ArticlePDF Available

RNase-Resistant Virus-Like Particles Containing Long Chimeric RNA Sequences Produced by Two-Plasmid Coexpression System

Authors:

Abstract and Figures

RNase-resistant, noninfectious virus-like particles containing exogenous RNA sequences (armored RNA) are good candidates as RNA controls and standards in RNA virus detection. However, the length of RNA packaged in the virus-like particles with high efficiency is usually less than 500 bases. In this study, we describe a method for producing armored L-RNA. Armored L-RNA is a complex of MS2 bacteriophage coat protein and RNA produced in Escherichia coli by the induction of a two-plasmid coexpression system in which the coat protein and maturase are expressed from one plasmid and the target RNA sequence with modified MS2 stem-loop (pac site) is transcribed from another plasmid. A 3V armored L-RNA of 2,248 bases containing six gene fragments-hepatitis C virus, severe acute respiratory syndrome coronavirus (SARS-CoV1, SARS-CoV2, and SARS-CoV3), avian influenza virus matrix gene (M300), and H5N1 avian influenza virus (HA300)-was successfully expressed by the two-plasmid coexpression system and was demonstrated to have all of the characteristics of armored RNA. We evaluated the 3V armored L-RNA as a calibrator for multiple virus assays. We used the WHO International Standard for HCV RNA (NIBSC 96/790) to calibrate the chimeric armored L-RNA, which was diluted by 10-fold serial dilutions to obtain samples containing 10(6) to 10(2) copies. In conclusion, the approach we used for armored L-RNA preparation is practical and could reduce the labor and cost of quality control in multiplex RNA virus assays. Furthermore, we can assign the chimeric armored RNA with an international unit for quantitative detection.
Content may be subject to copyright.
JOURNAL OF CLINICAL MICROBIOLOGY, May 2008, p. 1734–1740 Vol. 46, No. 5
0095-1137/08/$08.000 doi:10.1128/JCM.02248-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
RNase-Resistant Virus-Like Particles Containing Long Chimeric RNA
Sequences Produced by Two-Plasmid Coexpression System
Yuxiang Wei,
1,2
Changmei Yang,
1,2
Baojun Wei,
1,2
Jie Huang,
1,2
Lunan Wang,
2
Shuang Meng,
2
Rui Zhang,
2
and Jinming Li
1,2
*
Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, People’s Republic of China,
1
and
Department of Immunoassay and Molecular Diagnosis, National Center for Clinical Laboratory, Beijing Hospital, Beijing,
People’s Republic of China
2
Received 20 November 2007/Returned for modification 28 December 2007/Accepted 16 February 2008
RNase-resistant, noninfectious virus-like particles containing exogenous RNA sequences (armored RNA) are
good candidates as RNA controls and standards in RNA virus detection. However, the length of RNA packaged
in the virus-like particles with high efficiency is usually less than 500 bases. In this study, we describe a method
for producing armored L-RNA. Armored L-RNA is a complex of MS2 bacteriophage coat protein and RNA
produced in Escherichia coli by the induction of a two-plasmid coexpression system in which the coat protein
and maturase are expressed from one plasmid and the target RNA sequence with modified MS2 stem-loop (pac
site) is transcribed from another plasmid. A 3V armored L-RNA of 2,248 bases containing six gene fragments—
hepatitis C virus, severe acute respiratory syndrome coronavirus (SARS-CoV1, SARS-CoV2, and SARS-CoV3),
avian influenza virus matrix gene (M300), and H5N1 avian influenza virus (HA300)—was successfully ex-
pressed by the two-plasmid coexpression system and was demonstrated to have all of the characteristics of
armored RNA. We evaluated the 3V armored L-RNA as a calibrator for multiple virus assays. We used the
WHO International Standard for HCV RNA (NIBSC 96/790) to calibrate the chimeric armored L-RNA, which
was diluted by 10-fold serial dilutions to obtain samples containing 10
6
to 10
2
copies. In conclusion, the
approach we used for armored L-RNA preparation is practical and could reduce the labor and cost of quality
control in multiplex RNA virus assays. Furthermore, we can assign the chimeric armored RNA with an
international unit for quantitative detection.
Armored RNA is a complex of MS2 bacteriophage coat
protein and RNA produced in Escherichia coli by the induction
of an expression plasmid that encodes the bacteriophage se-
quence consisting of the maturase, the coat protein, the pac
site, and an exogenous RNA sequence. This method produces
recombinant virus-like particles that are noninfectious and
contain predefined RNA (2–6, 8, 11, 12, 15, 16, 28). These
armored RNAs are RNase resistant by virtue of their encap-
sulation within an MS2 coat protein, and they have been widely
used as controls, standards, or calibrators for the detection of
hepatitis C virus (HCV) (11, 12, 28), human immune-defi-
ciency virus (11, 15), severe acute respiratory syndrome coro-
navirus (SARS-CoV) (3, 11), enterovirus (2, 5), avian influenza
virus 5 (4), and West Nile virus (6) using reverse transcription-
PCR (RT-PCR), real-time RT-PCR, and branched DNA as-
says (2–6, 11, 12, 15, 28).
The MS2 bacteriophage consists of 180 U of the bacteriophage
coat protein that encapsulates the bacteriophage genome (25).
The MS2 phage RNA genome comprises a single plus-sense
strand encoding 3,569 nucleotides. The genes are organized from
the 5 end as follows: the maturase or A protein, the bacterio-
phage coat protein, a 75-amino-acid lysis protein, and a replicase
subunit. Packaging of the RNA genome by coat protein is initi-
ated by high-specificity binding to a unique site on the RNA, a
single stem-loop structure, containing the initiation codon of the
gene for the viral replicase. The armored RNA contains approx-
imately 1.7 kb of bacteriophage RNA sequence encoding the
maturase, the coat protein, and the pac site. The wild-type MS2
bacteriophage contains an RNA genome of approximately 3.6 kb.
In addition, the extensively folded nature of MS2 RNA (22) may
make it particularly suitable for uptake into the confines of a small
capsid. Thus, theoretically, at most, 1.9 kb of nonbacteriophage
RNA sequence might be encapsulated by this method. Practically,
the packaging of 500 bases of RNA has been demonstrated to be
very efficient; however, packaging of 1- and 1.5-kb amounts of
RNA is inefficient (15). Recently, Huang et al. (11) used armored
RNA technology to package a 1,200-nucleotide foreign RNA
sequence by deleting some disposable sequences between the
multiple cloning site and the transcription terminator; however, to
date, there have been no reports of armored RNA with sizes
greater than 1,200 bp.
Although most RT-PCR assays do not target RNA se-
quences longer than 500 bases, there are some advantages if
longer target RNA sequences are packaged. For example, the
human immunodeficiency virus Quantiplex assay (Chiron
Corp.) uses a standard that is approximately 3 kb in length;
consequently, it is not possible to produce a single armored
RNA standard for this assay using routine armored RNA tech-
nology. A further advantage of using armored RNA of several
kilobases is that PCR primers for different regions of these
genes may be used with a single armored RNA standard. Ac-
cordingly, it is not necessary to construct a different armored
* Corresponding author. Mailing address: Department of Immuno-
assay and Molecular Diagnosis, National Center for Clinical Labora-
tory, 1 Dahua Road, Dongdan, Beijing 100730, People’s Republic of
China. Phone: 86-10-58115053. Fax: 86-10-65212064. E-mail: ljm63hn
@yahoo.com.cn.
† Y.W. and C.Y. contributed equally to this study.
Published ahead of print on 27 February 2008.
1734
RNA standard for each PCR primer pair that might be used.
With such a standard, different research groups and clinical
laboratories could directly compare their quantitative data. In
addition, if long RNA sequences were to be packaged, we
could produce a single chimeric armored RNA standard and
control that could meet the needs of a variety of different viral
assays designed to detect different viral genomes. This would in
turn simplify and reduce the cost of multivirus detection. Fur-
thermore, if chimeric armored RNA sequences from different
RNA viruses contain an HCV 5 untranslated region (5UTR),
we could easily assign the chimeric armored RNA with an
international unit for quantitative detection since an interna-
tional standard for HCV RNA is available from the National
Institute for Biological Standards and Controls (NIBSC)
(20, 21).
