Content uploaded by Christian Meyer
Author content
All content in this area was uploaded by Christian Meyer on May 20, 2016
Content may be subject to copyright.
Insulin-resistant muscle is exercise resistant: evidence for reduced response
of nuclear-encoded mitochondrial genes to exercise
Elena De Filippis,
1
Guy Alvarez,
2
Rachele Berria,
2
Kenneth Cusi,
2
Sarah Everman,
1
Christian Meyer,
3
and Lawrence J. Mandarino
1
1
Center for Metabolic Biology, Arizona State University, Tempe, Arizona;
2
University of Texas Health Science Center at San
Antonio, San Antonio, Texas; and
3
Carl T. Hayden Veterans Affairs Medical Center, Phoenix, Arizona
Submitted 19 November 2007; accepted in final form 4 January 2008
De Filippis E, Alvarez G, Berria R, Cusi K, Everman S, Meyer C,
Mandarino LJ. Insulin-resistant muscle is exercise resistant: evidence
for reduced response of nuclear-encoded mitochondrial genes to exercise.
Am J Physiol Endocrinol Metab 294: E607–E614, 2008. First published
January 8, 2007; doi:10.1152/ajpendo.00729.2007.—Mitochondrial dys-
function, associated with insulin resistance, is characterized by low
expression of peroxisome proliferator-activated receptor-␥coacti-
vator-1␣(PGC-1␣) and nuclear-encoded mitochondrial genes. This
deficit could be due to decreased physical activity or a decreased
response of gene expression to exercise. The objective of this study
was to investigate whether a bout of exercise induces the same
increase in nuclear-encoded mitochondrial gene expression in insulin-
sensitive and insulin-resistant subjects matched for exercise capacity.
Seven lean and nine obese subjects took part. Insulin sensitivity was
assessed by an 80 mU䡠m
⫺2
䡠min
⫺1
euglycemic clamp. Subjects were
matched for aerobic capacity and underwent a single bout of exercise
at 70 and 90% of maximum heart rate with muscle biopsies at 30 and
300 min postexercise. Quantitative RT-PCR and immunoblot analyses
were used to determine the effect of exercise on gene expression and
protein abundance and phosphorylation. In the postexercise period,
lean subjects immediately increased PGC-1␣mRNA level (reaching
an eightfold increase by 300 min postexercise) and protein abundance
and AMP-dependent protein kinase phosphorylation. Activation of
PGC-1␣was followed by increase of nuclear respiratory factor-1 and
cytochrome coxidase (subunit VIc). However, in insulin-resistant
subjects, there was a delayed and reduced response in PGC-1␣mRNA
and protein, and phosphorylation of AMP-dependent protein kinase
was transient. None of the genes downstream of PGC-1␣was in-
creased after exercise in insulin resistance. Insulin-resistant subjects
have a reduced response of nuclear-encoded mitochondrial genes to
exercise, and this could contribute to the origin and maintenance of
mitochondrial dysfunction.
insulin resistance; mitochondrial function; exercise; peroxisome pro-
liferator-activated receptor-␥coactivator-1␣; AMP-dependent protein
kinase
INSULIN RESISTANCE IN SKELETAL MUSCLE is a characteristic of
obesity and type 2 diabetes mellitus (8). Recently, the concept
that mitochondrial dysfunction may, in part, explain insulin
resistance has gained support (16, 18, 21). In skeletal muscle of
insulin-resistant subjects, ATP turnover is reduced (22), and
this reduced energy demand may lead to an accumulation of
intramyocellular lipids, which, in turn, could inhibit insulin
signaling (17). A number of studies have shown a reduction in
a cluster of oxidative genes under the control of peroxisome
proliferator-activated receptor-␥coactivator-1 (PGC-1) (16,
21). PGC-1␣is expressed in tissues with high-oxidative ca-
pacity, such as heart, slow-twitch skeletal muscle, and brown
adipose tissue, and is considered to be a critical regulator of
mitochondrial biogenesis and functional capacity through an
increase in expression of nuclear-encoded mitochondrial genes
(32). In particular, PGC-1␣coactivates nuclear respiratory
factor-1 (NRF-1) and -2 (NRF-2). NRFs regulate expression of
mitochondrial transcription factor A, a nuclear-encoded tran-
scription factor essential for replication, maintenance, and
transcription of mitochondrial DNA (26a). NRF-1 and -2 also
control the expression of nuclear genes encoding respiratory
chain subunits and other proteins involved in mitochondrial
function (26a).
Mootha et. al. (16) showed that lower expression in this
cluster of genes was correlated with reduced whole body
aerobic capacity in patients with type 2 diabetes mellitus.
Physical activity ameliorates insulin resistance and has a ben-
eficial role in the prevention of type 2 diabetes (14), but the
mechanism involved in this positive effect is not fully under-
stood. Regular physical activity increases skeletal muscle mi-
tochondrial mass (11), and, since PGC-1 can drive mitochon-
drial biogenesis, it is likely that PGC-1␣may be responsible
for this effect of exercise. Studies in rodents have shown an
increase in PGC-1 mRNA between 5- and 7- to 10-fold
following a single bout of exercise (2), lending weight to this
notion. Moreover, AMP-dependent protein kinase (AMPK) is
activated by a low ATP-to-AMP ratio in response to exercise
in both animal models and humans (4, 9, 30, 31), and its
activation increases glucose and fatty acid oxidation. More
recently, AMPK activation, in response to either a single
exercise bout (29) or training (28), has been linked to further
activation of PGC-1␣as a potential mechanism responsible for
the training-induced increase in mitochondrial function and
biogenesis.
The association of decreased expression of nuclear-encoded
mitochondrial genes and reduced mitochondrial dysfunction
with insulin resistance might be explained in two ways. First,
since exercise is well known to increase the number and
activity of mitochondria (11), decreased mitochondrial func-
tion in insulin resistance could be merely due to decreased
physical activity. Alternatively, insulin-resistant muscle could
be less responsive to the ability of exercise to increase expres-
sion of nuclear-encoded mitochondrial genes, leading to the
relationship between decreased mitochondrial function and
insulin resistance. To differentiate between these possibilities,
we assessed the ability of a single bout of exercise to increase
Address for reprint requests and other correspondence: L. J. Mandarino,
Center for Metabolic Biology, Arizona State University, P. O. Box 873704
Tempe, AZ 85287-3704 (e-mail: Lawrence.Mandarino@asu.edu).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Am J Physiol Endocrinol Metab 294: E607–E614, 2008.
