In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses

Article (PDF Available)inJournal of Virology 82(12):5887-911 · July 2008with54 Reads
DOI: 10.1128/JVI.00254-08 · Source: PubMed
Abstract
Adeno-associated virus (AAV) serotypes differ broadly in transduction efficacies and tissue tropisms and thus hold enormous potential as vectors for human gene therapy. In reality, however, their use in patients is restricted by prevalent anti-AAV immunity or by their inadequate performance in specific targets, exemplified by the AAV type 2 (AAV-2) prototype in the liver. Here, we attempted to merge desirable qualities of multiple natural AAV isolates by an adapted DNA family shuffling technology to create a complex library of hybrid capsids from eight different wild-type viruses. Selection on primary or transformed human hepatocytes yielded pools of hybrids from five of the starting serotypes: 2, 4, 5, 8, and 9. More stringent selection with pooled human antisera (intravenous immunoglobulin [IVIG]) then led to the selection of a single type 2/type 8/type 9 chimera, AAV-DJ, distinguished from its closest natural relative (AAV-2) by 60 capsid amino acids. Recombinant AAV-DJ vectors outperformed eight standard AAV serotypes in culture and greatly surpassed AAV-2 in livers of naïve and IVIG-immunized mice. A heparin binding domain in AAV-DJ was found to limit biodistribution to the liver (and a few other tissues) and to affect vector dose response and antibody neutralization. Moreover, we report the first successful in vivo biopanning of AAV capsids by using a new AAV-DJ-derived viral peptide display library. Two peptides enriched after serial passaging in mouse lungs mediated the retargeting of AAV-DJ vectors to distinct alveolar cells. Our study validates DNA family shuffling and viral peptide display as two powerful and compatible approaches to the molecular evolution of novel AAV vectors for human gene therapy applications.
JOURNAL OF VIROLOGY, June 2008, p. 5887–5911 Vol. 82, No. 12
0022-538X/08/$08.000 doi:10.1128/JVI.00254-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies
Interbreeding and Retargeting of Adeno-Associated Viruses
Dirk Grimm,
1
Joyce S. Lee,
1
Lora Wang,
1
Tushar Desai,
2
Bassel Akache,
1
Theresa A. Storm,
1
and Mark A. Kay
1
*
Departments of Pediatrics and Genetics, 300 Pasteur Drive,
1
and Department of Biochemistry, 279 Campus Drive,
2
School of Medicine, Stanford University, Stanford, California 94305
Received 4 February 2008/Accepted 2 April 2008
Adeno-associated virus (AAV) serotypes differ broadly in transduction efficacies and tissue tropisms and
thus hold enormous potential as vectors for human gene therapy. In reality, however, their use in patients is
restricted by prevalent anti-AAV immunity or by their inadequate performance in specific targets, exemplified
by the AAV type 2 (AAV-2) prototype in the liver. Here, we attempted to merge desirable qualities of multiple
natural AAV isolates by an adapted DNA family shuffling technology to create a complex library of hybrid
capsids from eight different wild-type viruses. Selection on primary or transformed human hepatocytes yielded
pools of hybrids from five of the starting serotypes: 2, 4, 5, 8, and 9. More stringent selection with pooled human
antisera (intravenous immunoglobulin [IVIG]) then led to the selection of a single type 2/type 8/type 9 chimera,
AAV-DJ, distinguished from its closest natural relative (AAV-2) by 60 capsid amino acids. Recombinant
AAV-DJ vectors outperformed eight standard AAV serotypes in culture and greatly surpassed AAV-2 in livers
of naı¨ve and IVIG-immunized mice. A heparin binding domain in AAV-DJ was found to limit biodistribution
to the liver (and a few other tissues) and to affect vector dose response and antibody neutralization. Moreover,
we report the first successful in vivo biopanning of AAV capsids by using a new AAV-DJ-derived viral peptide
display library. Two peptides enriched after serial passaging in mouse lungs mediated the retargeting of
AAV-DJ vectors to distinct alveolar cells. Our study validates DNA family shuffling and viral peptide display
as two powerful and compatible approaches to the molecular evolution of novel AAV vectors for human gene
therapy applications.