In this article, we describe a method for packaging a long
(2,000 bp) RNA sequence, which is referred to as armored
L-RNA technology. We sought to determine whether the bac-
teriophage sequences encoding the maturase and the coat pro-
tein could be replaced with nonbacteriophage RNA sequences,
thereby enabling long-fragment RNA sequences to be pack-
aged. In order to achieve this, we took advantage of a two-
plasmid coexpression system in which the maturase and coat
protein were expressed from one plasmid [pET-28(b)] and the
target RNA containing a modified stem-loop (pac site) of MS2
was produced by a second plasmid (pACYCDuet-1). The pac
site was located in the middle of the target sequence. In the
present study, we used a C-5 variant of the wild-type stem-loop
in which uridine had been substituted by cytosine. The replace-
ment of the wild-type uridine with a cytosine at position 5
significantly increases the affinity of the RNA for the coat
protein dimer (9, 19, 27, 29). The affinity increase has been
estimated to be 6-fold (26) or even as high as 50-fold (13). The
stronger binding of the C-5 variant compared to the wild-type
sequence has been suggested to be due to an interaction in-
volving the donation of a hydrogen by the amino group of the
cytosine or the corresponding hydroxyl group of the uracil enol
tautamer (24).
MATERIALS AND METHODS
Construction of pET-MC. MS2 maturase and coat protein genes were ampli-
fied by using primers S-MC and A-MC (Table 1) from the pMS
27
plasmid (kindly
provided by D. S. Peabody) containing nucleotides (nt) 81 to 1749 of the MS2
bacteriophage gene (GenBank accession no. V00642). Sense and reverse primers
contained BamHI and HindIII restriction sites (underlined), respectively. These
primers correspond to nt 81 to 101 and nt 1721 to 1741 of the MS2 phage genome
sequence. The 1.7-kb PCR-amplified DNA fragments were gel purified, digested
with BamHI and HindIII, and then ligated to a linearized pET28b (Novagen)
vector to generate the recombinant plasmid pET-MC. This plasmid was trans-
formed into competent E. coli DH5 cells according to the manufacturer’s
instructions. The pET-MC plasmids in positive clones that could replicate in LB
agar in the presence of 100 g of kanamycin ml
1
were isolated by using a
Takara MiniBEST plasmid purification kit (TaKaRa). The DNA insert was
sequenced with vector-specific primers using an automated fluorescent DNA
sequencer (model 3730XL; Applied Biosystems). The resulting sequences were
identified by a search of the NCBI databases for homologous sequences using
BLAST.
Construction of pACYC-3V. An exogenous chimeric sequence 2,248 bp in
length comprising the following sequences was inserted into a pACYCDuet-1
plasmid (p15A-type replication origin; Novagen): M-300 (nt 17373, 357 bp
from avian influenza virus matrix gene; GenBank accession no. DQ864720),
SARS-CoV1 (nt 15224 to 15618, 395 bp from SARS-CoV; GenBank accession
no. AY864806), SARS-CoV2 (nt 18038 to 18340, 303 bp from SARS-CoV;
GenBank accession no. AY864806), SARS-CoV3 (nt 328110 to 28692, 583 bp
from SARS-CoV; GenBank accession no. AY864806), a pac site (19 bp), HCV
(nt 18 to 310, 293 bp from HCV 5UTR; GenBank accession no. AF139594), and
HA300 (nt 295 to 611, 317 bp from H5N1 avian influenza virus; GenBank
accession no. DQ864720). The target sequence included the forward and reverse
primer sites, flanking regions, and probe-binding sites previously published or
described. A 19-mer pac site was placed between SARS-CoV3 and HCV (Fig. 1).
We spliced the six target DNA sequences using overlapping extensions (10).
During the first-round PCR, these six small fragments were amplified as fol-
lows. SARS-CoV1 was amplified from a pBSSR-V6 plasmid (kindly provided by
the Chinese Academy of Medical Sciences and Peking Union Medical College,
Institute of Basic Medical Sciences), containing nt 13785 to 16051 of the SARS-
CoV gene, using the primers S-SARS1 and LAP-SARS1. SARS-CoV2 was
amplified from a pNCCL-SARS plasmid (constructed by our laboratory), con-
taining nt 18038 to 18340 of the SARS-CoV gene, using the primers LAP-SARS2
and A-SARS2. SARS-CoV3 was amplified from a pBSSR7-8 plasmid (kindly
provided by the Chinese Academy of Medical Sciences and Peking Union Med-
ical College, Institute of Basic Medical Sciences), containing nt 27730 to 29212
of the SARS-CoV gene, using the primers LAP-SARS3 and A-SARS3. The
HCV fragment was amplified from a pNCCL-HCV plasmid (constructed by our
laboratory), containing nt 18 to 310 of the HCV gene, using the primers S-HCV
and HCV-LAP1(underlined for 19mer pac site). HA300 was amplified from a
TABLE 1. Primers used for PCR amplification
Primer
name
Primer sequence (5 to 3)
a
S-MC......................................CGGGATCCTGGCTATCGCTGTAGG
TAGCC
A-MC .....................................CCCAAGCTTATGGCCGGCGTCTAT
TAGTAG
S-SARS1 ................................TATCCAAAATGTGACAGAGCCATG
LAP-SARS1 ..........................ACGCTGAGGTGTGTAGGTGCAGG
TAAGCGTAAAACTCATCCAC
A-SARS2 ...............................TAACCAGTCGGTACAGCTACTAAG
LAP-SARS2 ..........................AGTTTTACGCTTACCTGCACCTAC
ACACCTCAGCGTTGATATAAAG
A-SARS3 ...............................ACTACGTGATGAGGAGCGAGA
AGAG
LAP-SARS3 ..........................AGCTGTACCGACTGGTTAACAAAT
TAAAATGTCTGATAATGGA
CCCC
LAP-SARS2
........................
ATCAGACATTTTAATTTGTTAACC
AGTCGGTACAGCTACTAAG
S-HCV ...................................ACATGAGGATCACCCATGTGGCGAC
ACTCCACCATAGATCACTC
HCV-LAP1............................ATGTAAGACCATTCCGGCTCGCAA
GCACCCTATCAGGCAGTAC
A-HA300 ...............................GAATCCGTCTTCCATCTTTCCCCCA
CAGTACCAAAAGATCTTC
HA300LAP............................CTGATAGGGTGCTTGCGAGCCGG
AATGGTCTTACATAGTGGAG
MSLAP1.............................ATGGCTCTGTCACATTTTGGATAG
AGTAGCTGAGTGCGACCTCC
TTAG
MSLAP2.............................AAGGAGGTCGCACTCAGCTACTCT
ATCCAAAATGTGACAGAGC
CATG
FIVELAP1 ............................CATGGGTGATCCTCATGTACTACG
TGATGAGGAGCGAGAAGAG
FIVELAP2 ............................CGCTCCTCATCACGTAGTACATGA
GGATCACCCATGTGGC
OverlapA..............................CCTTAATTAA CCCACAGTACCAAA
AGATCTTCTTG
M300-S .................................TTGGCCGGCC GAGTCTTCTAACC
GAGGTCGAAACG
overlap-A...............................CCCACAGTACCAAAAGATCTT
CTTG
M300RT-S .............................GGATTTGTATTCACGCTCACC
HA300RT-A..........................TGGGGATGATCTGAATTTTCTC
a
BamHI, HindIII, FseI, and PacI restriction sites are indicated by underscor
-
ing; a C vairiant is indicated in boldface type.
VOL. 46, 2008 LONG CHIMERIC RNA ARMORED L-RNA 1735
pNCCL-H5N1 plasmid (constructed by our laboratory) using the primers
HA300LAP and A-HA300. M300 was amplified from a pNCCL-H5N1 plasmid
(constructed by our laboratory) using the primers M300-S and MSLAP1. The
PCR products from the first-round amplifications were gel purified and used,
together with outside primers, in the overlap extension PCR. In the second-
round PCR, amplified SARS-CoV1 plus SARS-CoV2 and HCV plus HA300 were
amplified using the primers pairs S-SARS1–LAP-SARS2
and FIVELAP2-Over
-
lapA, respectively. The PCR products from the second round were gel purified. The
third-round PCR amplified SARS-CoV1 plus SARS-CoV2 plus SARS-CoV3 using
the primers MSLAP2 and FIVELAP1. The PCR products from the third round
were gel purified. The fourth-round PCR amplified SARS-CoV1 plus SARS-CoV2
plus SARS-CoV3 plus HCV plus HA300 using primers MSLAP2 and OverlapA.
The fifth-round PCR amplified M300 plus SARS-CoV1 plus SARS-CoV2 plus
SARS-CoV3 plus HCV plus HA300 using the primers M300-S and OverlapA.
Sense and reverse primers contained FseI and PacI restriction sites (underlined in
Table 1), respectively. The fifth-round PCR products were gel purified. The purified
fragments were cloned into a pGEM-T Easy vector (Promega) and then excised
from the resulting recombinant plasmid with the FseI and PacI restriction enzymes.