First published January 8, 2007; doi:10.1152/ajpendo.00729.2007.
http://www.ajpendo.org E607
expression of PGC-1 and nuclear-encoded mitochondrial genes
in lean, insulin-sensitive and obese, insulin-resistant subjects,
who were matched for exercise capacity and did not engage in
regular physical activity.
METHODS
Subjects. Seven lean control and nine obese nondiabetic subjects
were recruited for this study. The study was approved by the Institu-
tional Review Boards of the University of Texas Health Science
Center at San Antonio, the Carl T. Hayden Veterans Administration
Health Center, and Arizona State University. All studies were con-
ducted at either the General Clinical Research Center of the Univer-
sity of Texas Health Science Center at San Antonio or at the Carl
Hayden Veterans Affairs (VA) Hospital Diabetes Research Unit.
Informed, written consent was obtained from all subjects. None of the
volunteers engaged in regular exercise, nor did they change their total
body weight for at least 6 mo before participating in this study. As part
of the initial screening visit, a medical history, physical examination,
12-lead electrocardiogram, and a complete chemistry panel were
obtained. A 75-g oral glucose tolerance test was performed using
American Diabetes Association criteria to exclude nondiabetic sub-
jects with impaired glucose tolerance. No subjects were taking any
medication known to affect glucose metabolism.
Peak aerobic activity. Peak aerobic activity (V
˙O
2peak
) was deter-
mined using an electrically braked cycle ergometer and a Sensormed-
ics model V29 Metabolic Measurement System (Sensormedics, Savi
Park, CA), as previously described (6). Briefly, exercise was started at
a workload of 40 W and increased by 10 W/min until perceived
exhaustion or a respiratory quotient of 1.10 was reached. Heart rate
and rhythm were monitored using a 12-lead electrocardiogram. Lean
and obese subjects participating in the study were selected so as to be
matched for exercise capacity (V
˙O
2peak
and maximal work rate).
Euglycemic hyperinsulinemic clamp with basal muscle biopsy.
Subjects reported to the General Clinical Research Center at the
University of Texas Health Science Center at San Antonio or the
Diabetes Research Unit at the Carl T. Hayden VA Medical Center in
Phoenix, AZ, after a 10-h overnight fast. To determine insulin sensi-
tivity, subjects underwent a euglycemic hyperinsulinemic clamp, as
previously described (3a). At time ⫺120 min, a primed (25 Ci),
continuous (0.25 Ci/min) infusion of [3-
3
H]glucose was started via
a catheter placed into an antecubital vein and continued throughout
the study. A second catheter was placed in retrograde fashion in a vein
on the back of the hand, which was then placed in a heated box
(60°C). Baseline arterialized venous blood samples for determining
plasma [3-
3
H]glucose radioactivity and plasma glucose, free fatty
acid, and insulin concentrations were drawn at ⫺30, ⫺20, ⫺10, ⫺5,
and 0 min. At time 0 min, a primed, continuous infusion of regular
human insulin (Novolin; Novo Nordisk, Princeton, NJ) was started at
a rate of 80 mU䡠m
⫺2
䡠min
⫺1
and was continued for 120 min. Plasma
glucose was measured with a glucose analyzer (Beckman Instruments,
Fullerton, CA) at ⬃5-min intervals throughout the euglycemic clamp,
and a variable infusion of 20% glucose was used to maintain eugly-
cemia. Sixty minutes before the insulin infusion was started, a per-
cutaneous biopsy of the vastus lateralis muscle was obtained using a
Bergstrom cannula. This biopsy served as the basal, preexercise
muscle specimen taken under resting, unstimulated conditions. Mus-
cle biopsy specimens (50 –200 mg) were immediately blotted free of
blood, frozen, and stored in liquid nitrogen until use.
Exercise bout with muscle biopsies. All subjects also underwent an
exercise test consisting of a single bout of aerobic exercise. The
exercise bout was conducted on a separate day after determination of
V
˙O
2peak
and at least 1 wk either before or after the euglycemic
hyperinsulinemic clamp. Subjects reported to the General Clinical
Research Center or Diabetes Research Unit at about 7 AM after
fasting overnight. Upon arrival, vital signs were collected, and an
antecubital catheter was placed. Subjects were asked to exercise on a
recumbent cycle (Schwinn 205P) for a total of 48 min, not including
warm-up. The design of the exercise bout is shown in Fig. 1. Subjects
warmed up by pedaling for ⬃5 min with no resistance. When the
subject felt comfortable, resistance was increased until the subject’s
heart rate reached 70% of maximum heart rate measured during the
Fig. 1. Design of the exercise session. The exercise session was organized into
4 sets; exercise was carried out on a stationary recumbent cycle. In each set,
subjects cycled for 8 min at moderate intensity [70% of their individual
maximum heart rate (HR)], then for 2 min at high intensity (90% of their
individual maximum HR), followed by 2 min with no resistance. This set was
repeated 4 times. Throughout the exercise session, HR was monitored using a
3-lead ECG and recorded every 2 min. Biopsies (Bx) of the vastus lateralis
muscle were performed 30 min (t
30⬘
)and5h(t
300⬘
) after completion of the 4
sets of exercise.