A large number of inherited or acquired diseases remain
promising targets for human gene therapy. One vector that has
shown outstanding potential thus far in numerous preclinical
and clinical evaluations is based on nonpathogenic adeno-as-
sociated virus (AAV). A unique asset among various proper-
ties that make AAV especially attractive over its competitors,
such as adenoviral or lentiviral vectors, is the availability of a
vast number of natural isolates which differ significantly in
their properties (24). We and others have shown previously
that the function of an AAV vector particle is determined
mainly by the capsid protein and that viral Rep proteins and
genomic packaging elements are largely interchangeable (24,
27, 85). Paradoxically, the ever-increasing repertoire of natu-
rally occurring and synthetically generated AAV capsid se-
quences (300 to date) is currently creating a dilemma for the
rational selection of the optimal serotype for a given applica-
tion. The importance of finding the ideal capsid for efficient
and safe gene transfer has been exemplified in many preclinical
studies, as well as in a clinical trial using the AAV type 2
(AAV-2) prototype in human liver tissue (36, 47). In one
previous study, the treatment of patients with severe hemo-
philia B with recombinant AAV-2 expressing human factor IX
(hFIX) resulted in mildly elevated, yet therapeutic, levels of
this blood coagulation factor. However, expression was short
lived, and the hFIX decline was accompanied by a transient
asymptomatic increase of liver transaminases, due to a T-cell
immune response against the AAV-2 capsid (47). Also, preex-
isting neutralizing anti-AAV-2 antibodies (frequent in hu-
mans) in these individuals likely inhibited the linear vector
dose response previously observed in animals.
We and others have suggested previously that the use of
novel AAV serotypes, in particular, nonhuman isolates, will
help to overcome some of these problems (19, 24, 63). Impor-
tant examples are AAV-8 and AAV-9, which can transduce
mouse liver far better than AAV-2, albeit the difference in
dogs or primates is less clear (17, 52, 54, 75). The potential for
the complete transduction of liver tissue and perhaps other
tissues makes these two non-AAV-2 serotypes also particularly
interesting for therapeutic RNA interference (RNAi) (28). We
recently demonstrated the feasibility of efficiently and persis-
tently suppressing hepatitis B virus with RNAi from a double-
stranded AAV-8 vector (28). On the other hand, a potential
drawback of AAV-8 and AAV-9 is their lack of specific tissue
tropism (34, 52). The resulting frequent vector dissemination
into all organs, including the brain, even from low peripheral
doses in mice or monkeys (52, 54) is a particular concern for
RNAi therapies in which control over vector biodistribution
and the limitation of off-target effects will be imperative for the
success of the approach (28).
In order to overcome the constraints of wild-type AAV
* Corresponding author. Mailing address: Departments of Pediat-
rics and Genetics, School of Medicine, Stanford University, 300 Pas-
teur Dr., Stanford, CA 94305. Phone: (650) 498-6531. Fax: (650) 498-
6540. E-mail: markay@stanford.edu.
† Supplemental material for this article may be found at http://jvi
.asm.org/.
‡ Present address: University of Heidelberg, Cluster of Excellence
CellNetworks, BIOQUANT, Im Neuenheimer Feld 267, D-69120 Hei-
delberg, Germany.
Published ahead of print on 9 April 2008.