Simultaneously, the pACYCDuet-1 plasmid was digested with FseI and PacI, and
the resulting fragments were ligated into the linearized pACYCDuet-1 plasmid to
produce a new donor plasmid (pACYC-3V). pACYC-3V plasmids in positive
clones, which could replicate on LB agar in the presence of 100 g of chloramphen-
icol ml
1
, were confirmed by PCR and sequencing.
Construction of pET-MS2-3V. In order to compare armored RNA particles
and armored L-RNA particles, we constructed pET-MS2-3V according to rou-
tine armored RNA technology (15). The DNAs encoding the maturase; the coat
protein; the pac site; and the exogenous chimeric sequence (1,900 bp) containing
SARS-CoV1, SARS-CoV2, SARS-CoV3, HCV, and HA300 were cloned down-
stream of the inducible T7 promoter of pET28b.
Expression and purification of virus-like particles. Both pET-MC and
pACYC-3V plasmids were cotransformed into E. coli strain BL21(DE3). The 3V
armored L-RNA was expressed as described previously (16). The cells were
harvested by centrifugation and then washed three times with phosphate-buff-
ered saline. The cells were pelleted and then resuspended in 20 ml of sonication
buffer (5 mM MgSO
4
, 0.1 M NaCl, 50 mM Tris [pH 8.0]). The cells were
sonicated (Branson Sonifier 350) by using a small sonication probe operating at
50% duty cycle (unit 5 power) for five pulses. The sonicate was placed on ice for
1 min, and then the sonication step was repeated another five times. The sonicate
was centrifuged in order to pellet the cell debris. A total of 20 ml of supernatant
was then incubated with 1,000 U of E. coli RNase 1 and 200 U of bovine
pancreatic DNase 1 at 37°C for 40 min in order to eliminate E. coli RNA and
DNA. After nuclease treatment, 5 l of supernatant was electrophoresed on an
agarose gel in TAE buffer and stained with ethidium bromide to assay for
armored L-RNA. A CsCl gradient was then performed as the standard method
(16). In order to compare the densities of 3V armored L-RNA and 3V armored
RNA particles, the 3V armored RNA from pET-MS2-3V was expressed as
described previously (16). Each RNA was loaded on separate gradients. After
ultracentrifugation, the ultracentrifugation tube was stabilized in an upright
position. An 18-gauge needle was slowly inserted into the bottom of the tube, and
0.5-ml fractions were collected and weighed in order to determine the density of
the CsCl. The optical density of each fraction at 260 nm was measured in order
to quantify the 3V armored L-RNA and 3V armored RNA particles. A 5-l
portion of each fraction was electrophoresed on an agarose gel in TAE buffer
and stained with ethidium bromide in order to determine the fractions contain-
ing armored L-RNA and those containing armored RNA. The fractions were
then pooled and dialyzed against sonication buffer in order to remove CsCl. The
dialysate was collected and stored at 4°C.
RNA extraction. RNA was extracted from 140 l of the purified armored
L-RNA by using a QIAamp viral RNA minikit (Qiagen) according to the man-
ufacturer’s instructions. The extracted RNA was eluted in 60 l of diethyl
pyrocarbonate-treated H
2
O and then used as a template for RT-PCR and RNA
electrophoresis.
Identification of armored L-RNA by RT-PCR. RT of the 3V armored L-RNA
was carried out by using the Overlap-A downstream primer; this primer corre-
sponds to nt 581 to 605 of the H5N1 gene. PCR was carried out with the primers
M300RT-S and HA300RT-A in order to amplify the full length of the 3V
L-RNA. RT-PCR was conducted in separate (two-step) reactions by using an
Eppendorf PCR system Autorisierter thermal cycler (Eppendorf). For the RT
step, each reaction mixture (20 l) contained 4 l of first-strand buffer (Invitro-
gen), 1 l of 10 mM deoxynucleoside triphosphates, 1 l of RNaseOUT, 1 lof
0.1 mM dithiothreitol, 1 l of reverse primer (Overlap-A), 1 l of SuperScript III
reverse transcriptase (Invitrogen), 5 l of RNA, and sterile distilled water to 20
l. The reaction mixture was incubated initially at 55°C for 50 min and then at
70°C for 15 min. An aliquot (5 l) of the resulting cDNA was amplified by PCR
using a 25-l mixture that contained 1 PCR buffer (Promega), 1.5 mM MgCl
2
,
300 M deoxynucleoside triphosphate, 1.5 M concentrations of each primer,
and 1.25 U of Taq DNA polymerase (Promega). After an initial incubation at
95°C for 3 min, 40 cycles of the following temperature conditions were used: 95°C
for 30 s, 56°C for 30 s, and 72°C for 140 s. A final extension at 72°C for 10 min
was performed. Several controls, including a negative control with no template,
a positive control with DNA from pACYC-3V, and a negative control with
supernatant of the virus-like particles without RT, were tested simultaneously.
PCR products (5 l) were analyzed by electrophoresis on agarose gels containing
ethidium bromide.
FIG. 1. Armored L-RNA packaging system. Two expressing vectors were constructed, in which the maturase and the coat protein were
expressed from one plasmid [pET-28(b)] and the pac site and the six-target chimeric RNA sequence were produced from the second plasmid
(pACYCDuet-1). The pac site was located between SARS3 and HCV. 3V armored L-RNA was produced by inducing and expressing the
two-plasmid system.
1736 WEI ET AL. J. C
LIN.MICROBIOL.
In order to increase the sensitivity of the RT-PCR, a second amplification was
performed in a 25-l reaction mixture containing 5 l of the amplification
product under the same PCR conditions.
The identity of the amplification products was confirmed by agarose gel elec-
trophoresis. The strands of full-length 3V PCR product were cloned into
pGEM-T Easy vectors (Promega), and then the recombinant AT clones were
sent to Beijing Sunbiotech Co. to be sequenced using T7 and SP6 primers. The
sequences obtained were compared to the target sequences.
In order to determine the nature of the RNA packaged into 3V armored RNA,
RT of the RNA was carried out with three downstream primers: Overlap-A,
HCV-LAP1, and A-SARS3. PCR was carried out with the primers S-SARS1 and
HA300RT-A in order to amplify the full length of the 3V RNA and with the
primer pairs S-SARS1 and HCV-LAP1, S-SARS1 and A-SARS3, and S-SARS1
and A-SARS2 to amplify the SARS-CoV1SARS-CoV2SARS-CoV3HCV
sequence, the SARS-CoV1SARS-CoV2SARS-CoV3 sequence, and the
SARS-CoV1SARS-CoV2 sequence, respectively.
Stability of 3V armored L-RNA. The armored L-RNA was examined for
stability in newborn calf serum. Initially, the purified 3V armored L-RNA prep-
aration was quantified, in duplicate, with an HCV RNA PCR fluorescence
quantitative diagnostic kit (Shanghai Kehua Bio-Engineering Co., Ltd.). The
quantified 3V armored L-RNA was serially diluted 10-fold with the newborn calf
serum to obtain 10,000 and 1,000,000 copies/ml. For each stability study, a single
batch was separated into aliquots in individual time point samples of 100 l. The
samples were then incubated at 4°C, 37°C, or room temperature. 3V armored
L-RNA plasma samples were removed at each time point and were stored at
80°C until completion of the experiment. All samples were quantified by using
an HCV RNA RT-PCR fluorescence quantitative diagnostic kit (Shanghai
Kehua) and LightCycler thermal cycler (Roche). The data were then analyzed by
using LightCycler software (Roche).
Calibration of the chimeric armored RNA against an international standard
for HCV RNA. Initially, the purified 3V armored L-RNA preparation was quan-
tified, in duplicate, using a HCV RNA PCR fluorescence quantitative diagnostic
kit (Shanghai Kehua). The quantified 3V armored L-RNA was diluted with
newborn calf serum, and 500-l aliquots were prepared by 10-fold serial dilution
to obtain samples containing 10
6
to 10
2
copies/ml.
In order to calibrate the chimeric armored RNA, the National Reference
material for HCV RNA (GBW09151, 2.26 10
3
IU ml
1
to 4.22 10
7
IU ml
1
)
was used; these RNA values were assigned using the WHO HCV International
Standard (NIBSC 96/790). This material is HCV gene type I. The reference
material was redissolved in 300 l of diethyl pyrocarbonate-H
2
O when used.
