Biochim Biophys Acta 1998;
1402:277‑87.
13. Damiens E, El Yazidi I, Mazurier J, Duthille I, Spik G, Boilly‑Marer Y. Lactoferrin inhibits
G
1
cyclin‑dependent kinases during growth arrest of human breast carcinoma cells. J Cell
Biochem 1999; 74:486‑98.
14. Yoo YC, Watanabe R, Koike Y, et al. Apoptosis in human leukemic cells induced by lac‑
toferricin, a bovine milk protein‑derived peptide: Involvement of reactive oxygen species.
Biochem Biophys Res Commun 1997; 237:624‑8.
15. Ward PP, Paz E, Conneely OM. Multifunctional roles of lactoferrin: A critical overview. Cell
Mol Life Sci 2005; 62:2540‑8.
16. Tsuda H, Sekine K, Fujita K, Ligo M. Cancer prevention by bovine lactoferrin and underly‑
ing mechanisms—A review of experimental and clinical studies. Biochem Cell Biol 2002;
80:131‑6.
17. Sanchez L, Calvo M, Brock JH. Biological role of lactoferrin. Arch Dis Child 1992;
67:657‑61.
18. Tsuda H, Sekine K, Ushida Y, et al. Milk and dairy products in cancer prevention: Focus on
bovine lactoferrin. Mutat Res 2000; 462:227‑33.
19. Tsuda H, Sekine K. Milk Components as Cancer Chemopreventive Agents. Asian Pac J
Cancer Prev 2000; 1:277‑82.
20. Tsuda H, Sekine K, Takasuka N, Toriyama‑Baba H, Iigo M. Prevention of colon carci‑
nogenesis and carcinoma metastasis by orally administered bovine lactoferrin in animals.
Biofactors 2000; 12:83‑8.
21. Fujita K, Ohnishi T, Sekine K, Iigo M, Tsuda H. Downregulation of 2‑ami‑
no‑3,8‑dimethylimidazo[4,5‑f]quinoxaline (MeIQx)‑induced CYP1A2 expression is associ‑
ated with bovine lactoferrin inhibition of MeIQx‑induced liver and colon carcinogenesis in
rats. Jpn J Cancer Res 2002; 93:616‑25.
22. Weng J, Wang J, Cai Y, et al. Increased expression of prostate‑specific G‑protein‑coupled
receptor in human prostate intraepithelial neoplasia and prostate cancers. Int J Cancer 2005;
113:811‑8.
23. Freedland SJ, Humphreys EB, Mangold LA, et al. Risk of prostate cancer‑specific
mortality following biochemical recurrence after radical prostatectomy. JAMA 2005;
294(4):433‑439.
24. Zou Z, Zhang W, Young D, et al. Maspin expression profile in human prostate cancer (CaP)
and in vitro induction of Maspin expression by androgen ablation. Clin Cancer Res 2002;
8:1172‑7.
25. Ehrich M, Nelson MR, Stanssens P, et al. Quantitative high‑throughput analysis of DNA
methylation patterns by base‑specific cleavage and mass spectrometry. Proc Natl Acad Sci
USA 2005; 102:15785‑90.
26. Richter E MK, Cook C, Ehrich M, Tadese AY, Li H, Owusu A, Srivastava S, Dobi A. A role
for DNA methylation in regulating the growth suppressor PMEPA1 gene in prostate cancer.
Epigenetics 2007; In press.
27. Legrand D, Vigie K, Said EA, et al. Surface nucleolin participates in both the binding and
endocytosis of lactoferrin in target cells. Eur J Biochem 2004; 271:303‑17.
28. Naito S. Evaluation and management of prostate‑specific antigen recurrence after radical
prostatectomy for localized prostate cancer. Jpn J Clin Oncol 2005; 35:365‑74.
Figure 5. Effect of human lactotransferrin on cell cycle
in prostate cancer cells. LNCaP cells were grown
in cultures as described in Materials and Methods
and treated with 10 mM of LTF for 24 of 48 h. DNA
contents were analyzed by PI fluorescence flow
cytometry. Cells in the G
0
phase represent apoptotic
cells. Each phase was calculated by using ModiFIT
program. A, percentage of cells resident in each
cell-cycle phase in 24 h untreated control cells. B,
data indicate LTF induced robust apoptosis (G
0
)
and arrested progression in G
1
-S of the cell cycle
in 10 mM LTF treated LNCaP cells. C, percentage
of untreated control cells resident in each cell-cycle
phase at 48 h. D, LTF induced apoptosis and arrested
progression in G
1
-S of the cell cycle in response to10
mM LTF treatment for 48h.
Downloaded by [87.119.208.30] at 03:20 05 September 2015
©2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
www.landesbioscience.com Cancer Biology & Therapy e8
Decreased LTF expression in Prostate Cancer
29. Rhodes DR, Sanda MG, Otte AP, Chinnaiyan AM, Rubin MA. Multiplex biomarker
approach for determining risk of prostate‑specific antigen‑defined recurrence of prostate
cancer. J Natl Cancer Inst 2003; 95:661‑8.
30. Xiao Y, Monitto CL, Minhas KM, Sidransky D. Lactoferrin down‑regulates G
1
cyclin‑de‑
pendent kinases during growth arrest of head and neck cancer cells. Clin Cancer Res 2004;
10:8683‑6.
31. Katunuma N, Le QT, Murata E, et al. A novel apoptosis cascade mediated by lysosomal
lactoferrin and its participation in hepatocyte apoptosis induced by D‑galactosamine. FEBS
Lett 2006; 580:3699‑705.
32. Furlong SJ, Mader JS, Hoskin DW. Lactoferricin‑induced apoptosis in estrogen‑nonrespon‑
sive MDA‑MB‑435 breast cancer cells is enhanced by C6 ceramide or tamoxifen. Oncol Rep
2006; 15:1385‑90.
33. Ushida Y, Sekine K, Kuhara T, Takasuka N, Iigo M, Tsuda H. Inhibitory effects of bovine
lactoferrin on intestinal polyposis in the Apc(Min) mouse. Cancer Lett 1998; 134:141‑5.
Downloaded by [87.119.208.30] at 03:20 05 September 2015