Table 1. Primer sequences for quantitative RT-PCR
Gene Accession Number Forward Primer Sequence (5⬘33⬘) Reverse Primer Sequence (3⬘35⬘)
-Actin NM_001101.2 AAACTGGAACGGTGAAGGTG AGAGAAGTGGGGTGGCTTTT
PGC-1␣NM_013261 TTTCCTTTTGCCATGGAATC GAAAGAACCGCTGAACAAGC
NRF-1 NM_005011.2 TGACATTGGAACAGTGACAT AATGCAGTTTCTTCACCAAT
NRF-2 U_13048 AAATTGAGATTGATGGAACAGAGAA TATGGCCTGGCTTACACATTCA
cytochrome coxidase subunit VIc NM_004374 AAGGACGTTGGTGTTGAGGT TTTCTTTGATCAGCCACACG
cytochrome coxidase subunit VIIc NM_001867 GTTTGTACTTTGGATCTGCATT TGGCATATGAGTTCTAGTTTGA
AMPK-␣
1
NM_006251 ATGCTGAGGCTCAAGGAAAA GGAAGCATTTGGCTGTGACT
AMPK-␣
2
NM_006252 ACCAGCTTGCAGTGGCTTAT CAGTGCATCCAATGGACATC
LKB1 NM_000455 GGCCTCCATGCACTTTATGT CCACAGCTCAAATCCACCTT
STRAD BK_001542 CAAACCTGGAAGAGCTGGAG AAAAGCCTTGGAGCAGTGAA
MO25 AF_113536 CAGTCCAGGTTGGAGATCGT ACTTGCCACACTGCACTCAG
Primer sequences of genes analyzed using quantitative RT-PCR are as described in METHODS. PGC-1␣, peroxisome proliferative-activated receptor-␥
coactivator-1␣; NRF, nuclear respiratory factor; AMPK, AMP kinase; LKB1, serine/threonine kinase like; STRAD, Ste20-related adaptor protein-␣; MO25,
mouse protein 25-␣.
E608 EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
V
˙O
2peak
test; the resistance was then kept stable for 8 min. For the next
2 min, resistance was increased so that the subject’s heart rate reached
90% of maximum heart rate. Resistance then was reduced to zero for
a 2-min rest interval, completing the first set of exercise. This scheme
was repeated for a total of four times. Immediately after completing
the fourth set, the subject was moved to a bed where a biopsy of the
vastus lateralis muscle was performed within 30 min after completion
of the exercise bout (⬃1.5 h after the start of exercise). A second
muscle biopsy followed after5hofbedrest, at ⬃3 PM.
Muscle processing. Muscle samples were homogenized, as previ-
ously described (19). Muscle samples were weighed while still frozen
and were homogenized in ice-cold lysis buffer (1:10 wt/vol) contain-
ing 20 mmol/l Tris䡠HCl (pH 7.4), 1% Triton X-100, 50 mmol/l NaCl,
250 mmol/l sucrose, 50 mmol/l NaF, 5 mmol/l sodium pyrophosphate,
2 mmol/l dithiothreitol, 4 mg/l leupeptin, 50 mg/l trypsin inhibitor, 0.1
mmol/l benzamidine, and 0.5 mmol/l phenylmethylsulphonyl fluoride.
The homogenate was centrifuged at 14,000 gfor 30 min at 4°C.
Homogenates were incubated on ice for 30 min and then centrifuged
at 15,000 gfor 20 min at 4°C. The supernatants were collected, and
protein concentrations were measured by the Lowry method. Super-
natants were stored at ⫺80°C until use.
SDS-PAGE and immunoblotting. Immunoblot analysis using 50-g
muscle protein was carried out as described (5). Briefly, protein
lysates were separated by 7.5% SDS-PAGE and transferred to nitro-
cellulose membranes. After blocking in Tris-buffered saline with 5%
nonfat dry milk, the membranes were incubated overnight at 4°C with
antibodies against PGC-1␣(Cayman, Ann Arbor, MI), phospho-
AMPK-␣(Thr
172
), AMPK-␣
1
, and AMPK-␣
2
(Cell Signaling Tech-
nology, Danvers, MA), following the manufacturer’s recommenda-
tions (28). The blots were then quantified by densitometry (VersaDoc
imaging system, model 5000; Bio-Rad, Hercules, CA).
Quantitative RT-PCR. Total RNA was extracted from 30 –50 mg of
muscle using the acid guanidinium thiocyanate-phenol-chloroform
extraction with modification (RNA STAT-60; TEL-TEST, Friends-
wood, TX). Oligo(dT) single-stranded cDNA was synthesized using
iScript cDNA synthesis kit (Bio-Rad). Forward and reverse primers
complementary to the human genes of interests (Table 1) were
designed using the web-based software Primer 3 (http://frodo.wi.mit.
edu/cgi-bin/primer3/primer3_www.cgi) and synthesized by IDT Inte-
grated (DNA Technologies, Coralville, IA). RT-PCR was performed
using the MyiQ Single-Color RT-PCR detection system (Bio-Rad,
Coralville, IA), using the iQ SYBRgreen Supermix reagents (Bio-
Rad, Hercules, CA) added to 160 ng of cDNA previously synthesized.
To determine the efficiencies of each primer pair, a standard curve
was generated by serial dilution of an RNA sample taken from a
healthy subject. Each sample was run in duplicate, and the mean value
of the duplicate was used to calculate the mRNA expression of the
gene of interest and an endogenous control. The quantity of the gene
of interest in each sample was normalized to that of -actin RNA
using the comparative (2
⫺⌬⌬CT
) method (15). Statistical comparisons
were done using paired t-tests.
Analytical determinations. Plasma insulin concentrations were
measured by radioimmunoassay (Diagnostic Product, Los Angeles,
CA). Tritiated glucose-specific activity was determined using barium
hydroxide/zinc sulfate deproteinization of plasma samples, and rates
of glucose appearance and disappearance were calculated using
steady-state or non-steady-state equations, as appropriate (7). Plasma
free fatty acid concentrations were determined by an enzymatic,
calorimetric quantification method (Wako, Nuess, Germany).
Statistical analysis. Data are presented as means ⫾SE. Data were
compared using repeated-measures analysis of variance, followed by
one- or two-tailed Student’s paired t-tests, as appropriate. Statistical
tests were performed using StatView version 5.0 (SAS Institute, Cary,
NC). The significance level was set at 0.05. Analysis of covariance
was used to assess any effects of age on glucose metabolism or gene
expression and protein abundance changes in response to exercise. To
illustrate the variability in response to exercise, box-whisker plots
were used. These plots show the median, mean, and 5th and 95th
percentile, and data range from lowest to highest value, as well as any
skewness in the data.