Three different commercially available reagent kits were used for the calibra-
tion. The HCV RNA PCR-fluorescence quantitative diagnostic kit (Shanghai
Kehua) was used for the HCV RNA tests, the SARS virus RNA PCR fluores-
cence quantitative diagnostic kit (Shenzhen PG Bio-Technology Co., Ltd.) was
used for the SARS-Cov2 RNA tests, and the AIV-H5 virus RNA PCR fluores-
cence quantitative diagnostic kit (Shenzhen PG) was used for the HA300 RNA
tests. The tests were carried out using a LightCycler thermal cycler (Roche).
First, we used an international standard to calibrate the chimeric armored RNA.
We isolated template RNA from the international standard and the diluted
chimeric armored RNA. Newborn calf serum was used as a negative control. All
RNA templates were assayed in a single run using the HCV RNA PCR fluores-
cence quantitative diagnostic kit. We then used the calibrated chimeric armored
RNA to prepare calibrators of the SARS-CoV2 and HA300 real-time RT-PCR
assays. Samples were assayed in three replicates in a 25-l final volume contain-
ing 12.5 l of extracted RNA and 12.5 l of the master mix supplied with the
respective kits. The thermal cycling conditions used for the three different kits
are given in Table 2.
RESULTS
Homogeneity of armored L-RNA. RNA was isolated from
purified armored L-RNA particles. The majority of the 3V
L-RNA packaged was approximately 2,200 bases in length, as
detected by ethidium bromide staining (Fig. 2).
Density gradient analysis of armored RNA and armored
L-RNA particles. Armored RNA and armored L-RNA parti-
cles form narrow bands at 1.37 and 1.36 g ml
1
, respectively,
when sedimented to their buoyant density in CsCl density
gradients. This compares favorably with the previously re-
ported value of 1.35 g ml
1
(15).
FIG. 2. Characterization of the recombinant RNA packaged in
armored L-RNA. Recombinant RNA was isolated from 3V armored
L-RNA, fractionated in a denaturing 3% agarose gel, stained with
ethidium bromide, and detected by using UV fluorescence. Abbrevi-
ations: M, RNA marker; 3V, 3V armored L-RNA recombinant RNA.
TABLE 2. Thermal cycle conditions for the three different kits
used in real-time RT-PCR assays
Program
No.
of
cycles
Temp
(°C)
Incubation
time
(min:s)
Temp
transition
rate
(°C/s)
Acquisition
mode
HCV
1 1 50 25:00 20 None
2 1 94 2:00 20 None
3 5 93 3:00 20 None
55 15:00 2 None
72 15:00 20 None
4 42 93 3:00 20 None
60 45:00 20 Single
5 1 40 30:00 20 None
H5N1
1 1 42 30:00 20 None
2 1 92 3:00 20 None
3 5 92 10:00 20 None
45 30:00 20 None
72 1:00 20 None
4 40 92 10:00 20 None
60 30:00 20 Single
5 1 40 0:00 20 None
SARS-Cov2
1 1 42 30:00 20 None
2 1 92 3:00 20 None
3 5 92 10:00 20 None
52 20:00 2 None
72 30:00 20 None
40 92 5:00 20 None
4 60 30:00 20 Single
5 1 40 10:00 20 None
V
OL. 46, 2008 LONG CHIMERIC RNA ARMORED L-RNA 1737
Cloning and sequencing of the RT-PCR products. The size
of the RT-PCR amplification products of the RNA extracted
from 3V armored L-RNA was full length (2,248 bp), whereas
the size of RNA extracted from 3V armored RNA was be-
tween 1,000 and 2,000 bp (Fig. 3). The sequencing result dem-
onstrated that the size was 1,200 bp.
Durability of armored L-RNA. The armored L-RNA was
completely resistant to DNase and RNase treatment under
conditions in which naked DNA and RNA are both degraded
rapidly (data not shown).
Armored L-RNA plasma stability. The 3V armored L-RNA
in newborn calf serum incubated at 4, 37, and 25°C was stable
over 2 months (Fig. 4).
Calibration of the chimeric armored RNA. In order to eval-
uate the 3V armored L-RNA as a calibrator for multiple virus
assays, we used the National Reference HCV RNA assigned
the HCV International Standard (NIBSC 96/790) to calibrate
the serially diluted chimeric armored L-RNA. The concentra-
tions of the chimeric armored L-RNA for the five samples (10
6
,
10
5
,10
4
,10
3
, and 10
2
) were 1.354 10
7
IU ml
1
, 5.740 10
5
IU ml
1
, 6.580 10
4
IU ml
1
, 5.428 10
3
IU ml
1
, and
9.613 10
2
IU ml
1
, respectively (Fig. 5).
DISCUSSION
The armored L-RNA (2,248 bp) expressed by our two-plas-
mid coexpression system differs in several respects from the
virus-like particles previously described by Pickett and Pea-
body (17). These authors also used a two-plasmid expression
system; their goal was to determine whether the 21-nt Opera-
tor (pac site) would confer MS2-specific packageability on non-
bacteriophage RNA in vivo. The E. coli was induced such that
the Operator-lacZ hybrid RNA was coexpressed with the MS2
coat protein. The specificity of the Pickett and Peabody bac-
teriophage packaging system, however, was poor since the host
E. coli RNA was packaged in preference to the Operator-lacZ
RNA. In other studies, Pickett and Peabody modified the
packaging of the Operator-lacZ RNA by changing the ratios of
coat protein to Operator-lacZ RNA produced in E. coli.By
increasing the concentration of the Operator-lacZ RNA and
decreasing the concentration of the coat protein, these re-
searchers were able to encapsulate mainly the Operator-lacZ
RNA. These results suggest that the original Pickett and Pea-
body packaging strategy lacked specificity because they were
unable to determine an appropriate ratio of coat protein to
Operator-lacZ RNA. Furthermore, the size of the lacZ RNA
FIG. 3. Ethidium bromide-stained 1% agarose gel of RT-PCR am-
plification products of RNA extracted from 3V armored L-RNA and
3V armored RNA. (A) RT-PCR amplification products of RNA ex-
tracted from 3V armored L-RNA. Lane 1, negative control with no
template; lanes 2 and 3, negative control without RT; lanes 4 and 5,
positive control of pACYC-3V plasmid; lanes 6 to 8, RT-PCR of 3V
full-length L-RNA. (B) RT-PCR amplification products of RNA ex-
tracted from 3V armored RNA: lane 1, positive control of pET-
MS2-3V plasmid using the primers S-SARS1 and HA300RT-A; lane 2,
RT-PCR of SARS-CoV1 plus SARS-CoV2 plus SARS-CoV3 plus
HCVHA300 using the primers S-SARS1 and HA300RT-A; lane 3,
positive control of pET-MS2-3V plasmid using the primers S-SARS1
and HCV-LAP1; lane 4, RT-PCR of SARS-CoV1 plus SARS-CoV2
plus SARS-CoV3 plus HCV using the primers S-SARS1 and HCV-
LAP1; lane 5, positive control of pET-MS2-3V plasmid using the
primers S-SARS1 and A-SARS3; lane 6, negative control without RT
using primers S-SARS1 and A-SARS3; lane 7, RT-PCR of SARS-
CoV1 plus SARS-CoV2 plus SARS-CoV3 using the primers S-SARS1
and A-SARS3; lane 8, RT-PCR of SARS-CoV1 plus SARS-CoV2
using the primers S-SARS1 and A-SARS2; lane 9, positive control of
pET-MS2-3V plasmid using the primers S-SARS1 and A-SARS2; lane
10, negative control without reverse transcription using the primers
S-SARS1 and A-SARS2.
FIG. 4. Stability study of 3V armored L-RNA. 3V armored L-RNA
was added to newborn calf serum to a final concentration of 10,000 and
10,000,000 copies/ml. Samples were incubated at 4°C, 37°C, or room
temperature for 0, 1, 2, 4, and 8 weeks. Samples were removed at each
time point and were stored at 80°C until the completion of the
experiment. From these materials, we isolated template RNA for real-
time RT-PCR assays. Water was used as a negative control. All RNA
templates were assayed in a single run by using an HCV RNA PCR
fluorescence quantitative diagnostic kit (Shanghai Kehua Bio-Engi-
neering Co., Ltd.). Real-time RT-PCR was conducted by using Light-
Cycler technology (Roche). The mean for low-copy samples was 67,226
IU/ml (4.83 log
10
; range, 50,100 to 79,400 IU/ml [range, 4.70 to 4.92
log
10
]), and the coefficient of variation was 12.9%. The mean for
high-copy samples was 29,060,000 IU/ml (7.45 log
10
; range, 22,900,000
to 41,700,000 IU/ml [range, 7.36 to 7.62 log
10
]), and the coefficient of
variation was 22%.