5887
serotypes, numerous groups have recently begun to develop
novel strategies to engineer “designer” AAVs tailored for the
therapeutic transduction of clinically relevant organs (reviewed
in detail in references 9, 12, 35, 41, 51, and 85). Briefly, the
variety of strategies can be grouped into indirect or chemical
approaches and direct physical modification strategies. In the
indirect approaches, specific molecules (e.g., bispecific anti-
bodies [6] or avidin-coupled ligands [4]) are allowed to react
with the viral surface (biotinylated in the case of avidin [4]), as
well as a cellular receptor, forming a conjugate ideally able to
retarget the capsid to a refractory cell type. Yet, numerous
pharmacological problems, such as concerns about in vivo
complex stability and difficulties in upscaling complex manu-
facturing, continue to prevent the broad adaptation of these
approaches. Alternative, more powerful strategies rely on the
direct physical modification of the AAV capsid protein and
gene. Early examples include the generation of mosaic AAV
capsids via the mixing of helper plasmids carrying capsid genes
from distinct serotypes, such as AAV-1 and AAV-2 (30) and
pairwise combinations of AAV-1 through AAV-5 (62). Similar
mosaics were generated previously via a marker rescue ap-
proach, yielding AAV-2/AAV-3 recombinants with unique
properties (8). A related strategy is the rational creation of
chimeric virions via domain swapping among multiple parental
serotypes, involving either entire capsid loops or parts thereof
or individual residues. Notable examples include AAV-1/
AAV-2 chimeras with improved tropism in muscle tissue (31),
with one of these chimeras presently being studied in a phase
I clinical trial for the treatment of Duchenne muscular dystro-
phy (85). Most recently, our own group described a battery of
unique chimeras comprising elements from serotypes 2 and 8,
which were exploited to identify capsid subdomains responsible
for efficient AAV transduction in murine liver tissue in vivo (64).
A special type of chimeric capsids are those containing for-
eign proteins or peptides inserted into various positions of the
virion shell. The methods and strategies used are widely di-
verse, and again, we refer to comprehensive reviews (12, 35,
41). Noteworthy here are approaches to fuse targeting ligands
to the N termini of AAV capsid proteins (ideally, VP2 [45,
83]), or more powerful, to insert short peptides (up to 14
amino acids [21], typically 7) into exposed regions of the as-
sembled virion. This strategy is referred to as viral display, in
analogy to phage display, and has already been used exten-
sively to retarget AAV-2 virions to a multitude of refractory or
hard-to-infect cell types, such as vascular endothelial, smooth
muscle, and pancreatic islet cells (43, 55, 77, 81, 82) and vari-
ous tumor lines (22, 58, 65, 66). It has particularly benefited
from comprehensive mutational analyses by various groups
(e.g., references 21, 33, 56, and 83) that have resulted in the
identification of prominent locations within the AAV-2 capsid
tolerating peptide insertion. Most notable is the heparin bind-
ing domain (HBD), consisting of a total of four arginine (R)
residues and one lysine residue, with R585 and R588 repre-
senting the most crucial components (37, 56). Numerous
groups have now consistently shown that the insertion of 7-mer
peptides into this region not only is frequently well tolerated
and efficiently mediates virus retargeting, but also provides the
extra benefit that the endogenous AAV-2 tropism can be abol-
ished, thus enhancing target specificity (e.g., reference 21).
In addition to identifying sites for vector engineering, some
of the mutational AAV studies directly yielded novel capsid
variants with potential benefits for clinical use. A remarkable
case was a recent study by Lochrie et al. (42) in which a set of
127 AAV-2 variants with point or insertion mutations were
generated and screened for multiple properties. Several cap-
sids were isolated which differed from the wild-type AAV-2
capsid in having better in vitro transduction efficiencies (albeit
being equally efficient in vivo) or, clinically most relevant, high-
er-level resistance to individual or pooled human antisera.
Nonetheless, the limitations of the approach also became
clear, most notably, the extreme effort required to generate
and manually screen a large number of mutants, which in fact
prevented the interesting analyses of all possible combinations
of beneficial point mutations in further capsids.
