TRIM E3 Ligases Interfere with Early and Late Stages of the Retroviral Life Cycle

Abstract

Author Summary

A lot of excitement in the field of innate immunity to retroviruses such as HIV has come from the discovery of TRIM5 as a key player in cross species restriction. TRIM5 belongs to a family of E3 ligases with over 70 members, a number of which have exhibited antiviral activity. These findings have led to the hypothesis that several TRIM proteins may contribute to the innate immunity to retroviruses. In this manuscript, we systematically test the antiviral activities of 55 human and mouse TRIM proteins. The results are astonishingly complex with activities affecting both early and late stages of the retroviral life cycle. Importantly, a number of TRIM proteins that affect HIV or MLV replication upon overexpression, enhance virus entry or release when downregulated by gene silencing. These experiments suggest that additional TRIM proteins contribute to the endogenous restriction of retroviruses. Future work should focus on the identification of TRIM proteins that are upregulated specifically in response to interferons as well as the mechanisms by which the identified proteins interfere with retroviral replication.

Full text

TRIM E3 Ligases Interfere
with Early and Late Stages
of the Retroviral Life Cycle
Pradeep D. Uchil
[
, Brian D. Quinlan
[
, Wai-Tsing Chan, Joseph M. Luna, Walther Mothes
*
Section of Microbial Pathogenesis, Yale University School of Medicine, New Haven, Connecticut, United States of America
Members of the TRIpartite interaction Motif (TRIM) family of E3 ligases have been shown to exhibit antiviral activities.
Here we report a near comprehensive screen for antiretroviral activities of 55 TRIM proteins (36 human, 19 mouse). We
identified ;20 TRIM proteins that, when transiently expressed in HEK293 cells, affect the entry or release of human
immunodeficiency virus 1 (HIV), murine leukemia virus (MLV), or avian leukosis virus (ALV). While TRIM11 and 31
inhibited HIV entry, TRIM11 enhanced N-MLV entry by interfering with Ref1 restriction. Strikingly, many TRIM proteins
affected late stages of the viral life cycle. Gene silencing of endogenously expressed TRIM 25, 31, and 62 inhibited viral
release indicating that they play an important role at late stages of the viral life cycle. In contrast, downregulation of
TRIM11 and 15 enhanced virus release suggesting that these proteins contribute to the endogenous restriction of
retroviruses in cells.
Citation: Uchil PD, Quinlan BD, Chan WT, Luna JM, Mothes W (2008) TRIM E3 ligases interfere with early and late stages of the retroviral life cycle. PLoS Pathog 4(2): e16.
doi:10.1371/journal.ppat.0040016
Introduction
Host cells express specific proteins to interfere with the
replication of retroviruses. These proteins are referred to as
restriction factors and are considered to be a part of an
innate or intrinsic immune system [1–5]. The interferon
inducible cytidine deaminase APOBEC3G is packaged into
retroviruses and exerts its antiviral effect during reverse
transcription. TRIM5 and murine Fv1 belong to a class of
restriction factors that interfere with virus replication before
and after reverse transcription, respectively. The Fv1 gene
encodes an endogenous retroviral Gag found in the mouse
genome and has two main alleles [6]. Fv1
n
, found in NIH Swiss
mice, restricts infection by B-tropic MLV (B-MLV) but not N-
tropic MLV (N-MLV). In contrast, Fv1
b
, found in BALB/c
mice, restricts N-MLV and not B-MLV [7]. NB-tropic MLV
replicates in both mouse strains. The residues critical for the
N-B tropism of MLV map to the retroviral capsid protein.
TRIM5 was identified as a protein responsible for the species-
specific restriction of HIV entry [8,9]. Moreover, TRIM5 also
mediates the Ref1 restriction of specific mouse retroviruses
such as N-MLV in mammalian cells [10–12]. TRIM5 binds to
incoming retroviral capsids via its C-terminal B30.2 or the
SPRY (SPla/RYanodine receptor) domain causing premature
capsid disassembly [13–15].
TRIM5 belongs to the large family of TRIM/RBCC proteins
with over 70 members. TRIM proteins display elements of a
conserved modular tripartite motif structure consisting of an
N-terminal E3 ubiquitin ligase RING (Really Interesting New
Gene) domain followed by one or two zinc binding motifs
named B-box and a predicted coiled coil (CC) region (see
Table 1). The C-terminus is highly variable and contains
specific domains such as the B30.2/PRY-SPRY domain (Table
1). The presence of a RING domain suggests that these
proteins function as E3 ubiquitin ligases. The associated B-
box and coiled coil are believed to participate in protein-
protein interactions and formation of macromolecular
complexes [16,17].
TRIM proteins localize to various regions within the cells
and many define specific nuclear (TRIM19/PML) [18] or
cytoplasmic compartments (TRIM5) [8,19]. Others such as
TRIM1, 9 and 18 have been shown to associate with
microtubules [20–23]. Proposed physiological roles for TRIM
proteins include fundamental cellular processes such as
apoptosis, transcription, differentiation, and regulation of
cell cycle progression [17]. Moreover, mutations in several
TRIM proteins have been linked to human disease [17].
A number of TRIM proteins besides TRIM5 and its close
relatives have been shown to possess antiviral activities
[2,3,17,24]. For example, TRIM1 has been shown to restrict
N-MLV [12]. Broad antiviral activities have been described for
TRIM19, the defining component of PML bodies in the
nucleus. The list of viruses inhibited by TRIM19 includes
vesicular stomatitis virus, influenza A virus, human cytome-
galovirus, herpes simplex type 1, Ebola virus, Lassa fever
virus, lymphocytic choriomeningitis virus, human foamy virus
and HIV [2,18]. TRIM28 restricts MLV in cells of germline
origin by inhibiting LTR-driven transcription [24]. TRIM22
and TRIM32 were reported to attenuate transcription of the
HIV LTR [25,26]. The identification of TRIM25 as a K63
Editor: Jeremy Luban, Institute for Research in Biomedicine, Switzerland
Received July 6, 2007; Accepted December 17, 2007; Published February 1, 2008
Copyright: Ó2008 Uchil et al. This is an open-access article distributed under the
terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author
and source are credited.
Abbreviations: ALV, avian leukemia virus; GFP, green fluorescent protein; HIV,
human immunodeficiency virus; MLV, murine leukemia virus; TRIM, TRIpartite
interaction Motif
* To whom correspondence should be addressed. E-mail: walther.mothes@yale.edu
[These authors contributed equally to this work.
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160001