1738 WEI ET AL. J. C
LIN.MICROBIOL.
purified from these virus-like particles was approximately 500
bases as opposed to the expected full-length 3,000 bases. These
authors were, however, unable to determine whether the deg-
radation occurred before or after encapsulation. In their sec-
ond set of packaging studies, the RNA was not assessed for size
by gel electrophoresis. The MS2 bacteriophage sequence of the
RNA of Pickett and Peabody’s particles consisted only of the
coat protein sequence in one recombinant plasmid, which con-
trasts with the MS2 maturase and coat protein sequences used
in our method. The maturase protein is an important compo-
nent of armored RNA. Its presence in the virus-like particles is
required to preserve the integrity of the genomic RNA against
RNase digestion (1, 7). In addition, a potential binding site for
coat protein has been identified in the MS2 maturase sequence
on the basis of structural homology to the translational oper-
ator (18). The maturase protein interacts specifically with viral
RNA at two sites (23) and may therefore play a facilitating role
in packaging. Pasloske et al. (16) used a single plasmid expres-
sion system to produce armored RNA. The armored RNA
contained approximately 1.7 kb of bacteriophage RNA se-
quence encoding the maturase, the coat protein, and the pac
site. Since the MS2 bacteriophage RNA genome is approxi-
mately 3.6 kb, it is likely that the maximal size of target RNA
packaged will be approximately 2.0 kb in armored RNA; how-
ever, to date, there have been no reports of armored RNA of
more than 1,200 bp using the method proposed by Pasloske
et al.
In order to arrive at an appropriate ratio of coat protein to
the six-target chimeric sequence, we selected the pET28b and
pACYCDuet-1 plasmids as expression vectors. These two plas-
mids are members of different compatibility groups. Therefore,
they can be stably maintained together in the same bacterial
host. These plasmids contain the same T7 bacteriophage pro-
moter, and they are both low-copy plasmids, having almost
equivalent copy numbers. Given this equivalence, the ratio of
coat protein from pET28b to the six-target chimeric RNA
sequence from pACYCDuet-1 should be appropriate.
Compared to armored RNA of approximately 1,200 bp ob-
tained using the original armored technology, our work indi-
cates that long-fragment (2,248 bp) RNA sequences can be
encapsulated by using the two-plasmid coexpression method in
conjunction with the C-variant of the wild-type stem-loop. The
armored L-RNA particles have all of the characteristics of
armored RNA. The technology allows the user to precisely
define the control RNA’s sequence. The armored L-RNA
comprising a 2,248-nt foreign RNA sequence, which includes
three SARS-CoV fragments, one HCV fragment, and two
H5N1 fragments, can be used as a control or calibrator for
SARS-CoV, HCV, and H5N1 qualitative or quantitative de-
tection by RT-PCR. The inclusion of the HCV 5UTR made it
easy to assign an international (IU) value to the SARS-CoV
and H5N1 RNAs within the armored L-RNA and avoided
complex procedures involved in value assignment of calibra-
tors or standards in situations where their international stan-
dard (IS) are not available (20, 21). Moreover, the metrolog-
ical traceability of nucleic acid measurement of all RNA
viruses without IS could be solved by the same model as chi-
meric armored L-RNA.
From Fig. 5, it can be seen that the highest copy number of
chimeric armored L-RNA used was calibrated higher than ex-
pected and was not near a 1:1 correlation, a finding that might be
explained as follows. First, an error in the first step of dilution
could have occurred. Second, it was acceptable that the detection
deviation for the samples was in the range of the target value
0.27 log
10
(14).
In theory, the length of armored L-RNA expressed by the
two-plasmid system could be as much as approximately 3.6 kb
FIG. 5. Calibration of the real-time RT-PCR assay for HCV,
SARS-CoV2, and HA300 (H5N1). First, the quantified 3V armored
L-RNA was diluted with newborn calf serum 10-fold serially to obtain
100, 1,000, 10,000, 100,000, and 1,000,000 copies/ml. We used the
National Reference material for HCV RNA (GBW09151, 2.26 10
3
IU ml
1
to 4.22 10
7
IU ml
1
) to calibrate the serial dilutions of
chimeric armored L-RNA and then used the calibrated L-RNA to
prepare calibrators for the two real-time RT-PCR assays. From these
materials, we isolated RNA template for RT-PCR assays. Newborn
calf serum was used as a negative control. Real-time RT-PCR was
conducted on a LightCycler thermal cycler (Roche). (A) Log concen-
tration of the international standard for HCV RNA versus the cycle
number for the HCV RT-PCR; (B) amplification curve for the HCV
RT-PCR assay; (C) amplification curve for the SARS-CoV2 RT-PCR
assay; (D) amplification curve for the HA300 (H5N1) RT-PCR assay.
V
OL. 46, 2008 LONG CHIMERIC RNA ARMORED L-RNA 1739
since the MS2 bacteriophage RNA genome is 3,569 bp in
length. The results presented here indicate that at least a
2,248-bp armored L-RNA can be expressed with high effi-
ciency. We have also successfully expressed an approximate
2,700-bp chimeric armored RNA by the two-plasmid system
(data not shown), and the construction of an expression vector
for a chimeric armored L-RNA of more than 3,000 bp in length
is under way.
Because the pac site is a key point in the interaction between
the MS2 coat protein and exogenous RNA, it is believed that
the expression efficiency and package capacity could be further
enhanced if the number of pac sites were to be increased within
the chimeric RNA.
In conclusion, the results presented here demonstrate that
the two-plasmid expression system for armored L-RNA
(2,000 bp) is effective. The chimeric armored L-RNA, which
exhibits RNase resistance and stability properties similar to
armored RNA, can be used as a calibrator in SARS-CoV,
H5N1, and HCV RT-PCR assays.
ACKNOWLEDGMENTS
This study was supported in part by the SEPSDA project of the
European Commission (under no. Sp22-CT-2004-003831), the Na-
tional Natural Science Foundation of China (30371365 and 30571776),
and the Capital Medicine Development Foundation of Beijing (2002-
3041).
REFERENCES
1. Argetsinger, J., and G. Gussin. 1966. Intact ribonucleic acid from defective
particles of bacteriophage R17. J. Mol. Biol. 21:421–424.
2. Beld, M., R. Minnaar, J. Weel, C. Sol, M. Damen, H. van der Avoort, P.
Wertheim-van Dillen, A. van Breda, and R. Boom. 2004. Highly sensitive
assay for detection of enterovirus in clinical specimens by reverse transcrip-
tion-PCR with an armored RNA internal control. J. Clin. Microbiol. 42:
3059–3064.
3. Bressler, A. M., and F. S. Nolte. 2004. Preclinical evaluation of two real-time,
reverse transcription-PCR assays for detection of the severe acute respira-
tory syndrome coronavirus. J. Clin. Microbiol. 42:987–991.
4. Das, A., E. Spackman, D. Senne, J. Pedersen, and D. L. Suarez. 2006.
Development of an internal positive control for rapid diagnosis of avian
influenza virus infections by real-time reverse transcription-PCR with lyoph-
ilized reagents. J. Clin. Microbiol. 44:3065–3073.
5. Donia, D., M. Divizia, and A. Pana. 2005. Use of armored RNA as a standard
to construct a calibration curve for real-time RT-PCR. J. Virol. Methods
126:157–163.
6. Eisler, D. L., A. McNabb, D. R. Jorgensen, and J. L. Isaac-Renton. 2004. Use
of an internal positive control in a multiplex reverse transcription-PCR to
detect West Nile virus RNA in mosquito pools. J. Clin. Microbiol. 42:841–
843.
7. Heisenberg, M. 1966. Formation of defective bacteriophage particles by fr
amber mutants. J. Mol. Biol. 17:136–144.
8. Hietala, S. K., and B. M. Crossley. 2006. Armored RNA as virus surrogate
in a real-time reverse transcriptase PCR assay proficiency panel. J. Clin.
Microbiol. 44:67–70.
9. Horn, W. T., M. A. Convery, N. J. Stonehouse, C. J. Adams, L. Liljas, S. E.
Phillips, and P. G. Stockley. 2004. The crystal structure of a high affinity
RNA stem-loop complexed with the bacteriophage MS2 capsid: further
challenges in the modeling of ligand-RNA interactions. RNA 10:1776–1782.
10. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989.
Engineering hybrid genes without the use of restriction enzymes: gene splic-
ing by overlap extension. Gene 77:61–68.
11. Huang, Q., Y. Cheng, Q. Guo, and Q. Li. 2006. Preparation of a chimeric
Armored RNA as a versatile calibrator for multiple virus assays. Clin. Chem.
52:1446–1448.