Indeed, the factors of time and labor are the main reasons
why an increasing number of groups have recently begun to
develop novel means for AAV vector evolution that no longer
rely on the rational modification of the AAV-2 capsid. Instead,
the new combinatorial methodologies allow for the far more
efficient creation and selection of interesting candidates in a
library-based high-throughput format. Thus far, two different
strategies have been reported, both principally expanding on
previously developed techniques. One is the use of viral display
libraries, in which random 7-mer peptides are inserted into the
AAV-2 HBD (at amino acid 587 or 588), yielding between 4
10
6
and 1.7 10
8
capsids potentially exposing new ligands on
their surfaces (50, 58, 76). Subsequent iterative selection on
diverse cell types refractory to the wild type, e.g., coronary
artery endothelial cells, cardiomyoblasts, and carcinoma, leu-
kemia, and megakaryocytic cell lines, led to enrichment with
peptide mutants with increased target specificities and effica-
cies (48, 50, 58, 76). The second library type, independently
described by two groups in 2006, relies on error-prone PCR
amplification of the AAV-2 capsid gene (46, 59). Similar to the
methods in earlier mutational studies, this approach resulted
in the identification of AAV-2 point mutations (usually up to
two per capsid) which yielded mutants that differed from the
wild type in having mildly enhanced efficacies in vitro and/or
improved transduction efficiencies in the presence of neutral-
izing anti-AAV-2 antibodies either generated in rabbits or
preexisting in individual human sera.
Here, for the first time, we introduce the technology of DNA
family shuffling into the realm of AAV vector evolution. The
basic concept of this technology is the in vitro recombination of
related parental genes with 50% homology, which are first
fragmented and then reassembled based on partial homology,
resulting in libraries of chimeric genes. Iterative amplification
under pressure can then yield hybrids not only combining pa-
rental assets, but also ideally exhibiting novel and synergistic
properties (70, 71). DNA family shuffling has been used exten-
sively in recent years to evolve and improve all types of pro-
teins, from markers and enzymes to vaccines (e.g., references
10, 13–15, and 39). Importantly, a set of reports also suggested
its power to enhance viral gene therapy vectors by creating
retro- or lentiviruses with improved stability or efficacy com-
pared to that of the parental wild types (57, 61, 69). Here, we
describe the novel use of DNA family shuffling for the highly
efficient molecular interbreeding of eight multispecies AAVs
to create chimeric capsids and, moreover, document its com-
5888 GRIMM ET AL. J. VIROL.
patibility and synergism with existing AAV vector evolution
technology.
MATERIALS AND METHODS
Plasmids for generation of shuffled AAV capsid library. Plasmids containing
full-length capsid genes (cap) of seven different AAV serotypes were present in
the lab (for AAV-2, AAV-4, and AAV-5) or kindly provided by James Wilson
(for AAV-8 and AAV-9) or Jay Chiorini and Rob Kotin (for avian and bovine
AAV). Goat AAV was not available as a molecular clone early in our study and
was therefore partly synthesized (GeneArt, Regensburg, Germany) as an 888-
nucleotide (nt) fragment (nt 1023 to 1910). This subclone corresponds to the
entire right half of the goat AAV capsid protein, which comprises all 42 reported
(3) differences between goat AAV and AAV-5. The other seven cap genes were
initially amplified via PCR and subcloned into pBluescript II SK (Stratagene).
The purpose was to flank all cap genes with sites for the unique restriction
enzyme PacI (5) or AscI (3) to facilitate the later cloning of shuffled cap genes
into a wild-type AAV plasmid (see below). All primers also contained either a
HindIII (5) or a SpeI (3) site to allow directed cloning into pBluescript (none
of the four restriction enzymes cut in any parental cap gene). A 20-nt signature
region was inserted between the two restriction sites in each primer to provide
conserved primer binding sites for the later PCR amplification of shuffled genes.
The resulting sequence of the forward primer was 5 GGACTC AAGCTT GTC
TGAGTGACTAGCATTCG TTAATTAA CAGGT ATG N
22
3 (the HindIII site
is in bold, the PacI site is in bold italics, the signature region is underlined, and
N
22
denotes the first 22 nt of each cap gene following the ATG start codon).
Likewise, the reverse primer was 5 CGTGAG ACTAGT GCTTACTGAAGCT
CACTGAG GGCGCGCC TTA N
22
3 (the SpeI site is in bold, the AcsI site is in
bold italics, the signature region is underlined, and N
22
denotes the last 22 nt of
each cap gene up to the TAA stop codon).