specific ubiquitin E3 ligase activating RIG-I presents direct
evidence that TRIM proteins regulate innate immunity to
viral infection [27]. The recognition and suppression of
Sendai virus, New Castle disease virus and vesicular stomatis
virus (VSV) replication by RIG-I depends on functional
TRIM25 [27]. Thus, the association of several family members
with antiviral activities coupled with the fact that many of
them are induced by interferons [2] has led to the hypothesis
that members of TRIM family proteins are a part of innate
immune system to counter intracellular pathogens [2,17,28].
To systematically test antiretroviral activities of TRIM
proteins, we investigated the ability of 55 TRIM proteins (36
human, 19 mouse) to interfere with early and/or late stages of
the retroviral life cycle.
Results
TRIM Proteins Inhibiting or Enhancing Retroviral Entry
We screened for potential antiviral activities of 36 human
and 19 mouse TRIM proteins (Table 1) by transient
expression in HEK293 cells. These cells are highly permissive
for most retroviruses and are easily transfectable. We first
performed control experiments to verify that the transfection
of 50 ng plasmids encoding TRIM proteins in a 24-well format
minimally induced apoptosis and had little effect on cell
viability or gene expression (Figure S1A–S1C). In the case of
human and mouse TRIM11, transfected DNA levels were
reduced to 10 ng (Figure S1C).
We then analysed the ability of the TRIM proteins to
interfere with viral entry defined here as all early events in
the retroviral life cycle leading up to the establishment of
viral gene expression (Figure 1A). To identify activities
directed specifically against incoming retroviral capsids, all
viruses carried the same subgroup A envelope glycoprotein of
ALV (ALV-A) and target cells expressed the cognate receptor
Tva950 [29]. To guarantee a ;90% probability of Tva950 co-
expression with each TRIM protein, plasmids encoding for
both proteins were co-transfected 36 h prior to initiating
infection. Infection levels were determined by measuring the
expression of cytoplamic GFP from integrated viral genomes.
To perform an entry screen for HIV, reporter viruses were
generated in HEK293 cells by transfecting HXB2DEnv-GFP, an
HXB2 derivative lacking envelope and encoding GFP instead
of the nef gene, together with a plasmid encoding ALV-A Env.
Culture supernatants were harvested 48 h later and tested for
their ability to infect HEK293 cells expressing Tva950 in the
presence or absence of individual TRIM protein. To evaluate
the significance of the observed inhibitory and enhancing
effects standard statistical analysis was employed to arrive at a
cut-off of 2.5 (by adding the maximum variability between
control samples and two times the standard deviations). HIV
entry was potently blocked by rhesus TRIM5 (38-fold) and to a
lesser extent by human TRIM5 (5-fold) confirming previous
results [8,10–12] (Figure 1B). Interestingly, no other TRIM
protein affected HIV entry as potently as rhesus TRIM5.
Mouse TRIM8 inhibited HIV entry about 6-fold. Moderate
inhibitory effects were observed for human TRIM11, 26, 31
and mouse 10, 11 and 56. Expression of human TRIM38 and
mouse TRIM21 enhanced HIV entry.
To perform a similar experiment for N-tropic MLV (N-
MLV), reporter viruses were generated in HEK293 cells by
transfecting plasmids encoding for N-tropic MLV GagPol,
MLV LTR-GFP and ALV-A Env. Viruses were harvested as
above and the susceptibility of HEK293 cells expressing Tva
receptor and individual TRIM proteins to N-MLV was tested.
N-MLV was strongly inhibited by TRIM1 (15-fold) and TRIM5
(18-fold) (Figure 1C). A number of additional TRIM proteins
moderately affected N-MLV entry (human TRIM25, 26 and
62; mouse TRIM8, 25, 31 and 56). Interestingly, human and
mouse TRIM11 as well as mouse TRIM30 enhanced N-MLV
entry (4.5-, 3- and 4.5-fold, respectively).
The inhibitory pattern observed for N-MLV was largely
distinct from HIV (Figure 1B and 1C). Notable exceptions
included human TRIM26, mouse TRIM8 and 56 that affected
both HIV and MLV. Opposite effects were observed for the
TRIM11 proteins. While they inhibited HIV entry, enhancing
effects were observed for MLV. TRIM proteins specifically
affecting N-MLV were human and mouse TRIM25, human
TRIM62, mouse TRIM31 and mouse TRIM30. In contrast,
human TRIM proteins 31, 38 and the mouse proteins 10 and
21 specifically affected HIV entry. A scatter plot depicting
fold inhibition in infectivity for HIV versus N-MLV summa-
rizes these results (Figure 1F).
The interference of TRIM 1 and 5 with MLV entry is
specific for capsid determinants of N-MLV but not of B-MLV
[10–12]. To test which TRIM proteins are specific for N-MLV,
we performed an identical entry experiment for B-MLV. As
previously reported, human TRIM1 and TRIM5 exhibited no
effect on B-MLV entry (Figure 1D). In contrast, the remaining
TRIM proteins exhibited an inhibitory profile that resembled
that observed for N-MLV (compare Figure 1D to 1C).
Interestingly, the enhancing properties of TRIM11 (human
and mouse) and mouse TRIM30 proteins were specific for N-
MLV and not observed for B-MLV. The ratio of fold
inhibition for N versus B-MLV as well as the scatter plot
analysis illustrate this finding (Figure 1E and 1G). Thus, the
inhibitory effects of TRIM1 and 5 as well as the enhancing
effects of TRIM11 (human and mouse) and TRIM30 (mouse)
strongly correlate with N-tropism.
To validate critical results gained in our transient
expression screen, we downregulated endogenously ex-
pressed human TRIM proteins 11, 25, 31 and 62 in HeLa
cells using RNA interference (RNAi) (Figure 1H). Consistent
with the inhibitory effects of TRIM 11 and 31 on HIV entry,
downregulation of both proteins using siRNA facilitated HIV
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160002
Anti-Retroviral TRIM Proteins
Author Summary
A lot of excitement in the field of innate immunity to retroviruses
such as HIV has come from the discovery of TRIM5 as a key player in
cross species restriction. TRIM5 belongs to a family of E3 ligases with
over 70 members, a number of which have exhibited antiviral
activity. These findings have led to the hypothesis that several TRIM
proteins may contribute to the innate immunity to retroviruses. In
this manuscript, we systematically test the antiviral activities of 55
human and mouse TRIM proteins. The results are astonishingly
complex with activities affecting both early and late stages of the
retroviral life cycle. Importantly, a number of TRIM proteins that
affect HIV or MLV replication upon overexpression, enhance virus
entry or release when downregulated by gene silencing. These
experiments suggest that additional TRIM proteins contribute to the
endogenous restriction of retroviruses. Future work should focus on
the identification of TRIM proteins that are upregulated specifically
in response to interferons as well as the mechanisms by which the
identified proteins interfere with retroviral replication.

entry (2–3-fold). While modest, these enhancements in viral
entry suggest that TRIM11 and 31 contribute to the
restriction of HIV in HeLa cells. Likewise, the enhancing
effect of TRIM11 expression on N-MLV entry led to a
corresponding inhibition following gene downregulation of
the endogenous protein (3-fold). In contrast, TRIM25 and 62
exhibited inhibitory effects against MLV viruses when over-
expressed or silenced using RNAi. Thus, the transient
Table 1. TRIM Proteins Included in the Study
TRIM Reference Sequence Accession Number Source Structure
Hs1 NM_052817 BC017707 OB:MHS1010–58431 R BB BB CC FN3 SPRY CC
Hs2 NM_015271 BC011052 OB:MHS1010–7429489 R BB CC IG_FLMN (NHL)4
Hs3 NM_033278 AF045239 [16]
a
R BB CC IG_FLMN
Hs4 NM_033091 AF220024 [16]
a
R BB CC PRY SPRY
Hs5 NM_033034 BC021258 [8] R BB CC SPRY
Hs6 NM_058166 BC065575 [16]
a
R BB PRY SPRY
Hs8 NM_030912 BC021925 [16]
a
R BB BB CC NRD
Hs9 NM_015163 AF220037 [16]
a
BB BB CC FN3 SPRY
Hs11 NM_145214 BC069227 OB:MHS1011–98054040
b
R BB PRY SPRY
Hs13 NM_005798 BI905976 OB:EHS1001–7517987 R BB NRD TM NRD
Hs14 NM_014788 AF220130 [16]
a
BB PRY SPRY
Hs15 NM_033229 BC038585 OB:MHS1010–7508596 R BB CC PRY SPRY
Hs18 NM_033291 BC053626 OB: MHS1010–9205608 R BB CC FN3 PRY
Hs19 NM_033249 AF230411 [16]
a
(PML3) R BB CDK5
Hs20 NM_000243 AF018080 [16]
a
PYR BB PRY SPRY
Hs21 NM_003141 BC010861 OB:MHS1010–73808 R BB PRY SPRY
Hs23 NM_006074 BC035582 [16]
a
R BB BB CC ARF
Hs25 NM_005082 BC016924 OB:MHS1010–58392 R CC PRY SPRY
Hs26 NM_003449 BC032297 OB:MHS1010–7507981 R BB PRY SPRY
Hs27 NM_009054 BC013580 OB:MHS1010–73801 R BB PRY SPRY
Hs28 NM_005762 BC052986 OB:MHS1010–9205415 BB BB CC PHD BROMO
Hs29 NM_012101 AF230388 [16]
a
NRD BB CC NRD
Hs31 NM_007028 BC017017 OB:MHS1010–74233 R BB CC NRD
Hs32 NM_012210 BC003154 [16]
a
R BB CC NHL WD40
Hs35 NM_015066 BC018337 OB:MHS1010–73500 R BB CC PRY SPRY
Hs38 NM_006355 BC026930 OB:MHS1010–7429568 R BB PRY SPRY
Hs39 NM_021253 BC034985 OB:MHS1010–7295937
b
R BB PRY SPRY
Hs40 NM_138700.2 BC060785 OB:MHS1010–9204128
b
R BB CC NRD
Hs41 NM_033549 BC018765 OB:MHS1011–76931
b
R BB PRY SPRY
Hs43 NM_138800 BC015353 OB:MHS1010–74174 R BB CC SPRY
Hs44 NM_017583 BC013166 OB:MHS1010–58247 NRD BB CC
Hs45 NM_025188 BC034943 OB:MHS1010–7295468
b
R BB CC IG_FLMN
Hs46 NM_025058 BC069416 OB:MHS1768–9143936
b
RCC
Hs47 NM_033452 BC017304 OB:MHS1011–76759
b
R BB BB PRY SPRY
Hs51 NM_032681 BC005014 OB:MHS1011–60710
b
HisZ SPRY
Hs62 NM_018207 BC012152 OB:MHS1011–75791
b
R BB CC PRY SPRY
Mm8 NM_053100 BC037065 OB:EMM1002–7378958 R CC NRD
Mm10 NM_011280 BC051632 [16]
a
R BB PRY SPRY
Mm11 NM_053168 BC020102 [16]
a
R BB PRY SPRY
Mm12 NM_023835 BC094899 [16]
a
R BB NRD
Mm15 NM_001024134 BC027186 OB:MMM1013–7511478 R BB CC
Mm16 NM_53169 BC052821 OB:MMM1013–9201878 BB PRY SPRY
Mm19 NM_178087 BC020990 OB:MMM1013–64912 (PML2) R BB BB CC
Mm21 NM_009277 BC010580 OB:MMM1013–64534 R BB PRY SPRY
Mm24 NM_145076 BC056959 [16]
a
BB CC PHD BROMO
Mm25 NM_009546 BC006908 OB:MMM1013–63678 R NRD PRY SPRY
Mm27 NM_009054 BC003219 OB:MMM1013–62960 R BB PRY SPRY
Mm30 NM_009099 BC005447 OB:MMM1013–63956 R BB SPRY
Mm31 NM_146077 BC026666 OB:MMM1013–7513301 R BB PRY SPRY
Mm37 NM_197987 BC022117 OB:EMM1002–21509 R BB CC MATH
Mm39 NM_024468 BC031540 OB:MMM1013–7510521 R BB CC PRY SPRY
Mm41 NM_145377.2 BC020156 OB:MMM1013–65964 PRY SPRY
Mm44 NM_020267 BC039979 OB:MMM1013–7514310 NRD BB NRD
Mm56 NM_201373 BC045615 OB:MMM1013–9199937 R BB CC
Mm59 NM_025863 BC025430 OB:MMM1013–7511597 R BB TM
Rh5 NM_001032910 AY523632 [8] R BB CC SPRY
a
pcDNA3 Nterminal HA tag.
b
Cloned into pCMVSPORT6.
Key for the used TRIM proteins: OB, Open Biosystems; Hs, Homo sapiens; Mm, Mus Musculus; Rh, Macaca mulatta; R, Really interesting new gene domain; BB, Bbox; BBC, Coiled Coil domain
associated with BBox; PRY/SPRY, SPla/RYanodine domain; BROMO, Bromodomain; CC, Predicted Coiled Coil domain; CDK5, Cyclin-dependent kinase 5; FN3, Fibronectin III like domain;
HisZ, Histidine zinc finger domain; IG_FLMN, Filamin-type immunoglobulin domain; MATH, Meprin and TRAF homology domain; NHL, NHL repeat; PHD, Plant homeodomain; TM,
Transmembrane domain, NRD, no recognizable domain.
doi:10.1371/journal.ppat.0040016.t001
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160003
Anti-Retroviral TRIM Proteins

PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160004
Anti-Retroviral TRIM Proteins

expression screen for TRIM proteins identified human
TRIM11 and TRIM31 as factors modulating retroviral entry.
A Role for TRIM 11 in the Reduction of TRIM 5 Protein
Levels
The specific enhancement of N-MLV, but not B-MLV entry
upon expression of TRIM11 proteins as well as mouse
TRIM30 was unanticipated (Figure 1C–1E). These enhancing
properties of TRIM11 were observed over a wide range of
expression levels (Figure 2A). Silencing of endogenous
TRIM11 by siRNA in HeLa or HEK293 cells led to an increase
in restriction of N-MLV, but not B or NB-MLV (Figure 1H
and data not shown). Together, these data suggest that
TRIM11 regulates the Ref1 restriction in human cells.
HEK293 cells endogenously express low levels of human
TRIM5 that restricts N-MLV entry [10–12].
To test if the effects of TRIM11 and TRIM30 on N-MLV
entry are due to interference with the Ref1 restriction, we
silenced TRIM5 in HEK293 cells by RNAi. Indeed, the
enhancing effects of TRIM11 and TRIM30 on N-MLV entry
were dependent on the presence of TRIM5 and lost in
response to TRIM5 silencing (Figure 2B).
Potentially, these proteins affect TRIM5 protein levels. To
test this hypothesis for TRIM11, a plasmid encoding HA or
GFP-tagged TRIM5 was co-transfected together with either
empty vector or increasing amounts of a plasmid encoding
mouse and or human TRIM11. TRIM5 protein levels were
then examined by western blot and fluorescence microscopy
(Figure 2C and 2D). Strikingly, expression of low amounts of
TRIM11 led to the disappearance of TRIM5, an effect that
could be delayed by treating cells with the proteasome
inhibitor MG132 (Figure 2C and 2D). The reduction of
TRIM5 levels as determined by western blotting corre-
sponded with a loss of cytoplasmic bodies (Figure 2D, lower
panel). The protein levels of another TRIM protein, human
TRIM15, were largely unaffected by the expression of human
TRIM11 (Figure 2D). Because both proteins are expressed
from the same promoter, the observed reduction in TRIM5
levels is likely not explained by effects of TRIM11 on
transcription. Deleting the RING domain of TRIM11 did
not affect TRIM5 protein levels, indicating a functional
dependence on E3 ligase activity (Figure 2D). Correspond-
ingly, entry of N-MLV in HeLa cells was enhanced 16-fold by
the expression of wild-type TRIM11, whereas TRIM11 lacking
the RING domain exhibited reduced activity (Figure 2E).
Together these results suggest that TRIM11 regulates the
turnover of TRIM5 thereby regulating the level of Ref1
restriction in mammalian cells. The observed co-localization
of TRIM11 and TRIM5 proteins to cytoplasmic bodies is
consistent with such a model (Figure 2F).
In contrast to TRIM11 proteins, expression of mouse
TRIM30 did not affect the protein levels of TRIM5 (Figure
2D). How mouse TRIM30 interferes with the Ref1 restriction
remains to be determined. Interestingly, TRIM30 is the
closest homologue of human TRIM5 in the mouse genome,
but carries a deletion in the variable region 1 within the B30.2
domain that is critical for interaction with capsid (Figure
S1D) [30–32]. Mouse TRIM30 may function as a dominant-
negative protein not unlike TRIM5 proteins lacking the B30.2
domain [8,31].
Antiviral Activities of TRIM Proteins Affecting Late Stages
of Retroviral Replication
After studying the role of TRIM proteins during early
events in viral replication, we next investigated if they
exhibited antiviral effects at late stages of viral replication
(Figure 3A). To determine effects specific for HIV release, we
bypassed entry by directly transfecting plasmids that encoded
for TRIM proteins along with a HIV variant HXB2DEnv-GFP
lacking Env and expressing cytoplasmic GFP. Infectious
virions were generated by co-expression of VSVG. After 48
h, the culture supernatants were harvested and the level of
GFP expression in producer cells was determined by flow
cytometry. The viral infectivity in the harvested culture
supernatant was determined by infecting susceptible target
cells and measuring GFP-positive cells after an additional 36
h. In addition, the Gag protein released into the supernatant
was determined by western blot using antibodies to the HIV
capsid protein p24. The results of such an experiment for
HIV release is shown in Figure 3B in fold inhibition. HIV
capsid released into the supernatant is presented in Figure
S2A. Our analysis identified the human TRIM proteins 15, 26,
32, the mouse proteins 11, 25, 27, and 56 as factors that
specifically affected HIV release from cells, but not viral gene
expression (Figure 3B). A number of TRIM proteins (human
TRIM19, 21, 25 and mouse TRIM8) were close to the
statistically determined cut-off value of 6. At the transfection
level (50ng) used in the assembly assay, human TRIM11
affected both viral gene expression and virus release. A
scatter plot analysis depicting the effects of TRIM protein
expression on virus release over effects on LTR expression
summarizes these results (Figure 3D).
We then performed an identical experiment for NB-tropic
MLV (Figure 3C) using a plasmid encoding for the Friend57
MLV genome carrying a GFP insertion into the Env protein
[33,34]. MLV capsid (p30) released into the supernatant is
presented below the graph (Figure 3C). Our analysis revealed
a striking sensitivity of MLV to the expression of TRIM
proteins, in particular human TRIM proteins. Overall, 21
TRIM proteins and rhesus TRIM5 inhibited MLV release at
least 10-fold, 9 of which inhibited MLV release by more than
100-fold (Figure 3C). A dose-response experiment revealed
that transfecting small amounts of plasmids encoding for
human TRIM15, 25, 31, 62 and mouse 11 and 25 resulted in
Figure 1. TRIM Proteins Inhibiting or Enhancing Retroviral Entry
(A) Experimental design: HIV, N, and B-MLV viruses carried an ALV-A envelope and the target HEK293 cells expressed cognate receptor Tva950 and TRIM
proteins. Effects on entry were measured at the level of gene expression using GFP as reporter.
(B–D) Effects of TRIM protein expression on the entry of HIV (B), N-MLV (C), and B-MLV (D) shown as fold inhibition using a log2 scale with standard
errors. The dotted line represents the statistically determined cut-off value.
(E) Ratio of fold inhibition in N- and B-tropic MLV entry.
(F, G) Scatter plot comparing the effects on entry for one virus against another as indicated.
(H) Effect of silencing endogenous TRIM proteins 11, 25, 31, and 62 in HeLa cells using specific or control siRNA on HIV, NB- and N-MLV entry. The ratio
of fold increase in entry of N versus NB-MLV is shown to the right.
doi:10.1371/journal.ppat.0040016.g001
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160005
Anti-Retroviral TRIM Proteins