12. Konnick, E. Q., S. M. Williams, E. R. Ashwood, and D. R. Hillyard. 2005.
Evaluation of the COBAS hepatitis C virus (HCV) TaqMan analyte-specific
reagent assay and comparison to the COBAS Amplicor HCV Monitor V2.0
and Versant HCV bDNA 3.0 assays. J. Clin. Microbiol. 43:2133–2140.
13. Lowary, P. T., and O. C. Uhlenbeck. 1987. An RNA mutation that increases
the affinity of an RNA-protein interaction. Nucleic Acids Res. 15:10483–
10493.
14. Oliver, A. R., S. F. Pereira, and D. A. Clark. 2007. Comparative evaluation
of the automated Roche TaqMan real-time quantitative human immunode-
ficiency virus type 1 RNA PCR assay and the Roche AMPLICOR version 1.5
conventional PCR assay. J. Clin. Microbiol. 45:3616–3619.
15. Pasloske, B. L., C. R. Walkerpeach, R. D. Obermoeller, M. Winkler, and
D. B. DuBois. 1998. Armored RNA technology for production of ribonucle-
ase-resistant viral RNA controls and standards. J. Clin. Microbiol. 36:3590–
3594.
16. Pasloske, B. L., D. DuBois, D. Brown, and M. Winkler. April 2001. Ribo-
nuclease-resistant RNA preparation and utilization. U.S. patent 6,214,982.
17. Pickett, G. G., and D. S. Peabody. 1993. Encapsidation of heterologous
RNAs by bacteriophage MS2 coat protein. Nucleic Acids Res. 21:4621–4626.
18. Romaniuk, P. J., P. Lowary, H. N. Wu, G. Stormo, and O. C. Uhlenbeck.
1987. RNA binding site of R17 coat protein. Biochemistry 26:1563–1568.
19. Rowsell, S., N. J. Stonehouse, M. A. Convery, C. J. Adams, A. D. Ellington,
I. Hirao, D. S. Peabody, P. G. Stockley, and S. E. Phillips. 1998. Crystal
structures of a series of RNA aptamers complexed to the same protein
target. Nat. Struct. Biol. 5:970–975.
20. Saldanha, J., and A. Heath. 2003. Collaborative study to calibrate hepatitis
C virus genotypes 2-6 against the HCV International Standard, 96/790 (ge-
notype 1). Vox Sang 84:20–27.
21. Saldanha, J., A. Heath, C. Aberham, J. Albrecht, G. Gentili, M. Gessner, and
G. Pisani. 2005. World Health Organization collaborative study to establish
a replacement WHO international standard for hepatitis C virus RNA nu-
cleic acid amplification technology assays. Vox Sang 88:202–204.
22. Scheuermann, R. H., and H. Echols. 1984. A separate editing exonuclease
for DNA replication: the epsilon subunit of Escherichia coli DNA polymer-
ase III holoenzyme. Proc. Natl. Acad. Sci. USA 81:7747–7751.
23. Shiba, T., and Y. Suzuki. 1981. Localization of A protein in the RNA-A
protein complex of RNA phage MS2. Biochim. Biophys. Acta 654:249–255.
24. Stockley, P. G., N. J. Stonehouse, C. Walton, D. A. Walters, G. Medina, J. M.
Macedo, H. R. Hill, S. T. Goodman, S. J. Talbot, and H. K. Tewary. 1993.
Molecular mechanism of RNA-phage morphogenesis. Biochem. Soc. Trans.
21:627–633.
25. Stockley, P. G., N. J. Stonehouse, and K. Valegard. 1994. Molecular mech-
anism of RNA phage morphogenesis. Int. J. Biochem. 26:1249–1260.
26. Talbot, S. J., S. Goodman, S. R. Bates, C. W. Fishwick, and P. G. Stockley.
1990. Use of synthetic oligoribonucleotides to probe RNA-protein interac-
tions in the MS2 translational operator complex. Nucleic Acids Res. 18:
3521–3528.
27. Valegard, K., J. B. Murray, N. J. Stonehouse, S. van den Worm, P. G.
Stockley, and L. Liljas. 1997. The three-dimensional structures of two com-
plexes between recombinant MS2 capsids and RNA operator fragments
reveal sequence-specific protein-RNA interactions. J. Mol. Biol. 270:724–
738.
28. WalkerPeach, C. R., M. Winkler, D. B. DuBois, and B. L. Pasloske. 1999.
Ribonuclease-resistant RNA controls (armored RNA) for reverse transcrip-
tion-PCR, branched DNA, and genotyping assays for hepatitis C virus. Clin.
Chem. 45:2079–2085.
29. Witherell, G. W., J. M. Gott, and O. C. Uhlenbeck. 1991. Specific interaction
between RNA phage coat proteins and RNA. Prog. Nucleic Acid Res. Mol.
Biol. 40:185–220.
1740 WEI ET AL. J. CLIN.MICROBIOL.
... We therefore needed to generate a standard for our assay. The standard MS2 pseudo phage virus has been employed previously to generate standard RNA for measuring hepatitis C virus (HCV) and human immunodeficiency virus (HIV) [7,30]. We first tried to insert the HBV pgRNA target sequence (as shown in Fig. 2C) into the armored phage MS2 to generate an HBV pgRNA standard. ...
... A standard reference pgRNA is required to make our assay more applicable for clinical research. Armored MS2 phage is often used as an artificial standard reference for detection of RNA viruses such as HCV and HIV [7,30]. However, we failed to generate an armored HBV pgRNA virus after several attempts. ...
Article
Full-text available
Current antiviral therapies against hepatitis B virus (HBV) infections, such as treatment with nucleos(t)ide analogs (NAs) and interferon alpha, can significantly lower HBV DNA titers, eventually to undetectable levels. However, it is still difficult to completely eliminate the stable template of HBV, the covalently closed circular DNA (cccDNA), and this contributes to viral rebound when treatment is discontinued. HBV pregenomic RNA (pgRNA), which was recently found to be present in the enveloped mature HBV viral particle in blood, is tentatively regarded, with still accumulating clinical evidence, as a novel bona fide virological marker reflecting the amount and status of cccDNA when serum HBV DNA becomes undetectable. HBV pgRNA and DNA share almost identical sequences, and it is therefore difficult to differentiate pgRNA from viral DNA using normal PCR methods. To exclude interference from viral DNA, methods for measuring pgRNA usually require a selective DNA degradation step, which is complicated and time-consuming and also compromises the accuracy of detection. In this study, we developed a simplified quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay with improved accuracy achieved by probing the polyA tail of pgRNA. Using clinical serum samples, we observed that not all patients share the same 3′ sequence, suggesting slight differences between HBV strains in the way they end transcription. We then designed and evaluated a universal primer and probe set for distinguishing HBV pgRNA from HBV DNA. Our results demonstrated that a one-step qRT-PCR assay could selectively amplify HBV pgRNA from a mixture of HBV RNA and DNA, which is valuable for clinical applications.
... technology could package >2 kb RNA sequence14 , the packaging capacity of MS2 is still not as good as lentivirus. Because of the limitation, N gene, E gene and nine parts of ORF1ab gene were inserted into the MS2 vector separately, and different MS2-based pseudoviruses were mixed together to form quality control materials. ...
Article
The ongoing pandemic of COVID-19 threats the whole world, which catalyzes a variety of SARS-CoV-2 nucleic acid test (NAT) kits. To monitor test quality and evaluate NAT kits, quality control materials that best simulate real clinical samples are needed in this study, the performance of SARS-CoV-2 cell culture supernatant, PCDH-based pseudovirus, and MS2-based pseudovirus as quality control materials was compared. As a result, PCDH-based pseudovirus was more similar in characteristics to SARS-CoV-2 particle, and was more suitable for evaluating SARS-CoV-2 NAT kits than MS2-based pseudovirus. Proper detection using sensitive and precise NAT kits is essential to guarantee diagnosis. Thus, limit of detection, precision, anti-inference ability and cross-reactivity of NAT kits from PerkinElmer, Wantai, Shanghai Kehua Bio-Engineering (KHB), Sansure, Da An, BioGerm, and Applied Biological Technologies (ABT) were compared using PCDH-based pseudovirus. For the seven kits evaluated, N gene was more sensitive than ORF1ab gene in most kits, while E gene was most sensitive among the three genes in KHB and ABT. PerkinElmer got the lowest LoD for N gene at 11.61 copies/mL, and 34.66 copies/mL for ORF1ab gene. All the kits showed good precision with CV values less than 5%, as well as acceptable anti-interference ability of 2 mg/L human genomic DNA. No cross-reactivity was observed with other respiratory viruses.