RESULTS
Subject characteristics and insulin sensitivity. Clinical char-
acteristics of the subjects are shown in Table 2. The obese
subjects had a greater body mass index (BMI) and fat mass
(P⬍0.01) and were somewhat older (48 ⫾3 vs. 33 ⫾4 yr;
P⬍0.01) than the lean group. As expected, all of the other
Table 2. Characteristics of subjects
Lean Obese
Sex (male/female) 3/3 6/3
Age, yr 33⫾448⫾3*
BMI, kg/m
2
25⫾132⫾2*
BW, kg 69⫾5.5 95⫾8*
FM, kg 19⫾232⫾3.5*
FFA, mol/l 550⫾0.2 583⫾0.05
FPG, mmol/l 5.2⫾0.08 5.4⫾0.18
FPI, pmol/l 73.6⫾6.2 130⫾2.8
Hb A
1c
,% 5.3⫾0.2 5.5⫾0.1
Total cholesterol, mmol/l 4.3⫾0.22 4.4⫾0.2
Triglycerides, mmol/l 0.9⫾0.1 1.4⫾0.4
HDL cholesterol, mmol/l 1.2⫾0.1 1.2⫾0.05
LDL cholesterol, mg/dl 2.7⫾0.3 2.6⫾0.1
SBP, mmHg 117⫾4 126⫾6
DBP, mmHg 70⫾380⫾3
Resting heart rate, beats/min 65⫾5.5 72⫾3
Subject characteristics are baseline values expressed as means ⫾SE. BMI,
body mass index; BW, body weight; FM, fat mass; FFA, free fatty acid; FPG,
fasting plasma glucose; FPI, fasting plasma insulin; Hb A
1c
, glycosylated
hemoglobin; SBP, systolic blood pressure; DBP, diastolic blood pressure.
*P⬍0.01 vs. lean controls.
Table 3. Exercise characteristics
Lean Obese
Maximum HR, beats/min 170⫾12 168⫾6
70% Maximum HR, beats/min 119⫾8 118⫾4
90% Maximum HR, beats/min 153⫾11 152⫾5
V
˙O
2peak
,ml䡠kg FFM
⫺1
䡠min
⫺1
35.4⫾1.0 35.0⫾3.4
Maximum workload, W 149⫾13 156⫾9
Values are means ⫾SE. Peak measurements are maximum values obtained
during peak aerobic activity (V
˙O
2peak
) test. Heart rate (HR) peak is the mean
heart rate during the last minute of exercise during the V
˙O
2peak
test. The
maximum workload represents the highest workload reached and sustained,
corresponding to the maximum HR and V
˙O
2peak
observed during V
˙O
2peak
test.
FFM, fat-free mass.
Table 4. Rates of glucose metabolism during an 80 mU/m
2
euglycemic hyperinsulinemic clamp
Lean Obese
Glucose production
Basal 2.6⫾0.5 2.8⫾0.4
Insulin 0 0
Glucose disposal
Basal 2.6⫾0.5 2.8⫾0.4
Insulin 9.7⫾0.7 7.0⫾0.7*
Values are means ⫾SE in ml 䡠kg FFM
⫺1
䡠min
⫺1
. Endogenous glucose
production was calculated during the euglycemic hyperinsulinemic clamp, as
described in METHODS.*P⬍0.05 vs. lean controls.
E609EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
clinical parameters, such as Hb A
1c
, fasting plasma glucose,
lipid profile, and blood pressure, were comparable between
the lean and obese individuals. Expressed relative to lean
body mass, the lean and obese groups were matched for
V
˙O
2peak
(35.0 ⫾1.2 vs. 35.0 ⫾3.4 ml䡠kg fat-free mass
⫺1
䡠min
⫺1
)
and maximum heart rate (170 ⫾12 vs. 168 ⫾6 beats/min,
Table 3).
To assess insulin sensitivity, subjects underwent a euglyce-
mic clamp. The results are shown in Table 4. Rates of basal
endogenous glucose production were similar between the
groups. However, the rate of insulin-stimulated glucose uptake
was significantly higher in the lean subjects compared with the
obese (P⬍0.05). Although the obese subjects were slightly
older, when glucose disposal was regressed against BMI, fat
mass, and age using a stepwise model, BMI was the only
variable that significantly influenced insulin-stimulated glu-
cose uptake (P⬍0.05), accounting for 50% of the variability
among subjects. Age was not a significant factor.
Effect of a single bout of exercise. During the 48-min aerobic
exercise bout (Fig. 1), heart rate was monitored continuously
and recorded every 2 min. Exercise intensity was adjusted as
necessary to maintain the target heart rate. Analysis of mean
heart rate during each set showed that all participants reached
the predicted heart rate, and no differences in heart rate during
exercise were observed between groups (Table 3). Because
heart rate and workload did not differ between the groups
(Table 3), subjects exercised at the same relative and absolute
intensities.
The expression levels of nuclear-encoded genes involved in
mitochondrial biogenesis and function (primer sequences are
given in Table 1) were analyzed using quantitative RT-PCR in
muscle biopsy samples obtained at rest before the euglycemic
clamp and 30 min and 5 h after exercise. At rest, there were no
differences in mRNA expression between lean and obese
groups for any gene other than AMPK-␣
2
, which was de-
creased by ⬃50% (P⬍0.05; Table 5). To assess the effects of
exercise, basal values were set to a value of 1.0. In the lean
subjects, a single bout of exercise significantly upregulated
Fig. 2. Effect of exercise on peroxisome prolifera-
tor-activated receptor-␥coactivator-1␣(PGC-1␣)
mRNA and protein expression. Expression of
PGC-1␣mRNA and protein levels were measured
as described in METHODS.A: time course of
PGC-1␣mRNA response. Data were calculated
using the 2
⫺⌬⌬CT
method (see text) and were
expressed as fold increase over baseline values for
7 lean (F) and 9 obese (■) subjects. Data are given
as means ⫾SE. B: box-whisker plot of PGC-1␣
mRNA responses used in the 30- and 300-min
postexercise periods for A(all basal values set to
1.0). The dashed line within the box shows the
mean, the solid line within the box shows the
median, the upper and lower limits of the boxes are
the 95th and 5th percentiles, respectively, and the
whiskers show the lower and upper data ranges.