In parallel, a wild-type cap recipient plasmid was engineered to contain the
AAV-2 packaging elements (inverted terminal repeats [ITRs]) flanking the
AAV-2 rep gene (encoding AAV replication proteins), together with PacI and
AscI sites for cap cloning and the AAV-2 polyadenylation site. Therefore,
AAV-2 rep (nt 191 to 2189) was PCR amplified using primers containing BglII
sites and then subcloned into pTRUF3 (carrying AAV-2 ITRs with adjacent
BglII sites) (88). The forward primer used was 5 CGAACC AGATCT GTCCT
GTATTAGAGGTCACGTGAG 3 (the BglII site is in bold, and AAV-2 nt 191
is underlined), and the reverse primer was 5 GGTAGC AGATCT GTTCGAC
CGCAGCCTTTCGAATGTCCGG TTTATT GATTA GGCGCGCC CTGG
ACTC TTAATTAA CATTTATTGTTCAAAGATGC 3 (the BglII site is in bold,
the polyadenylation signal is underlined, the AscI site is in bold italics, the PacI
site is underlined and shown in bold italics, and the AAV-2 rep stop codon is
underlined and shown in italics). Note that this procedure changed the AAV-2
SwaI site (downstream of the rep stop codon) into a PacI site.
DNA family shuffling of AAV capsid genes. For DNA family shuffling, we
basically utilized a two-step protocol in which the parental genes were first
fragmented using DNase I enzyme and then reassembled into a full-length gene
via primerless PCR (69, 71). This PCR was followed by a second PCR including
primers binding outside of the cap genes, allowing the subcloning of the products
into the wild-type recipient ITR-rep plasmid (see above and Fig. 1B). Initially, we
isolated all cap genes from our subclones via HindIII/SpeI digestion (EcoRI
digestion for goat AAV) and then optimized the reaction conditions as follows.
We tested various DNase I concentrations and incubation times, aiming to
obtain a pool of fragments between 0.2 and 1.0 kb in size (which gave the best
results in later steps). The optimal conditions were found to be 1 g of each cap
gene, 1 l of 1:200-prediluted DNase I (10 U/l; Roche), 50 mM Tris-Cl (pH
7.4), and 1 mM MgCl
2
in a total volume of 50 l. The reaction mixture was
incubated for 2 min at room temperature, and then the reaction was stopped by
heat inactivation at 75°C for 10 min. Fragments of the desired sizes were isolated
by running the entire reaction mixture on a 1% agarose gel (total final mixture
volume, 60 l). We next optimized the reassembly PCR by testing various
DNA polymerases (Platinum Pfx [Invitrogen], DeepVent [NEB], and Taq [Amer-
sham]) and respective conditions. Best results were obtained using PuReTaq
ready-to-go PCR beads (Amersham) and the following conditions: 25 lof
purified cap fragments and a program of 4 min at 95°C; 40 cycles of 1 min at 95°C,
1 min at 50°C, and 3 min at 72°C; 10 min at 72°C; and 10 min at 4°C. Agarose gel
(1%) analysis of 1 l from this reaction mixture typically showed a smear in the
area up to the 5-kb marker and no distinct bands. The same three polymerases
listed above were then evaluated for the primer-containing second PCR mixture,
and the following conditions were found to be optimal: 1 l of Platinum Pfx, 2
l of the product from the first PCR, 1 mM MgSO
4
,1g of each primer (see
below), and 0.3 mM (each) deoxynucleoside triphosphates in a total volume of 50
l and a program of 5 min at 94°C; 40 cycles of 30 s at 94°C, 1 min at 55°C, and
3 min at 68°C; 10 min at 68°C; and 10 min at 4°C. The primers used bound to the
20-nt signature regions described above. This reaction gave a distinct 2.2-kb
full-length cap band (on 1% agarose gel), which was purified (60 l total) and
cloned (4 l) by using the Zero Blunt TOPO PCR cloning kit (with electrocom-
petent Escherichia coli TOP10 cells; Invitrogen, Carlsbad, CA). This intermedi-
ate cloning step significantly enhanced the yield of shuffled cap genes compared
to that of efforts to clone the PCR product directly via conventional means (data
not shown). The shuffled cap genes were then released from the TOPO plasmid
via PacI and AscI double digestion and cloned into the appropriately digested
ITR-rep recipient plasmid.