... The stability of AR prepared using the MS2 packaging system at − 20 °C or 4 °C in this study was slightly different from that published previously, and these ARs added to human plasma with sodium azide (Pasloske et al. 1998), bovine serum (Wei et al. 2008b), or Dulbecco's Modified Eagle Medium (DMEM; Sun et al. 2013) to simulate real clinical conditions. Plasma, bovine serum, and DMEM are rich in proteins, amino acid, lipids, and carbohydrates, which could sufficiently protect the MS2 protein coat and increase AR stability. ...
Article
Full-text available
Foodborne viruses are a global threat to food safety. Real-time reverse transcription polymerase chain reaction (RT-PCR) is the most commonly used method to detect viral RNA in food. Armored RNA (AR) prepared using the MS2 phage system is a successful positive control for detecting foodborne viruses and is an important quality control process when using real-time RT-PCR. In this study, we report a novel technology for preparing AR using bacteriophage Qβ and compare its stability with AR prepared using the MS2 phage system for packaging norovirus detection target RNA. AR could be successfully and efficiently produced using the developed bacteriophage Qβ system. Two types of AR–AR-QNoV prepared using the Qβ system and AR-MNoV prepared using the MS2 system—were stored at different temperatures for different durations. After incubating at − 20 °C for 360 days, the copy numbers of AR-QNoV and AR-MNoV decreased by 8.9% and 35.9%, respectively. After incubating at 4 °C for 60 days, the copy numbers of AR-QNoV and AR-MNoV decreased by 12.0% and 38.9%, respectively. After incubating at 45 °C, the copy numbers of AR-QNoV decreased by 71.8% after 5 days, whereas those of AR-MNoV decreased by 92.9% after only 4 days. After 5 days, AR-MNoV could not be detected using real-time RT-PCR. There was a significant difference in copy numbers decrease rate between AR-QNoV and AR-MNoV at three different temperatures (P < 0.05 ). Therefore, AR prepared using the new bacteriophage Qβ system is more stable than the traditional AR, making the developed strategy a good candidate for AR preparation and quality control.
... MS2 phage is a novel display and delivery platform for foreign peptide epitopes. MS2 phage belongs to the Leviviridae family with small positive-sense single-stranded RNA bacteriophages, which is encapsulated by an icosahedral capsid comprised of 180 copies of coat protein (CP) and a single copy of mature protein (AP) (Koning et al., 2016;Wei et al., 2008). The CP of MS2 phage can self-assemble to form virus-like particles (VLPs) in Escherichia Coli (E. ...
Article
Full-text available
Foot-and-mouth disease (FMD) is a highly contagious disease of cloven-hoofed animals that has caused tremendous economic losses worldwide. In this study, we designed a chimeric nanoparticles (CNPs) vaccine that displays the predominant epitope of the serotype O foot-and-mouth disease virus (FMDV) VP1 131-160 on the surface of MS2 phage. The recombinant protein was expressed in Escherichia Coli and can self-assemble into CNPs with diameter at 25–30 nm in vitro . A tandem repeat peptide epitopes (TRE) was prepared as control. Mice were immunized with CNPs, TRE and commercialized synthetic peptide vaccines (PepVac), respectively. The ELISA results showed that CNPs stimulated a little higher specific antibody levels to PepVac, but was significantly higher than the TRE groups. Moreover, the results from specific IFN-γ responses and lymphocyte proliferation test indicated that CNP immunized mice exhibited significantly enhanced cellular immune response compared to TRE. These results suggested that the CNPs constructed in current study could be a potential alternative vaccine in future FMDV control.
... Pseudoviral particles comprising a viral coat protein encapsulating a nucleic acid specific to a pathogen have been developed, being the first one a commercial initiative called "Armored RNA" based on MS2 coat protein (Pasloske et al. 1998). After that, several works reported the use of this kind of competitive control (WalkerPeach et al. 1999, Drosten et al. 2001, Beld et al. 2004, Cheng et al. 2006, Zhao et al. 2007, Wei et al. 2008, Meng et al. 2009, Felder & Wölfel 2014, Sharma et al. 2014. ...
Article
Full-text available
BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
... Recently, the creation of armored dsDNA using HBV and HPV particles was accomplished on the basis of previous work using MS2 VLPs [275] . Armored RNAs have multiple uses, such as for the detection of HCV, severe acute respiratory syndrome coronavirus, and influenza virus RNA [276] or for the creation of unique RNA molecules harboring both tRNA and mRNA functions [277] . Perspectives on the production and practical use of MS2 VLPs for routine diagnostics including food quality control were discussed in a recent review [278] . ...
Article
Full-text available
RNA phages are often used as prototypes for modern recombinant virus-like particle (VLP) technologies. Icosahedral RNA phage VLPs can be formed from coat proteins (CPs) and are efficiently produced in bacteria and yeast. Both genetic fusion and chemical coupling have been successfully used for the production of numerous chimeras based on RNA phage VLPs. In this review, we describe advances in RNA phage VLP technology along with the history of the Leviviridae family, including its taxonomical organization, genomic structure, and important role in the development of molecular biology. Comparative 3D structures of different RNA phage VLPs are used to explain the level of VLP tolerance to foreign elements displayed on VLP surfaces. We also summarize data that demonstrate the ability of CPs to tolerate different organic (peptides, oligonucleotides, and carbohydrates) and inorganic (metal ions) compounds either chemically coupled or noncovalently added to the outer and/or inner surfaces of VLPs. Finally, we present lists of nanotechnological RNA phage VLP applications, such as experimental vaccines constructed by genetic fusion and chemical coupling methodologies, nanocontainers for targeted drug delivery, and bioimaging tools.
Article
Full-text available
Translation of the highly promising electrogenerated chemiluminescence (ECL) properties of Ir(III) complexes (with tri-n-propylamine (TPrA) as a co-reactant) into a new generation of ECL labels for bioassay necessitates the introduction of functionality suitable for bioconjugation. Modification of the ligands, however, can affect not only the photophysical and electrochemical properties of the complex, but also the reaction pathways available to generate light. Through a combined theoretical and experimental study, we reveal the limitations of conventional approaches to the design of electrochemiluminophores and introduce a new class of ECL label, [Ir(C^N)2(pt-TOxT-Sq)]⁺ (where C^N is a range of possible cyclometalating ligands, and pt-TOxT-Sq is a pyridyltriazole ligand with trioxatridecane chain and squarate amide ethyl ester), which outperformed commercial Ir(III) complex labels in two commonly used assay formats. Predicted limits on the redox potentials and emission wavelengths of Ir(III) complexes capable of generating ECL via the dominant pathway applicable in microbead supported ECL assays were experimentally verified by measuring the ECL intensities of the parent luminophores at different applied potentials, and comparing the ECL responses for the corresponding labels under assay conditions. This study provides a framework to tailor ECL labels for specific assay conditions and a fundamental understanding of the ECL pathways that will underpin exploration of new luminophores and co-reactants.
Article
Hepatitis C virus (HCV) is a major threat to public health being leading cause of chronic liver disease with 92 to 149 million people affected worldwide. A rapid and accurate diagnosis is a key to prevent viral transmission and management of disease progression. Here we describe a hand-held device for rapid detection of HCV infection called as STALLION (Single Tube Analysis using LAMP, LED and ION-sensing). A custom detection probe was designed to dip into a PCR tube. The probe comprises an ion sensitive field effect transistor (ISFET), a micro-capillary based Ag/AgCl reference electrode and a temperature sensor. In-vitro replication of HCV genomic RNA was performed by reverse transcription loop-mediated isothermal amplification (RT-LAMP) and detected in real-time by ISFET bio-sensing of released H+ ions. Incubation at 60°C was provided by a novel low-cost concept based on heat dissipated from power LED(s). With this system, the HCV positive samples with 10¹, 10², 10³ copies/ml were detected in as less as 30, 18 and 13 minutes respectively compared to no-template control (NTC). The detection limit was comparable to available methods such as nested PCR. No significant false positive signal was observed for HCV negative samples. The results can be viewed on accompanying LCD screen or alternatively can be transferred to computer or smart phone. The STALLION system provides analysis in conventional PCR tube format avoiding any complex fluidics or instrumentation requirements. Such a system will be particularly useful for rapid and reliable clinical diagnosis of HCV RNA by users with no prior expertise and provide the basis for point-of-care (POC) testing in limited resource settings especially for developing countries.