The horizontal dashed line at a value of 1.0 shows
the preexercise value. C: PGC-1␣protein abun-
dance changes at 30 min (light gray bars) and 300
min (dark gray bars) after exercise, compared with
basal values (solid bars) in lean and obese subjects.
D: box-whisker plot of PGC-1␣protein responses
used in the 30- and 300-min postexercise periods
for C.*P⬍0.05, #P⬍0.01 vs. basal values.
Table 5. Expression of mRNA under basal conditions
Gene Lean Obese
PGC-1␣4.14⫾0.28 3.87⫾0.22
NRF-1 5.74⫾0.78 5.80⫾0.24
NRF-2 5.14⫾0.51 5.11⫾0.20
cytochrome coxidase (subunit VIc) ⫺0.51⫾0.25 ⫺1.11⫾0.17
cytochrome coxidase (subunit VIIc) ⫺3.46⫾0.48 ⫺3.03⫾0.21
AMPK-␣
1
2.40⫾0.45 2.92⫾0.54
AMPK-␣
2
0.07⫾0.29 1.23⫾0.34*
LKB1 4.66⫾0.63 4.53⫾0.61
MO25 0.16⫾0.35 0.19⫾0.26
STRAD 8.79⫾0.80 9.09⫾0.45
Values are presented as means ⫾SE of change in threshold cycle values
compared with -actin control mRNA values for each individual. -Actin
threshold cycle values were 23.3 ⫾0.1 and 23.7 ⫾0.1 in lean and obese
subjects, respectively (P⫽not significant). Basal muscle biopsies samples
were obtained during the euglycemic, hyperinsulinemic clamp as described in
the METHODS section. Quantification of the above genes was assessed by
quantitative RT-PCR using 160 ng cDNA, as described in METHODS.*P⬍0.05
vs. lean controls by t-test.
E610 EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
PGC-1␣mRNA level as early as 30 min postexercise
(Fig. 2A); this increase was then sustained for at least 5 h after
exercise. Compared with lean subjects, obese insulin-resistant
subjects had a delayed and reduced increase in PGC-1␣mRNA
level, even though relative exercise intensity, absolute work
rate, and heart rate were the same. In particular, in obese
subjects, no change compared with baseline was observed 30
min after exercise (Fig. 2A); however, 5 h after exercise, there
was a significant increase in mRNA level compared with
resting values. Compared with lean subjects, however, the
increase in PGC-1␣mRNA was significantly lower (P⬍0.05)
at 30 min in the obese group, and this trend was maintained at
5h(P⫽0.055). Using a stepwise regression analysis, we also
evaluated whether confounding factors such as age, BMI, or fat
mass were independently influencing our analysis. This anal-
ysis showed that age did not independently contribute to the
variability in the response of PGC-1 mRNA to exercise. The
variability of response to exercise of PGC-1␣mRNA is shown
using a box-whisker plot in Fig. 2B.
Having determined that exercise increased PGC-1 mRNA,
next we assessed whether this increase was translated into
higher protein abundance. Using immunoblot analysis, we
found that the pattern of increase in PGC-1␣protein mirrored
that of mRNA, with the obese group having a delayed and
blunted response compared with the lean control subjects (Fig.
2C). Variability in the response to exercise of PGC-1␣protein
abundance is shown in Fig. 2D.
In conjunction with a network of transcription factors,
PGC-1␣coordinates the expression of genes involved in aer-
obic energy metabolism. PGC-1␣participates in regulating the
expression of NRF-1 and NRF-2, which, in turn, control
expression of regulators of mitochondrial DNA regulation,
replication, and genes involved in the mitochondrial respira-
tory apparatus, such as cytochrome coxidase (subunit VIc and
VIIc) (24). Therefore, we investigated whether activation of
PGC-1␣was followed by further activation of these genes in
response to exercise. Exercise by lean individuals significantly
increased NRF-1 mRNA at 30 min and 5 h after exercise; no
effect of exercise was observed in the obese subjects (Fig. 3A).
In lean subjects, we also observed a subsequent activation of
the downstream cytochrome coxidase (subunit VIc) gene (Fig.
3C). NRF-2 and its downstream cytochrome coxidase (subunit
VIIc) were not activated in either group in response to a single
bout of exercise at any time point analyzed (data not shown).
These diminished responses in the obese subjects were consis-
tent with the decreased response of PGC-1␣to exercise.
Variability in the responses to exercise of NRF-1 and cyto-
chrome coxidase, subunit VIc mRNA expression levels, are
shown in Fig. 3, Band D.
Exercise also is a known regulator of AMPK. Recently,
AMPK activation has been suggested to be involved in regu-
lating expression of PGC-1␣, thereby potentially playing a role
in mitochondrial biogenesis or function (28). Because of the
reduced response of PGC-1␣to exercise in insulin-resistant
subjects, we asked whether this could be due to decreased
activation of AMPK. To answer this question, we examined the
effect of exercise on the mRNA level of AMPK catalytic
subunits ␣
1
and ␣
2
and of LKB1 complex (LKB1, MO25, and
Fig. 3. Effect of exercise on nuclear respiratory fac-
tor-1 (NRF-1) and cytochrome coxidase (subunit VIc)
mRNA expression. A: time course of response of
NRF-1 mRNA (mean ⫾SE) to exercise in 7 lean (F)
and in 9 obese (■) subjects. -Actin was used for
normalization purposes. B: box-whisker plot of NRF-1
mRNA responses used in the 30- and 300-min postex-
ercise periods for A. See Fig. 2 legend for description.
C: time course of response of cytochrome coxidase
subunit VIc mRNA (mean ⫾SE) to exercise in 7 lean
(F) and in 9 obese (■) subjects. -Actin was used for
normalization purposes. D: box-whisker plot of cyto-
chrome coxidase subunit VIc mRNA responses used
in the 30- and 300-min postexercise periods for C.