potent antiviral activity (Figure S2B). In contrast, higher DNA
amounts were required for the other TRIM proteins,
particularly TRIM5. TRIM22, while removed from the screen
due to varying results, did exhibit antiviral activity in a dose-
dependent manner.
Generally, we observed two distinct phenotypic groups for
MLV restriction. The first group, including the TRIM
proteins 8, 15, 19, 25, 26, 28 and 35 specifically interfered
with the release of infectious MLV into the culture super-
natant without major effects on viral gene expression (Figure
3C). For the second group, consisting of human TRIM
proteins 1, 11, 13, 14, 21, 27, 31, 32, 62, the mouse proteins
8, 11, 27 and rhesus 5, the inhibitory effects on viral gene
expression were close to the cut-off of 6 or higher implying
that a suppression of viral gene expression contributed to the
observed reduction in the release of infectivity. A scatter plot
depicting effects of TRIM proteins on infectivity versus gene
expression summarizes these results (Figure 3E).
Figure 2. TRIM11 Reduces the Protein Levels of TRIM5
(A) Effects of increasing amounts of transfected plasmid encoding human TRIM11 on entry of B-MLV and increasing amounts of N-MLV.
(B) The effects of transient expression of TRIM11 (10 ng DNA transfected), TRIM30 (50 ng DNA transfected), and empty vector (Vector) on N-MLV entry
were tested in HEK293 cells treated with either control (control si) or TRIM5 specific siRNA (H5 si).
(C) Western blot (anti-HA serum) of HEK293 cells 48 h after transfection with plasmids encoding HA-tagged TRIM5 and either increasing amounts (ng
DNA) of empty vector (pcDNA) or a plasmid expressing mouse TRIM11 (M11). Cells were treated with the proteasome inhibitor MG132 (10 lM) for 6 h
prior to analysis as indicated.
(D) An experiment as in (C) for cells expressing HA-tagged TRIM5 or TRIM15-YFP together with human TRIM11 (H11), its mutant lacking the RING
domain (DRING) and mouse TRIM30 (M30). The lower panel shows the parallel TRIM5 GFP-levels in cells.
(E) Fold increase in N-MLV entry in the HeLa cells expressing either control plasmid, wild-type human TRIM11, or its RING domain mutant (DRING).
(F) TRIM11-YFP (5 ng, red) and TRIM5-CFP (50 ng, green) were transfected into HEK293 and the localization of both proteins monitored by confocal
microscopy 24 h post-transfection.
doi:10.1371/journal.ppat.0040016.g002
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160006
Anti-Retroviral TRIM Proteins

PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160007
Anti-Retroviral TRIM Proteins

For a number of TRIM proteins, the reduction in infectivity
did not correspond with a proportionate reduction in p30
release. Western blot analysis of released virus for Env and Gag
revealed that human TRIM13, 21 and mouse TRIM19 prefer-
entially affected Env incorporation (Figure S2C). A reported
role for TRIM13 in protein degradation at the endoplasmic
reticulum is consistent with such a phenotype [35].
Finally, to measure ALV release, we studied the effects of
TRIM expression in chicken fibroblasts because the release of
this virus is restricted in mammalian cells [36]. Among the few
potent antiviral proteins were human and mouse TRIM25,
human 32 and mouse TRIM11 (Figure S2D). Human TRIM11
was not tested for ALV.
Gene Silencing of Human TRIM Proteins 25, 31, and 62
Affects HIV and MLV Release
The inhibitory effects observed above could be the result of
overexpression of these proteins in HEK293 cells. To
determine their role in the viral life cycle, we targeted
endogenously expressed TRIM proteins for downregulation
using RNAi. We concentrated on TRIM 11, 15, 25, 31 and 62
because they were very effective at low transfection levels and
were endogenously expressed in HEK293 and HeLa cells
(Figure S3A and S3B). Downregulation of TRIM proteins 25,
31 and 62 inhibited HIV and MLV release in HEK293 cells,
suggesting that these proteins play a role in efficient virus
release (Figure 4A and 4B). Notably, silencing of TRIM62 also
strongly interfered (7-fold) with HIV release in HeLa cells
(Figure 4B). Correspondingly, expression of low amounts of
TRIM62 enhanced HIV gene expression and release (Figure
4C).
To gain further insights into the antiviral activities of these
proteins we tested mutant proteins impaired in their E3
ligase activity. Interestingly, the E3 mutant of TRIM62
inhibited HIV and MLV release more potently than the
wild-type protein, likely by exhibiting a pronounced domi-
nant-negative effect (Figure 4C and 4D). Together, these data
Figure 4. Inhibitory and Enhancing Roles of Individual TRIM Proteins on Viral Release
(A, B) Fold increase in HIV and MLV infectivity released from HEK293 (A) and HeLa (B) cells treated with control siRNA (contsi) or siRNA targeting
endogenously expressed human TRIM proteins 11, 15, 25, 31, and 62.
(C) Fold increase in HIV gene expression and released infectivity in HEK293 cells transfected with increasing amounts of plasmid (0–100 ng) expressing
TRIM62 or its E3 mutant (62E3m).
(D) Infectivity of MLV releasedfrom HEK293 cells is shown as fold inhibition in presenceof plasmids expressingTRIM11, 15, 25, 62, or their E3 mutants (E3m).
doi:10.1371/journal.ppat.0040016.g004
Figure 3. TRIM Proteins Interfering with Virus Production and Release
(A) Experimental design: HEK293 cells transfected with viral plasmids encoding full-length HIV or MLV and carrying a GFP-reporter gene in the presence
or absence of plasmids encoding individual TRIM proteins. 48 h after transfection, producer cells and culture supernatants were harvested. Producer
cells were subjected to FACS analysis to measure viral gene expression. The infectivity of culture supernatants was determined by infecting target cells
and measuring GFP-positive cells 36 h after initiation of infection using FACS analysis.
(B, C) Effects of TRIM protein expression in HEK293 cells on the production and release of HIV (B) and MLV (C). Graphs represent the fold inhibition
(log10 scale) in released viral infectivity (grey bars) and in viral gene expression (black bars). All experiments were performed at least in triplicates and
the bars represent standard errors from the mean values. The dotted line represents the statistically determined cut-off value of 6. MLV Gag released
into culture supernatant was analysed by western blot using antibodies against p30 MLV capsid and presented beneath the graph in (C). Partition lines
indicate individual gels.
(D, E) Scatter plots of data shown in panels (B) and (C) depicting fold inhibitions in released virus infectivity plotted against viral gene expression from
the LTR upon TRIM expression for HIV (D) and MLV (E).
doi:10.1371/journal.ppat.0040016.g003
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160008
Anti-Retroviral TRIM Proteins