Article
Full-text available
Bacteriophage GA coat protein formed self-assembly competent virus-like particles (VLPs) have been expressed previously in bacterial and yeast cells. On the basis of our previous experiments on the yeast vector pESC-URA / S. cerevisiae system containing two oppositely oriented promoters, new constructions were created with point-mutations in coat protein to mimic phage MS2-like RNA binding characteristics. Simultaneously, the MS2 operator sequence was added to mRNA desired for packaging. After the introduction of single-point mutations (S87N, K55N, R43K) and double-point mutations (S87N + K55N and S87N + R43K), the coat protein’s ability to form VLPs was retained, but yield from cells was decreased. Exchange of the 87th Ser to Asn in coat protein sequence in combination with bacteriophage MS2 translational operator provided specific packaging of the gene of interest (GFP). Although non-specific nucleic acid sequences were packaged, the remarkable specificity for packaging of the gene of interest can be achieved using the described approach.
Article
Full-text available
The detection and quantification of enteric RNA viruses is based on isolation of viral RNA from the sample followed by quantitative reverse transcription polymerase chain reaction (RT-qPCR). To control the whole process of analysis and in order to guarantee the validity and reliability of results, process control viruses (PCV) are used. The present article describes the process of preparation and use of such PCV– MS2 phage-like particles (MS2 PLP) – in RT-qPCR detection and quantification of enteric RNA viruses. The MS2 PLP were derived from bacteriophage MS2 carrying a unique and specific de novo-constructed RNA target sequence originating from the DNA of two extinct species. The amount of prepared MS2 particles was quantified using four independent methods – UV spectrophotometry, fluorimetry, transmission electron microscopy and a specifically developed duplex RT-qPCR. To evaluate the usefulness of MS2 PLP in routine diagnostics different matrices known to harbor enteric RNA viruses (swab samples, liver tissue, serum, feces, and vegetables) were artificially contaminated with specific amounts of MS2 PLP. The extraction efficiencies were calculated for each individual matrix. The prepared particles fulfill all requirements for PCV – they are very stable, non-infectious, and are genetically distinct from the target RNA viruses. Due to these properties they represent a good morphological and physiochemical model. The use of MS2 PLP as a PCV in detection and quantification of enteric RNA viruses was evaluated in different types of matrices.
Article
Full-text available
Synthetic oligoribonucleotides have been used to probe the interaction of MS2 coat protein with the translational operator of the MS2 replicase gene. We have investigated the possible formation of a transient covalent bond between the single-stranded uridine residue, at position −5, and a cysteine side-chain on the coat protein, by the incorporation of a chemically modified residue (5-BrU) at this position. This chemically synthesised operator variant has a binding constant of between 10 and 50 times greater than that of the wild type and is therefore comparable with the tight binding variant having a cytidine substituted at the −5 position. Dissociation kinetics show that the complex with the 5-BrU operator is more stable than the −5C variant; a result which is consistent with the formation of a Michael adduct at the −5 position. In addition, a number of other chemical variants of the operator have been analysed. These include operators incorporating deoxyadenine residues at each of the important single-stranded adenine sites. Recently the Michael adduct proposal has been challenged on the basis of mutagenesis of the coat protein cysteine residues (1). These results are discussed in the light of our data in support of Michael adduct formation.
Article
Full-text available
The specific interaction between R17 coat protein and its target of translational repression at the initiation site of the R17 replicase gene was studied by synthesizing variants of the RNA binding site and measuring their affinity to the coat protein by using a nitrocellulose filter binding assay. Substitution of two of the seven single-stranded residues by other nucleotides greatly reduced the Ka, indicating that they are essential for the RNA-protein interaction. In contrast, three other single-stranded residues can be substituted without altering the Ka. When several of the base-paired residues in the binding site are altered in such a way that pairing is maintained, little change in Ka is observed. However, when the base pairs are disrupted, coat protein does not bind. These data suggest that while the hairpin loop structure is essential for protein binding, the base-paired residues do not contact the protein directly. On the basis of these and previous data, a model for the structural requirements of the R17 coat protein binding site is proposed. The model was successfully tested by demonstrating that oligomers with sequences quite different from the replicase initiator were able to bind coat protein.
Article
We have determined the crystal structures, at 2.8 A resolution, of two different RNA aptamers, each bound to MS2 coat protein. One of the aptamers contains a non-Watson-Crick base pair, while the other is missing one of the unpaired adenines that make sequence-specific contacts in the wild-type complex. Despite these differences, the RNA aptamers bind in the same location on the protein as the wild-type translational operator. Comparison of these new structures with other MS2-RNA complexes allows us to refine further the definition of the minimal recognition elements and suggests a possible application of the MS2 system for routine structure determination of small nucleic acid motifs.
Article
The growth of one group of amber mutants of R17 (class A) in non-permissive hosts results in a burst of bacteriophage-like particles, which are defective in that they are non-infectious. Here studies of particles produced by the growth of wild-type R17 and four class A mutants on AB301, a non-permissive Hfr Escherichia coli strain, and on RNase(-)10, an RNase I-deficient derivative of AB301, are described. Defective particles grown on AB301 contain degraded, non-infectious RNA and are on the average less dense than wild-type phage; particles grown on RNase(-)10 contain intact, infectious RNA and exhibit normal density in cesium chloride gradients, but are nonetheless non-infectious as phage. In addition, the RNA in purified defective particles grown on RNase(-)10 is partially susceptible to nuclease attack, whereas RNA in wild-type phage is not. The studies demonstrate that the presence of degraded RNA in defective particles of R17 results from the action of RNase I during the purification of the particles. The possible function of the A protein of R17 is considered in the light of the results obtained.
Article
This chapter describes the biochemistry of the interaction of phage coat protein with RNA and attempt to provide a molecular understanding of its high specificity. Coat protein binding is believed to serve two functions in the life cycle of the phage: 1) it acts as a translational repressor of the replicase gene early in infection, and 2) as an initiation site of phage assembly late in infection. This interaction has been extensively a prototype of sequence specific RNA-protein interactions. It is now clear that the phage coat proteins can be considered an example of a class of RNA hairpin binding proteins that are quite common in prokaryotes and eukaryotes. In case of bacteriophage coat protein, the coat protein assembles into phage-like capsids that can be purified by differential centrifugation and ion-exchange chromatography. Most coat proteins can be successfully renatured by the transfer from storage buffer directly into a variety of neutral buffers of moderate ionic strength. In many cases, these renatured proteins are fully active in both RNA binding and capsid assembly.
Article
Gene splicing by overlap extension is a new approach for recombining DNA molecules at precise junctions irrespective of nucleotide sequences at the recombination site and without the use of restriction endonucleases or ligase. Fragments from the genes that are to be recombined are generated in separate polymerase chain reactions (PCRs). The primers are designed so that the ends of the products contain complementary sequences. When these PCR products are mixed, denatured, and reannealed, the strands having the matching sequences at their 3' ends overlap and act as primers for each other. Extension of this overlap by DNA polymerase produces a molecule in which the original sequences are 'spliced' together. This technique is used to construct a gene encoding a mosaic fusion protein comprised of parts of two different class-I major histocompatibility genes. This simple and widely applicable approach has significant advantages over standard recombinant DNA techniques.
Article
The introduction of a cytidine in place of one of the two single stranded uridines in the R17 replicase translational operator results in a much tighter binding to R17 coat protein. The complex containing the variant RNA is stable to gel electrophoresis and has a binding constant about 50 times greater than the one with wild type RNA. The nearly thirty percent increase in the free energy of binding for the variant RNA is primarily due to a more favorable enthalpy of interaction. A possible explanation for this surprising result is that the U to C change leads to a greater extent of formation of a transient covalent complex between the protein and the RNA.
Article
The object of the present work was to study the events which take place after infection of the non-permissive host with the fr amber mutant sum. In this host, defective particles are formed which have a lower buoyant density than fr bacteriophage and which contain only 70% of the normal amount of RNA. This RNA consists of several pieces. The protein coat of these “light, defective particles”, as examined by electron microscopy, appears to be the same as that of fr phages. The end group amino-acid analysis further suggests that the amber mutation does not affect the coat protein. The RNA in the light defective particles is not infectious; nevertheless the mutant sum initiates the synthesis of infectious RNA in normal amounts. If a bacterial strain which is deficient in cell-wall ribonuclease is used as a non-permissive host, so-called “heavy, defective particles” are obtained. Their buoyant density is the same as that of fr phages, but their sedimentation coefficient is 69 s instead of 79 s. On treatment with ribonuclease, the buoyant density of these particles is decreased to that of light, defective particles. From this the conclusion is drawn that in the non-permissive host the assembly of normal RNA and normal coat protein into nucleoprotein particles is a defective process which does not produce viable fr phages. A phage-specific protein factor is assumed to be essential for establishing or stabilizing the conformation of the RNA.