*P⬍0.05 vs. basal values.
E611EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
STRAD). LKB1 is one of the major kinases responsible for
AMPK activation (10). There were no exercise-induced
changes in the mRNA levels for any of these genes (Table 6),
indicating that regulation at the level of gene expression was
not involved. We, therefore, used immunoblot analysis to
determine whether AMPK was activated by phosphorylation
(Fig. 4A). Lean subjects showed a significant increase in Thr
172
phosphorylation of AMPK-␣within 30 min of the end of
exercise, and this increase was maintained for at least 5 h.
Obese individuals exercising at the same intensity had a tran-
sient activation of AMPK-␣, reaching significance only at 30
min postexercise and decreasing thereafter (Fig. 4A). In keep-
ing with the lack of increase in mRNA for AMPK-␣, immu-
noblot analysis for the abundance of the catalytic subunit
showed only a minimal increase (Fig. 4, Band C).
DISCUSSION
Several lines of evidence suggest that insulin resistance and
impaired mitochondrial function are closely related. Studies
using
31
P-NMR spectroscopy show decreased ATP turnover in
insulin resistance (23), and enzymatic activity assays (25) as
well as apparent structural changes (13) also reveal abnormal-
ities. Studies using global gene expression analyses have
shown mRNA expression of a cluster of genes encoding
proteins involved in electron transport and oxidative phosphor-
ylation is lower in insulin-resistant individuals, and that this
concerted decrease possibly can be explained by decreased
expression of PGC-1␣(16, 21).
A number of studies have shown that an increase in PGC-1␣
expression mediated through AMPK signaling is important for
the induction of mitochondrial biogenesis by exercise (3, 28,
29). A decrease in expression of PGC-1 and nuclear-encoded
mitochondrial genes in insulin-resistant subjects could mean
that these subjects have a lower level of physical activity or a
reduced response of these genes to exercise. In the present
study, we controlled for physical activity by studying only
sedentary subjects who were matched for aerobic capacity
(V
˙O
2peak
) and peak work rate during a maximal exercise test. If
there were an abnormality in mitochondrial biogenesis in
insulin-resistant muscle, then it seems reasonable to hypothe-
size that exercise might not produce the same increase in
PGC-1␣expression in insulin-resistant individuals as it does in
those who are insulin sensitive. To avoid any confounding
effects of hyperglycemia, we also chose to test this hypothesis
in normal glucose-tolerant, obese, insulin-resistant subjects,
compared with healthy, lean controls. A single bout of exercise
is known to increase PGC-1␣gene expression (2, 29). To test
the hypothesis that exercise differentially regulates gene ex-
pression in insulin-sensitive and insulin-resistant skeletal mus-
cle, we used a single bout of exercise consisting of four sets of
12 min of cycling exercise, each of which included 2 min of
high-intensity exercise (90% of V
˙O
2peak
heart rate).
Fig. 4. Phospho-AMPK (pAMPK)-␣and AMPK-␣subunit protein content in
lean and obese subjects. pAMPK (A), AMPK-␣
1
(B), and AMPK-␣
2
(C)
subunits of protein abundance were measured in samples using immunoblot
analysis, as described in METHODS. Values are means ⫾SE. *P⬍0.05, #P⬍
0.01 vs. basal values.
Table 6. LKB1, MO25, and STRAD mRNA expression at
basal and postexercise
Gene
Lean Obese
Basal 30 min 5 h Basal 30 min 5 h
LKB1 1.0 1.5⫾0.6 3.3⫾2.0 1.0 1.6⫾0.5 0.9⫾0.2
MO25 1.0 1.9⫾0.7 0.8⫾0.1 1.0 1.2⫾0.4 0.7⫾0.1
STRAD 1.0 1.3⫾0.3 1.1⫾0.3 1.0 1.4⫾0.5 1.6⫾0.5
Values are expressed as fold increase vs. baseline and given as means ⫾SE.
Basal and postexercise mRNA levels were determined by RT-PCR in lean and
obese subjects.
E612 EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
At baseline, the majority of genes had similar expression
levels in the lean and obese groups. The exception was
AMPK-␣
2
mRNA, which was reduced in the obese subjects.
However, the small sample sizes of the groups in the present
study temper conclusions. The results of this study show that,
in insulin-sensitive subjects, exercise promptly increases
PGC-1␣mRNA. Within 30 min after the end of exercise,
PGC-1␣mRNA was significantly higher than basal levels, and
this increase in mRNA for PGC-1␣was magnified to about
eightfold within 5 h after the end of exercise. In contrast, in the
obese, insulin-resistant subjects, PGC-1␣mRNA was not in-
creased at 30 min following cessation of exercise. Although,
after5hofrest, PGC-1␣mRNA had increased in the insulin-
resistant group, this increase was only one-half of that achieved
by the insulin-sensitive subjects. These differences in gene
expression changes were reflected in differences in changes in
PGC-1␣protein abundance, as determined using immunoblot
analysis. In a recent study that used low- and moderate-
intensity exercise (50 and 70% of V
˙O
2peak
), it was reported that
the response of PGC-1␣mRNA to exercise was not signifi-
cantly reduced in obese, insulin-resistant subjects (27). Using
higher-intensity exercise (70 –90% V
˙O
2peak
), the results of the
present study show that, in fact, exercise does not increase
PGC-1␣mRNA in a normal fashion in insulin-resistant mus-
cle. The differences in the results of these studies are probably
accounted for by the different exercise intensities that were
used. Of note, the decrease in response of NRF-2 mRNA
observed in that study (27) is consistent with a decreased
PGC-1␣mRNA response and also is supported by our find-
ings. When the present findings are taken together with previ-
ous results (27), the evidence shows that a decreased ability of
exercise to produce changes leading to mitochondrial biogen-
esis is associated with insulin resistance. For these and all
responses observed in the present study, it must be noted that
the sample sizes of the groups were small, as is typical for this
type of study, and the results should be confirmed by additional
experiments.