suggest that TRIM 25, 31 and 62 play an important role in
virus release.
TRIM11 and 15 Contribute to the Innate Restriction of
Retroviruses in Human Cells
In contrast to TRIM25, 31 and 62, downregulation of
endogenous TRIM11 enhanced HIV release ;4-fold in
HEK293 and moderately (23fold) in HeLa cells (Figure 4A
and 4B). MLV release was enhanced 5-fold in response to
silencing of TRIM15 in HeLa cells (Figure 4B). The enhance-
ment of virus release observed in response to gene silencing is
consistent with the hypothesis that both TRIM proteins
contribute to the endogenous restriction of HIV and MLV in
mammalian cells.
We next tested the contribution of E3 ligase function to the
antiviral activity of both proteins. Interestingly, the antiviral
activity of TRIM11 was critically dependent on a functional
E3 ligase domain (Figure 4D) implying the involvement of the
ubiquitin-dependent degradative pathway. In contrast, the E3
mutant of TRIM15 largely retained its inhibitory activity
indicating that it interferes with viral replication via a
different mechanism (Figure 4D).
The Antiviral Activity of TRIM15 Depends on the Ability of
its B-box to Interact with the MLV Gag Precursor Protein
To understand how TRIM15 can interfere with viral release
in an E3 ligase independent manner, we performed a domain
analysis for human TRIM15. TRIM15 YFP fusion protein was
as active as its untagged version. Hence this analysis was
performed using YFP fusion proteins (Figure 5A). Interest-
ingly, TRIM15 lacking the B-box, but not RING or SPRY
domains, lost all of its antiviral activity (Figure 5A). In fact,
the B-box alone exhibited antiviral activity.
TRIM5 specifically interferes with retroviral entry by
Figure 5. The Antiviral Activity of TRIM15 Resides in Its B-box
(A) Fold inhibition in MLV released infectivity in presence of indicated TRIM15-YFP derivatives. The vectors pcDNA or pEYFP were used as controls. Top
schematic displays the TRIM15 domain structure.
(B) Western blot using GFP antibodies to detect MLV Gag-GFP that co-immunoprecipitated with antibodies against TRIM15.
(C) Western blot using antibodies to GFP to identify TRIM15-YFP derivatives that co-immunoprecipitated with MLV Gag.
(D) MLV Gag-CFP (green), full length MLV and TRIM15-YFP (red) were transfected into HEK293 cells and monitored 24 h later. Green arrows indicate the
accumulation of Gag at the plasma membrane. Red arrows point to cytoplasmic TRIM15 bodies.
(E) An experiment as described in (D) was performed for HIV Gag-YFP (red) and TRIM15-CFP (green).
doi:10.1371/journal.ppat.0040016.g005
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160009
Anti-Retroviral TRIM Proteins

binding to incoming mature capsids [13–15] and it had
recently been suggested that rhesus TRIM5 can also bind and
degrade immature capsids interfering with virus production
[37]. To test if TRIM15 can bind to the immature Gag
precursor protein of MLV, we performed co-immunopreci-
pitations. Interestingly, antibodies against TRIM15 specifically
co-immunoprecipitated MLV Gag and vice versa (Figure 5B
and 5C). Importantly, TRIM15 fragments containing the B-
box interacted with MLV Gag, while TRIM15 mutants lacking
the B-box did not. In fact, the B-box alone was capable of
interacting with the MLV Gag precursor protein. Thus,
TRIM15 interferes with MLV release by directly or indirectly
binding the MLV Gag precursor protein via its B-box.
To understand how TRIM15 binding to Gag alters the
cellular fate of retroviral capsids, we transfected plasmids
encoding for TRIM15-YFP together with MLV Gag-CFP and
replication competent MLV into HEK293. Visualization using
fluorescence microscopy revealed on average a reduction of
Gag fluorescence at the plasma membrane in cells containing
cytoplasmic TRIM15 bodies (Figure 5D). When TRIM15-CFP
was expressed together with HIVGag-YFP, a similar pheno-
type was observed. Less HIV Gag reached the plasma
membrane, but rather accumulated intracellularly (Figure 5E).
Figure 6. Anti-retroviral Activities of TRIM Proteins Identified in This Study
(A) A Java TREEVIEW graphic display of all TRIM proteins activities against early and late stages of the retroviral life cycle. Input fold inhibition values
were log2 transformed and shown as red/green color-coding for inhibitory and enhancing activities, respectively. Grey stands for experiments not
carried out.
(B–D) Scatter plot analyses were performed as indicated.
doi:10.1371/journal.ppat.0040016.g006
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160010
Anti-Retroviral TRIM Proteins

Discussion
Using a transient expression screen in HEK293 cells we
have performed the first near comprehensive screen for
antiviral activities of members of the TRIM family of
proteins. Our screen identifies ;20 TRIM proteins with
antiviral activity demonstrating that multiple TRIM proteins
can exhibit antiviral activities. Because many TRIM proteins
are upregulated in response to interferons [2], a potential
role of these proteins in the establishment of an antiviral
state should be investigated.
The specific effects of TRIM proteins on the replication
cycle of each retrovirus are summarized in Figure 6A using
red/green color-coding for inhibitory and enhancing activ-
ities, respectively. This presentation readily displays the
specificity of TRIM1, 5, 11 and 30 for N-MLV entry. This
analysis also allows a comparison of the entry results with the
viral gene expression data obtained in the screen for virus
release (Figure 6A–6C). For example, the inhibitory activities
of TRIM1 and 62 on N-MLV entry likely include effects on
viral gene expression (Figure 6A and 6C).
This analysis also reveals that an overexpression of human
and mouse TRIM11 proteins affects MLV gene expression
(Figure 6A and 6C). Despite these inhibitory effects, TRIM11
expression specifically enhanced N-MLV, but not B-MLV
entry. Under these conditions, the protein levels of tran-
siently expressed TRIM5 were reduced. TRIM11 may con-
tribute to the turnover of endogenous TRIM5, because
silencing of endogenous TRIM11 enhanced the Ref1 restric-
tion. These two observed activities of TRIM11, degradation of
cytoplasmic proteins as well as the regulation of tran-
scription, are similar to previous reports for a role of TRIM11
in the turnover of humanin and ARC105 [38,39]. Clearly,
several cellular targets exist for TRIM11. Its potential role in
the turn over of TRIM5, a protein that potently restricts
retrovirus entry, could be of therapeutic importance.
Strikingly, most of the antiviral TRIM proteins exhibited
strong inhibitory effects against late stages of the viral life
cycle (Figure 6A). MLV was highly sensitive to the expression
of TRIM proteins, particularly of human origin. Of the 14
TRIM proteins specifically interfering with MLV release, only
two were of mouse origin (Figure 6D). A similar cross species
effect was observed for HIV. 21% of all mouse, but only 11%
of all human TRIM proteins interfered with HIV release. Cross
species effects are consistent with the hypothesis that TRIM
proteins contribute to the innate control of retroviruses and
that over time, viruses can adapt to inhibitory effects.
In our further analysis we concentrated on TRIM proteins
that were highly effective even at very low transfection levels.
Gene silencing of TRIM 25, 31 and 62 inhibited virus release
suggesting that these E3 ligases play a role in cellular
pathways critical for virus release. They were identified in
our expression screen likely because overexpression of the
wild-type protein exhibited a dominant-negative effect.
In contrast, downregulation of TRIM11 and TRIM15
enhanced virus release suggesting that these proteins con-
tribute to the restriction of MLV and HIV even in highly
susceptible HEK293 and HeLa cells. A detailed understanding
of host restriction may lead to antiviral therapies aimed at
strengthening the innate immunity to retroviruses at the
cellular level. The interaction of TRIM15 with retroviral Gag
suggests that TRIM proteins, apart from entry, can recognize
retroviral Gag proteins during assembly and budding and
thereby inhibit viral release. A preferential targeting of late
stages of the retroviral life cycle may be more consistent with
a role for TRIM proteins in the establishment of an antiviral
state.
Materials and Methods
Cell lines and plasmids. HEK293, HeLa, DFJ8 and DF-1 were
described previously [40]. TZM-bl cells were a gift from Vineet
KewalRamani (NCI Frederick, MD). TRIM constructs presented in
Table 1 were confirmed by sequencing to be authentic and in the
correct reading frame. The reference for human TRIM22 is
NM_006074. YFP fusion proteins of human TRIM 11, 15, 25, 31
and 62 were generated by insertion of PCR amplified genes into the
EcoRI/XhoI sites of pEYFP-N1 (Clontech, Palo Alto, CA). E3 mutants
were created by substituting two active site cysteines to alanine using
site-directed mutagenesis (QuikChange, Stratagene, La Jolla, CA).
TRIM15-YFP mutants were generated by PCR; BCPS, CPS, RBC, R-
CPS-YFP fusions lacked the amino acids 1–64, 1–119, 346–465 and
81–119, respectively. The B-box-YFP corresponds to amino acids 64–
129.
Generation of viruses. N, B and NB-tropic MLV were prepared by
transfecting 4 lg of a plasmid encoding a viral RNA (pLZRS-GFP)
[40], 4 lg plasmid encoding the envelope glycoprotein of subgroup A
of ALV (EnvA) [41] and 4 lg of plasmids expressing either N-, B-
tropic (pCIG3-N or B, gifts from Greg Towers and Jonathan Stoye,
University College London, UK) [42] or NB GagPol (pMDGag-Pol)
[41] into a 10 cm plate of HEK293 cells using FuGene 6 (Roche,
Indianapolis, IN, USA) and serum-free OPTIMEM media (Invitrogen
Corporation, California). HIV-1 reporter viruses were generated by
transfecting 4 lg of HXB2Env