NRF-1 and NRF-2 are transcription factors that are under the
regulatory control of PGC-1 (32) and are thought to mediate
many of the effects of PGC-1. Expression levels of NRF-1
mRNA and one of its downstream activated genes, cyto-
chrome coxidase (subunit VIc), were increased in lean,
insulin-sensitive controls, but not in obese, insulin-resistant
individuals following exercise. These observations lend fur-
ther weight to the notion that insulin resistance is accom-
panied by a reduced mitochondrial biogenic response to
exercise and extend the previous findings (27) to the level of
expression of nuclear-encoded mitochondrial genes, exem-
plified here by cytochrome coxidase subunit VIc. It may be
significant that both insulin resistance and the extent of
response to exercise training are familial (1), and it is
tempting to speculate that these phenomena are related.
Because AMPK activation by exercise has been implicated
in the regulation of PGC-1␣expression, we also examined the
exercise-induced response of expression of AMPK-␣
1
and -␣
2
subunits as well as the LKB1 complex, which may be respon-
sible for activation of AMPK (26). Exercise did not increase
mRNA expression or protein abundance of any of these genes,
verifying the results of a previous report (27). However, the
exercise-induced increase in phosphorylation of AMPK was
greater in insulin-sensitive subjects in the present study, con-
sistent with the results for PGC-1␣. Previous results (27) with
lower intensity exercise showed that the response of AMPK
activity to exercise was reduced in insulin-resistant muscle.
The present results show that even high-intensity exercise may
not be able to overcome this abnormality.
Taken together, these data suggest that, in insulin resistance,
decreased AMPK phosphorylation and activation in response
to exercise may lead to a diminished response of PGC-1␣gene
expression. The decrease in PGC-1␣response, in turn, may
lead to a decreased exercise-induced response of mitochondrial
biogenesis to exercise in insulin-resistant subjects. A reduced
ability to respond to exercise may then lead to reduced mito-
chondrial function, a decreased capacity of muscle for fat
oxidation, accumulation of intramyocellular lipids, and subse-
quent inhibition of insulin signaling. In this manner, a vicious
cycle reinforcing insulin resistance and diminished mitochon-
drial function may be established.
ACKNOWLEDGMENTS
The expert technical assistance of Kenneth Kirschner, Kathy Camp, and
Sheila Taylor and the expert nursing assistance of Norma Diaz, James King,
John Kincaid, and Alexandra Meyer are gratefully acknowledged. We are
grateful to Dr. Stephanie Schroeder for assistance during the study. We also
thank all of the volunteers who participated in the study.
GRANTS
These studies were supported by National Institute of Diabetes and Diges-
tive and Kidney Diseases Grants DK-66483 and DK-47936 (L. J. Mandarino)
and the Carl T. Hayden VA Medical Center.
REFERENCES
1. An P, Teran-Garcia M, Rice T, Rankinen T, Weisnagel SJ, Bergman
RN, Boston RC, Mandel S, Stefanovski D, Leon AS, Skinner JS, Rao
DC, Bouchard C. Genome-wide linkage scans for prediabetes phenotypes
in response to 20 weeks of endurance exercise training in non-diabetic
whites and blacks: the HERITAGE Family Study. Diabetologia 48:
1142–1149, 2005.
2. Baar K, Wende AR, Jones TE, Marison M, Nolte LA, Chen M, Kelly
DP, Holloszy JO. Adaptations of skeletal muscle to exercise: rapid
increase in the transcriptional coactivator PGC-1. FASEB J 16: 1879–
1886, 2002.
3. Bergeron R, Ren JM, Cadman KS, Moore IK, Perret P, Pypaert M,
Young LH, Semenkovich CF, Shulman GI. Chronic activation of AMP
kinase results in NRF-1 activation and mitochondrial biogenesis. Am J
Physiol Endocrinol Metab 281: E1340 –E1346, 2001.
3a.Berria R, Wang L, Richardson DK, Finlayson J, Belfort R, Pratipana-
watr T, De Filippis EA, Kashyap S, Mandarino LJ. Increased collagen
content in insulin-resistant skeletal muscle. Am J Physiol Endocrinol
Metab 290: E560 –E565, 2006.
4. Chen ZP, Stephens TJ, Murthy S, Canny BJ, Hargreaves M, Witters
LA, Kemp BE, McConell GK. Effect of exercise intensity on skeletal
muscle AMPK signaling in humans. Diabetes 52: 2205–2212, 2003.
5. Cusi K, Maezono K, Osman A, Pendergrass M, Patti ME, Pratipana-
watr T, DeFronzo RA, Kahn CR, Mandarino LJ. Insulin resistance
differentially affects the PI 3-kinase- and MAP kinase-mediated signaling
in human muscle. J Clin Invest 105: 311–320, 2000.
6. De Filippis E, Cusi K, Ocampo G, Berria R, Buck S, Consoli A,
Mandarino LJ. Exercise-induced improvement in vasodilatory function
accompanies increased insulin sensitivity in obesity and type 2 diabetes
mellitus. J Clin Endocrinol Metab 91: 4903– 4910, 2006.
7. DeFronzo RA, Tobin JD, Reubin A. Glucose clamp technique: a method
for quantifying insulin secretion and resistance. Am J Physiol 6: E214 –
E223, 1979.
8. DeFronzo RA. Lilly lecture 1987. The triumvirate: beta-cell, muscle,
liver. A collusion responsible for NIDDM. Diabetes 37: 667– 687, 1988.
9. Fujii N, Hayashi T, Hirshman MF, Smith JT, Habinowski SA, Kaijser
L, Mu J, Ljungqvist O, Birnbaum MJ, Witters LA, Thorell A,
Goodyear LJ. Exercise induces isoform-specific increase in 5⬘AMP-
E613EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
activated protein kinase activity in human skeletal muscle. Biochem
Biophys Res Commun 273: 1150 –1155, 2000.
10. Hawley S, Boudeau J, Reid J, Mustard K, Udd L, Makela T, Alessi
D, Hardie DG. Complexes between the LKB1 tumor suppressor,
STRADalpha/beta and MO25alpha/beta are upstream kinases in the
AMP-activated protein kinase cascade. J Biol 2: 28, 2003.
11. Hood DA. Plasticity in Skeletal, Cardiac, and Smooth Muscle: Invited
Review. Contractile activity-induced mitochondrial biogenesis in skeletal
muscle. J Appl Physiol 90: 1137–1157, 2001.
13. Kelley DE, He J, Menshikova EV, Ritov VB. Dysfunction of mitochon-
dria in human skeletal muscle in type 2 diabetes. Diabetes 51: 2944 –2950,
2002.
14. Lindstro¨m J, Ilanne-Parikka P, Peltonen M, Aunola S, Eriksson J,
Hemio¨K,Ha¨ma¨la¨inen H, Ha¨rko¨ nen P, Keina¨ nen-Kiukaanniemi S,
Laakso M, Louheranta A, Mannelin M, Paturi M, Sundvall J, Valle T,
Uusitupa M, Tuomilehto J; Finnish Diabetes Prevention Study
Group. Sustained reduction in the incidence of type 2 diabetes by lifestyle
intervention: follow-up of the Finnish Diabetes Prevention Study. Lancet
368: 1673–1679, 2006.
15. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2-⌬⌬CT method. Methods 25:
402– 408, 2001.
16. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S,
Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis
N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P,
Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC.
PGC-1␣-responsive genes involved in oxidative phosphorylation are co-
ordinately downregulated in human diabetes. Nat Genet 34: 267–273,
2003.
17. Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes N,
Neschen S, White MF, Bilz S, Sono S, Pypaert M, Shulman GI.
Reduced mitochondrial density and increased IRS-1 serine phosphoryla-
tion in muscle of insulin-resistant offspring of type 2 diabetic parents.
J Clin Invest 115: 3587–3593, 2005.
18. Morino K, Petersen KF, Shulman GI. Molecular mechanisms of insulin
resistance in humans and their potential links with mitochondrial dysfunc-
tion. Diabetes 55: S9 –S15, 2006.
19. Musi N, Fujii N, Hirshman MF, Ekberg I, Froberg S, Ljungqvist O,
Thorell A, Goodyear LJ. AMP-activated protein kinase (AMPK) is
activated in muscle of subjects with type 2 diabetes during exercise.
Diabetes 50: 921–927, 2001.
21. Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S,
Miyazaki Y, Kohane I, Costello M, Saccone R, Landaker EJ, Goldfine
AB, Mun E, DeFronzo R, Finlayson J, Kahn CR, Mandarino LJ.
Coordinated reduction of genes of oxidative metabolism in humans with
insulin resistance and diabetes: potential role of PGC1 and NRF1. Proc
Natl Acad Sci USA 100: 8466– 8471, 2003.
22. Petersen KF, Dufour S, Shulman GI. Decreased insulin-stimulated ATP
synthesis and phosphate transport in muscle of insulin-resistant offspring
of type 2 diabetic parents. PLoS Med 2: e233, 2005.
23. Petersen KF, Dufour S, Befroy D, Garcia R, Shulman GI. Impaired
mitochondrial activity in the insulin-resistant offspring of patients with
type 2 diabetes. N Engl J Med 350: 664– 671, 2004.
24. Puigserver P, Spiegelman BM. Peroxisome proliferator-activated recep-
tor-␥coactivator 1␣(PGC-1␣): transcriptional coactivator and metabolic
regulator. Endocr Rev 24: 78 –90, 2003.
25. Ritov VB, Menshikova EV, He J, Ferrell RE, Goodpaster BH, Kelley
DE. Deficiency of subsarcolemmal mitochondria in obesity and type 2
diabetes. Diabetes 54: 8 –14, 2005.
26. Sakamoto K, McCarthy A, Smith D, Green KA, Grahame Hardie D,
Ashworth A, Alessi DR. Deficiency of LKB1 in skeletal muscle prevents
AMPK activation and glucose uptake during contraction. EMBO J 24:
1810 –1820, 2006.
26a.Scarpulla RC. Nuclear control of respiratory gene expression in mam-
malian cells. J Cell Biochem 97: 673– 683, 2006.
27. Sriwijitkamol A, Coletta DK, Wajcberg E, Balbontin GB, Reyna SM,
Barrientes J, Eagan PA, Jenkinson CP, Cersosimo E, DeFronzo RA,
Sakamoto K, Musi N. Effect of acute exercise on AMPK signaling in
skeletal muscle of subjects with type 2 diabetes: a time-course and
dose-response study. Diabetes 56: 836– 848, 2007.
28. Sriwijitkamol A, Ivy JL, Christ-Roberts C, DeFronzo RA, Mandarino
LJ, Musi N. LKB1-AMPK signaling in muscle from obese insulin-
resistant Zucker rats and effects of training. Am J Physiol Endocrinol
Metab 290: E925–E932, 2006.
29. Terada S, Goto M, Kato M, Kawanaka K, Shimokawa T, Tabata I.
Effects of low-intensity prolonged exercise on PGC-1 mRNA expression
in rat epitrochlearis muscle. Biochem Biophys Res Commun 296: 350 –
354, 2002.
30. Winder WW, Hardie DG. Inactivation of acetyl-CoA carboxylase and
activation of AMP-activated protein kinase in muscle during exercise.
Am J Physiol Endocrinol Metab 270: E299 –E304, 1996.
31. Wojtaszewski JFP, Nielsen P, Hansen BF, Richter EA, Kiens B.
Isoform-specific and exercise intensity-dependent activation of 5⬘-AMP-
activated protein kinase in human skeletal muscle. J Physiol 528: 221–
226, 2000.
32. Wu ZPP, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A,
Cinti S, Lowell B, Scarpulla RC, Spiegelman BM. Mechanisms con-
trolling mitochondrial biogenesis and respiration through the thermogenic
coactivator PGC-1. Cell 98: 115–124, 1999.
E614 EXERCISE RESISTANCE IN INSULIN-RESISTANT MUSCLE
AJP-Endocrinol Metab •VOL 294 •MARCH 2008 •www.ajpendo.org