-GFP, a HXB2 derivative (lacking
envelope and encoding GFP instead of nef gene; gift from Heinrich
Gottlinger, Worcester, UMass, MA), and 4 lg plasmid encoding ALV
EnvA [41]. ALV reporter viruses were from supernatants of DF-1 cells
chronically infected with RCASBP(A)-GFP [41]. For siRNA experi-
ments, viruses were generated carrying the Vesicular stomatitis virus
G (VSVG) envelope protein instead of ALV-A Env. The culture
medium was harvested 48 h after transfection, filtered through 0.45
lm, aliquoted and stored at 80 C. To determine the titer, serial
dilutions of virus stocks were titrated onto DFJ8 cells in the presence
of 5 lg/ml of polybrene followed by flow cytometry of GFP- positive
cells (FACS, Becton Dickinson) 36–48 h later.
Virus entry assays. HEK293 cells were co-transfected in 24 wells
with 50 ng each of plasmids encoding the TRIM protein and 25 ng of
ALV receptor Tva950. 30 h after transfection, cells were seeded into
48-well plates at a density of 1.5 310
4
target cells/well. After an
additional 6 h, cells were challenged with N, B-MLV, HIV or ALV
carrying a GFP reporter genome. GFP-positive cells were quantified
by flow cytometry after 36 h post infection. To perform the screen
initially with a dynamic range that allows reliable detection of both
inhibiting and enhancing effects, an amount of virus was used that
resulted in infection levels of 5%. Strong inhibitory or enhancing
TRIM proteins were characterized in a second round with adjusted
infection levels. All experiments were at least performed four times
on separate days. These data sets were combined for the final analysis
shown in Figure 1. Fold inhibitions in virus entry represent the ratio
of percent GFP-positive cells of cells transfected with empty control
vector versus those expressing TRIM proteins. The maximum
variability between control samples in the absence of TRIM proteins
was ;1.5-fold. The cut-off value of 2.5 applied in Figure 1 was the
derived from 1.5 plus two times the standard deviations (confidence
value of 95%) of 0.5.
Virus release and gene expression assays. 2.5 310
5
HEK293 cells
(producer cells) in 24-wells were transfected with 50 ng TRIM
expressing construct with either 150 ng each of the HXB2Env

-GFP
and 50 ng plasmid expressing VSVG. For MLV release assays, 200 ng
of plasmid MLVEnv-GFP encoding full length Friend 57 MLV
genome with a GFP insertion into the envelope protein [33,34] was
co-transfected with TRIM expressing construct as above. ALV release
assays were conducted by transfecting 3 310
4
DF-1 cells in 24-well
plate with 50 ng TRIM expressing plasmids, 200 ng of ALV vector
lacking the envelope protein (plasmid DASBP-GFP, a gift from
Stephen Hughes, NCI Frederick, MD) and 50 ng of plasmid expressing
ecotropic Friend MLV envelope protein (pcDNA3-FrEnv) [33]. 48 h
after transfection, the released virus infectivity was measured by
applying two dilutions of the culture supernatants differing by 10-
fold onto target cells (DFJ8 for MLV and ALV; HEK293 or TZMbl
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160011
Anti-Retroviral TRIM Proteins

cells for HIV) in presence of 5 lg/ml of polybrene. GFP-positive cells
were enumerated after additional 36–48 h as above. For measuring
viral gene expression, the mean fluorescence intensity (MFI) of GFP
in the transfected producer cells (48 h after transfection) was
estimated using FACS (Becton Dickinson). Fold inhibition in viral
gene expression was calculated using the ratio of GFP MFI in cells
transfected with vector to those expressing TRIM. The maximum
variability between control samples in the absence of TRIM proteins
was ;2-fold. The cut-off value of 6 applied in Figure 3 was the
derived from 2 plus two times the standard deviations (confidence
value of 95%) of 2.
To measure the release of Gag (p30 for MLV and p24 for HIV) a
parallel experiment as described above was conducted in triplicates.
48 h after transfection the culture supernatants from triplicate wells
were combined and viruses sedimented at 12,000 3g in a micro-
centrifuge for 2 h. The resulting 12,000 g pellet was solubilized in SDS
gel loading buffer and resolved on SDS-10% PAGE followed by
western blot using antibodies to MLV capsid and Env (p30 & gp70;
Quality Biotech, Camden, NJ) or HIV capsid (p24; obtained through
the AIDS Research and Reference Reagent Program, NIH from Dr.
Michael H. Malim.)
Cell viability, apoptosis, and gene expression assays. Cell viability
and Caspase 3/7 activity was measured sequentially for the same
samples 48 h after transfection of 50 ng TRIM-expressing construct in
HEK 293 cells using CellTiter-BlueeCell Viability and Caspase-Glo 3/
7 Assay System (Promega Corp.) according to manufacturer’s
recommendations. To measure the effect on cellular gene expression
due to transient expression of TRIM proteins, 10 ng of plasmid
expressing GFP under a CMV promoter was co-transfected with 50 ng
of TRIM encoding plasmids in HEK293 cells. 48 h later the MFI of
GFP and fold inhibitions were calculated as above.
Viral entry and release assays in RNAi treated cells. 2310
5
HeLa
or HEK293 cells in 48 well plates were transfected with 80 nM TRIM-
specific siRNA smartpool (Dharmacon Inc) or control siRNA
(Dharmacon Inc, #D-001210–01) using Lipofectamine 2000 (Invitro-
gen, CA). After 4 h the medium was changed and after additional 20 h
the cells were split 1:4 into 4 wells of a 48 well plate. For entry assays,
36 h post-transfection, the cells were challenged as above with VSV-G
pseudotyped reporter N-, NB-MLV and HIV at two concentrations of
virus differing by 2-fold. After additional 24 h the cells were
harvested, fixed and analyzed by FACS. For virus release assays, 30
h after first siRNA transfection, cells were transfected again with 80
nM TRIM-specific siRNA smartpool or control siRNA together with
either 200 ng plasmid encoding full length Friend MLV genome
carrying a GFP insertion into the envelope protein or 100ng of full
length replication competent HIV-1 plasmid pNL4–3 (AIDS Research
and Reference Reagent Program). After an additional 48 h, the
culture supernatants were harvested and applied onto DFJ8 for MLV
and TZMbl cells for HIV titration. For MLV, DFJ8 cells were
harvested 48 h after infection and analyzed by FACS as before. For
HIV, 48 h after infection, TZMBL cells were lysed and luciferase
activity measured using a Luminometer (Turner Biosystems). Fold
increase in entry or release was calculated using a ratio of the percent
GFP positive cells or luciferase activity (measured as relative light
units) from experimental samples transfected with TRIM specific
siRNA and those transfected with control siRNA.
TRIM specific siRNA used in the study. Silencing of endogenous
human TRIM proteins was carried out using ON-TARGETplus siRNA
smart pools (a mix of 4 siRNAs) from Dharmacon, Inc. pre-designed
to reduce off-target effects by up to 90%. We routinely obtained 70 to
90% knock down of specific TRIM proteins as assessed by monitoring
the levels of transiently expressed TRIM-GFP 36 h post-transfection.
The sense sequences of siRNAs targeting (1) TRIM11 were #1: AG
GCGAAGCUGGAGAAGUCUU, #2: GAGCUGAUC CUGUCUGAA
GUU, #3: UCACUGCUA UUCAUCUUUCUU, #4: GGACAGCCCA
GAGCGCU UUUU; (2) TRIM15 were #1: GGGAGAAACUUACUGC
GAGUU, #2: GCGAGAACGAUGCCG AGUUUU, #3: CCCUGAAG
GUGGUCCAUGAUU, #4: GCAGAACCACAGACGGCUUUU; (3)
TRIM25 were #1: CGGAACA GUUAGUGGAUUUUU, #2: CAACAA
GAAUACACGGAA AUU, #3: GCGGAUGACUGCAAACAGAUU, #4:
GGGAUGAGUUCGAGUUUCUUU; (4) TRIM31 were #1: GGAGAA
GAAUU UCCUGCUAUU, #2: GGAAGAACGCAAUCAGGUU UU, #3:
AAUUUGAACUCCUGCAUCAUU, #4: CCACAAAUCCCAUAAUGU
CUU; (5) TRIM62 were #1: CUACAAUGCUGAUGACAUGUU, #2:
GCGAGAAGUUCCCUGGCAAUU, #3: AGACCAACCUCACAUAU
GAUU, #4: GACCAAGUCUUCCACCAAGUU. For human TRIM5,
the sequences of the siRNA smart pool from Dharmacon were as
previously reported [8]. TRIM5 silencing using this smart pool
resulted in a ;4-fold and ;50-fold enhancement of N-MLV entry in
HEK293 and HeLa cells, respectively.
Data analysis. For easy interpretation of the screen we used scatter
plots generated using Excel. Fold inhibitions for the two parameters
compared were plotted against each other in log scale. Java
TREEVIEW was used to represent data in color codes [43]. The input
fold inhibition values obtained as described in previous sections were
log2 transformed to obtain positive (inhibition, shades of red) and
negative (enhancement, shades of green) values prior to data analysis
using TREEVIEW.
Co-immunoprecipitation analysis. HEK293 cells were transfected
as above with 50 ng of plasmids encoding TRIM15 derivatives with C-
terminal YFP fusions or untagged TRIM15 and 200 ng of plasmid
encoding full length Friend MLV genome carrying a GFP insertion
into the envelope protein or 100 ng of MLV Gag-GFP. 48 h post-
transfection, the cells were lysed using triple detergent lysis buffer
(TDLB, 100 mM Tris [pH 8.0], 1% Triton-X-100, 0.5% sodium
deoxycholate, 0.2% sodium dodecyl sulphate, 150 mM NaCl). The
nuclei and undissolved cellular components were removed by
centrifugation at 12,000 3g for 30 minutes in a microcentrifuge.
The clarified 12,000 3g supernatant was used for immunoprecipi-
tation using protein-G beads prebound with antibodies to MLV
capsid (Quality Biotech, Camden, NJ) or TRIM15 (Abcam, Boston,
MA) raised in goat or isotype specific antibodies. The immunopre-
cipitates were washed three times with TDLB and analyzed using
SDS-10%-PAGE followed by western blot using antibodies to GFP.
Imaging. The generation of fluorescently labeled MLV and HIV
virions using Gag-GFP proteins was previously described [33]. To
visualize MLV Gag and TRIM15 in HEK293 cells, plasmids encoding
for MLV Gag-CFP (50 ng), replication competent MoMLV (200 ng)
and TRIM15-YFP (10 ng) were co-transfected. To perform a similar
experiment for HIV, 50 ng HIV Gag-YFP was co-transfected with 10
ng TRIM15-CFP. 24 h later, cells were fixed and the CFP and YFP
channels monitored using the 60x oil objective (NA 1.4) of a Nikon
TE2000 inverted wide-field microscope. To monitor TRIM11 and
TRIM5, HEK293 cells were transfected with 5 ng TRIM11-YFP
together with 50 ng TRIM5-CFP and cells imaged 24 h post-
transfection using the 603oil Nikon objective (NA 1.4) and an
Improvision spinning disc confocal microscope.
Reverse-transcription PCR for detection of endogenous expressed
TRIMs. Total RNA was extracted from HEK293 and HeLa cells using
PrepEase RNA extraction kit (USB), which has an on-column DNAse
treatment step. The RNA was reverse transcribed with anchored
oligodT using Reverse-iT first strand synthesis kit (ABgene). The
cDNA was then used to check presence TRIM-specific sequences by
PCR using appropriate primer pairs. Control reactions which used
plain RNA for PCR amplification did not yield any products (data not
shown). Specific primer pairs used for amplifications were obtained
from Primer Bank database and sequences can be found at http://pga.
mgh.harvard.edu/primerbank/index.html.
Supporting Information
Figure S1. Effects of TRIM Protein Expression on Cell Viability and
CMV Promoter Activity
(A) The effect of TRIM protein expression in HEK293 cells using 50
ng of TRIM-expressing constructs in a 24 well on the induction of
apoptosis was monitored 48 h post-transfection using a caspase 3/7
activity assay.
(B) An assay as in (A) was performed to measure the effects of TRIM
protein expression on cell viability using the ability of cells to convert
resazurin into resorufin.
(C) The effects of TRIM protein expression in HEK293 cells as in (A)
on the activity of the CMV promoter were tested by measuring GFP
fluorescence of the plasmid pEGFP-N1. For TRIM11 proteins, the
transfection of 10 ng reduced pleiotropic effects on transcription.
(D) Sequence comparison of the B30.2 domain of mouse TRIM30 in
comparison to its closest homologues rat TRIM30 (68% identity), the
TRIM5 like proteins from cow 505265 (48%) and pig 733579 (47%),
human TRIM5 (47%), and rhesus TRIM5 (45%).
Found at doi:10.1371/journal.ppat.0040016.sg001 (1.3 MB TIF).
Figure S2. TRIM Proteins Interfere with Retroviral Release
(A) HIV p24 capsid released into the culture supernatant from
HEK293 cells expressing indicated TRIM proteins. Effects of TRIM
protein expression on HIV release and viral gene expression are as in
Figure 3B.
(B) TRIM proteins interfere with MLV release in a dose dependent
fashion. An experiment as in Figure 3C was performed with
increasing amounts of transfected plasmids encoding TRIM proteins.
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160012
Anti-Retroviral TRIM Proteins

(C) MLV p30 capsid and gp70 Env released into the culture
supernatant from HEK293 cells expressing indicated TRIM proteins.
(D) An experiment as in Figure 3 was performed to determine TRIM
proteins that interfere with ALV release in DF-1 cells.
Found at doi:10.1371/journal.ppat.0040016.sg002 (3.7 MB TIF).
Figure S3. Endogenous Expression and Silencing of TRIM Proteins
Expressed in HEK293 and HeLa Cells
(A) Reverse transcriptase PCR for the presence of indicated TRIM
mRNA in HEK293 and HeLa cells.
(B) Western blot using GFP antibodies for indicated TRIM-YFP fusion
proteins expressed in the presence of control (con) or specific siRNA
(sp). Protein loads were monitored using antibodies against actin.
Found at doi:10.1371/journal.ppat.0040016.sg003 (1.9 MB TIF).
Acknowledgments
We are grateful to Germana Meroni for sharing TRIM expression
constructs. We thank Joseph Sodroski, Greg Towers, Jonathan Stoye,
Stephen Hughes, Alan Rein, and the AIDS Research and Reference
Reagent Program for plasmids and reagents; Nathan Sherer, Priti
Kumar, and Brett Lindenbach for critical reading of the manuscript;
and Ilker Oztop for assistance.
Author contributions. PDU, BDQ, and WM designed the study.
PDU and BDQ performed all experiments with some assistance from
WTC and JML. PDU and WM wrote the manuscript.
Funding. This work was supported by the National Institutes of
Health (NIH) grants RO1CA098727 and R21 AI065284 to WM and an
Anna Fuller Fellowship in Cancer Research to PDU.
Competing interests. The authors have declared that no competing
interests exist.
References
1. Goff SP (2007) Host factors exploited by retroviruses. Nat Rev Microbiol 5:
253–263.
2. Nisole S, Stoye JP, Saib A (2005) TRIM family proteins: retroviral
restriction and antiviral defence. Nat Rev Microbiol 3: 799–808.
3. Towers GJ, Goff SP (2003) Post-entry restriction of retroviral infections.
AIDS Rev 5: 156–164.
4. Bieniasz PD (2004) Intrinsic immunity: a front-line defense against viral
attack. Nat Immunol 5: 1109–1115.
5. Sokolskaja E, Luban J (2006) Cyclophilin, TRIM5, and innate immunity to
HIV-1. Curr Opin Microbiol 9: 404–408.
6. Best S, Le Tissier P, Towers G, Stoye JP (1996) Positional cloning of the
mouse retrovirus restriction gene Fv1. Nature 382: 826–829.
7. Pincus T, Hartley JW, Rowe WP (1975) A major genetic locus affecting
resistance to infection with murine leukemia viruses. IV. Dose-response
relationships in Fv-1-sensitive and resistant cell cultures. Virology 65: 333–
342.
8. Stremlau M, Owens CM, Perron MJ, Kiessling M, Autissier P, et al. (2004)
The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in
Old World monkeys. Nature 427: 848–853.
9. Sayah DM, Sokolskaja E, Berthoux L, Luban J (2004) Cyclophilin A
retrotransposition into TRIM5 explains owl monkey resistance to HIV-1.
Nature 430: 569–573.
10. Hatziioannou T, Perez-Caballero D, Yang A, Cowan S, Bieniasz PD (2004)
Retrovirus resistance factors Ref1 and Lv1 are species-specific variants of
TRIM5alpha. Proc Natl Acad Sci U S A 101: 10774–10779.
11. Keckesova Z, Ylinen LM, Towers GJ (2004) The human and African green
monkey TRIM5alpha genes encode Ref1 and Lv1 retroviral restriction
factor activities. Proc Natl Acad Sci U S A 101: 10780–10785.
12. Yap MW, Nisole S, Lynch C, Stoye JP (2004) Trim5alpha protein restricts
both HIV-1 and murine leukemia virus. Proc Natl Acad Sci U S A 101:
10786–10791.
13. Perron MJ, Stremlau M, Lee M, Javanbakht H, Song B, et al. (2007) The
human TRIM5alpha restriction factor mediates accelerated uncoating of
the N-tropic murine leukemia virus capsid. J Virol 81: 2138–2148.
14. Stremlau M, Perron M, Lee M, Li Y, Song B, et al. (2006) Specific
recognition and accelerated uncoating of retroviral capsids by the
TRIM5alpha restriction factor. Proc Natl Acad Sci U S A 103: 5514–5519.
15. Sebastian S, Luban J (2005) TRIM5alpha selectively binds a restriction-
sensitive retroviral capsid. Retrovirology 2: 40.
16. Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, et al. (2001) The
tripartite motif family identifies cell compartments. EMBO J 20: 2140–2151.
17. Meroni G, Diez-Roux G (2005) TRIM/RBCC, a novel class of ‘single protein
RING finger’ E3 ubiquitin ligases. Bioessays 27: 1147–1157.
18. Everett RD, Chelbi-Alix MK (2007) PML and PML nuclear bo dies:
Implications in antiviral defence. Biochimie 89: 819–830.
19. Campbell EM, Dodding MP, Yap MW, Wu X, Gallois-Montbrun S, et al.
(2007) TRIM5falphagCytoplasmic Bodies Are Highly Dynamic Structures.
Mol Biol Cell 18: 2102–2111.
20. Short KM, Cox TC (2006) Subclassification of the RBCC/TRIM superfamily
reveals a novel motif necessary for microtubule binding. J Biol Chem 281:
8970–8980.
21. Buchner G, Montini E, Andolfi G, Quaderi N, Cainarca S, et al. (1999) MID2,
a homologue of the Opitz syndrome gene MID1: similarities in subcellular
localization and differences in expression during development. Hum Mol
Genet 8: 1397–1407.
22. Cainarca S, Messali S, Ballabio A, Meroni G (1999) Functional character-
ization of the Opitz syndrome gene product (midin): evidence for
homodimerization and association with microtubules throughout the cell
cycle. Hum Mol Genet 8: 1387–1396.
23. Schweiger S, Foerster J, Lehmann T, Suckow V, Muller YA, et al. (1999) The
Opitz syndrome gene product, MID1, associates with microtubules. Proc
Natl Acad Sci U S A 96: 2794–2799.
24. Wolf D, Goff SP (2007) TRIM28 mediates primer binding site-targeted
silencing of murine leukemia virus in embryonic cells. Cell 131: 46–57.
25. Tissot C, Mechti N (1995) Molecular cloning of a new interferon-induced
factor that represses human immunodeficiency virus type 1 long terminal
repeat expression. J Biol Chem 270: 14891–14898.
26. Fridell RA, Harding LS, Bogerd HP, Cullen BR (1995) Identification of a
novel human zinc finger protein that specifically interacts with the
activation domain of lentiviral Tat proteins. Virology 209: 347–357.
27. Gack MU, Shin YC, Joo CH, Urano T, Liang C, et al. (2007) TRIM25 RING-
finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity.
Nature 446: 916–920.
28. Towers GJ (2005) Control of viral infectivity by tripartite motif proteins.
Hum Gene Ther 16: 1125–1132.
29. Bates P, Rong L, Varmus HE, Young JA, Crittenden LB (1998) Genetic
mapping of the cloned subgroup A avian sarcoma and leukosis virus
receptor gene to the TVA locus. J Virol 72: 2505–2508.
30. Si Z, Vandegraaff N, O’Huigin C, Song B, Yuan W, et al. (2006) Evolution of
a cytoplasmic tripartite motif (TRIM) protein in cows that restricts
retroviral infection. Proc Natl Acad Sci U S A 103: 7454–7459.
31. Perez-Caballero D, Hatziioannou T, Yang A, Cowan S, Bieniasz PD (2005)
Human tripartite motif 5alpha domains responsible for retrovirus
restriction activity and specificity. J Virol 79: 8969–8978.
32. Sawyer SL, Wu LI, Emerman M, Malik HS (2005) Positive selection of
primate TRIM5alpha identifies a critical species-specific retroviral restric-
tion domain. Proc Natl Acad Sci U S A 102: 2832–2837.
33. Sherer NM, Lehmann MJ, Jimenez-Soto LF, Ingmundson A, Horner SM, et
al. (2003) Visualization of retroviral replication in living cells reveals
budding into multivesicular bodies. Traffic 4: 785–801.
34. Lehmann MJ, Sherer NM, Marks CB, Pypaert M, Mothes W (2005) Actin-
and myosin-driven movement of viruses along filopodia precedes their
entry into cells. J Cell Biol 170: 317–325.
35. Lerner M, Corcoran M, Cepeda D, Nielsen ML, Zubarev R, et al. (2007) The
RBCC gene RFP2 (Leu5) encodes a novel transmembrane E3 ubiquitin
ligase involved in ERAD. Mol Biol Cell 18: 1670–1682.
36. Nasioulas G, Hughes SH, Felber BK, Whitcomb JM (1995) Production of
avian leukosis virus particles in mammalian cells can be mediated by the
interaction of the human immunodeficiency virus protein Rev and the Rev-
responsive element. Proc Natl Acad Sci U S A 92: 11940–11944.
37. Sakuma R, Noser JA, Ohmine S, Ikeda Y (2007) Rhesus monkey TRIM5alpha
restricts HIV-1 production through rapid degradation of viral Gag
polyproteins. Nat Med 13: 631–635.
38. Ishikawa H, Tachikawa H, Miura Y, Takahashi N (2006) TRIM11 binds to
and destabilizes a key component of the activator-mediated cofactor
complex (ARC105) through the ubiquitin-proteasome system. FEBS Lett
580: 4784–4792.
39. Niikura T, Hashimoto Y, Tajima H, Ishizaka M, Yamagishi Y, et al. (2003) A
tripartite motif protein TRIM11 binds and destabilizes Humanin, a
neuroprotective peptide against Alzheimer’s disease-relevant insults. Eur
J Neurosci 17: 1150–1158.
40. Sherer NM, Lehmann MJ, Jimenez-Soto LF, Horensavitz C, Pypaert M, et al.
(2007) Retroviruses can establish filopodial bridges for efficient cell-to-cell
transmission. Nat Cell Biol 9: 310–315.
41. Mothes W, Boerger AL, Narayan S, Cunningham JM, Young JA (2000)
Retroviral entry mediated by receptor priming and low pH triggering of an
envelope glycoprotein. Cell 103: 679–689.
42. Towers G, Bock M, Martin S, Takeuchi Y, Stoye JP, et al. (2000) A conserved
mechanism of retrovirus restriction in mammals. Proc Natl Acad Sci U S A
97: 12295–12299.
43. Saldanha AJ (2004) Java Treeview–extensible visualization of microarray
data. Bioinformatics 20: 3246–3248.
PLoS Pathogens | www.plospathogens.org February 2008 | Volume 4 | Issue 2 | e160013
Anti-Retroviral TRIM Proteins