Performing all these reactions under minimal conditions (with respect to
volumes and amounts), we obtained a library of approximately 3 10
4
bacterial
colonies. The upscaling of each step (including final plating onto 100 15-cm
plates) resulted in a final library of 7 10
5
plasmid clones. The integrity,
genetic diversity, and functionality of the library were confirmed by DNA se-
quencing and small-scale expression studies (see Fig. 1C and Fig. S1 and S2 in
the supplemental material).
Selective in vitro amplification of the shuffled capsid library. We prepared a
viral library by transfecting 293 cells in 50 T225 flasks (10
9
cells) with 50 gof
plasmid from the bacterial library per flask, together with 25 g of an adenoviral
helper plasmid (23). The resulting hybrid viruses were concentrated, purified,
and titrated as described previously for recombinant AAV (23, 53). The final
library used in this study had a particle titer (viral genome concentration) of
8.2 10
11
/ml (total volume, 3 ml). Various amounts of purified shuffled AAV
were then incubated with the different cell lines (in 6-cm dishes), together with
various amounts of helper adenovirus type 5. Ideally, the adenovirus would lyse
the cells within 3 days, giving the AAV sufficient time to replicate. The AAV
amounts were adjusted empirically so that we obtained minimal signals in West-
ern blot analyses of cell extracts. This strategy helped to optimize the stringency
of our library in each amplification round by ensuring that (ideally) a single viral
genome was delivered to each cell and subsequently packaged into the capsid
expressed from this particular viral genome. In one set of experiments, the library
was additionally subjected to intravenous immunoglobulin (IVIG) pressure dur-
ing amplification. Therefore, various volumes of the library and IVIG (Gamimu-
neN [10%]; Bayer, Elkhart, IN) were mixed (see Fig. S3 in the supplemental
material for examples), and the mixtures were incubated for1hat37°C and then
added to the cells. After overnight incubation, the cells were washed and super-
infected with adenovirus. The wash step was included to avoid helper virus
inactivation by the IVIG. As before, AAV amplification was controlled by West-
ern blotting after each round, and only supernatants giving minimal expression
were used for subsequent infections. The increasing IVIG resistance of the
library during consecutive passages allowed us to continuously escalate the IVIG
doses (see Fig. S3 in the supplemental material). All amplification experiments
comprised five infection cycles (adenovirus was heat inactivated between each
and then added fresh, to avoid uncontrolled amplification). Finally, viral DNA
was purified from the supernatant by using a DNA extractor kit (Wako, Japan),
and AAV cap genes were PCR amplified by using DeepVent polymerase and
primers 5 GATCTGGTCAATGTGGATTTGGATG 3 (binding in AAV-2 rep
upstream of the PacI site used for cap cloning) and 5 GACCGCAGCCTTTC
GAATGTCCG 3 (binding downstream of the AscI site and the polyadenylation
signal). The resulting blunt-ended cap genes were subcloned using the Zero
Blunt TOPO PCR cloning kit for sequencing (Invitrogen), and DNA from
individual clones (96 per cell line per amplification round) was prepared. To
assemble full-length cap sequences, we first used T3 and T7 primers to obtain the
5 and 3 ends of each clone and then designed individual primers (data not
shown) to acquire the remaining sequence. Alignments (DNA and protein) with
the sequences of the eight parental viruses were performed using BLAST and
VectorNTI 10/AlignX software (Invitrogen).
Helper plasmid cloning and vector particle production. Helper plasmids ex-
pressing wild-type AAV-2, AAV-8, or AAV-9 cap together with AAV-2 rep
genes, as well as AAV-2-based vector plasmids expressing the hFIX gene from a
liver-specific promoter or the elongation factor 1 promoter, lacZ from a cyto-
megalovirus (CMV) promoter, or the luciferase gene from a simian virus 40
promoter, have all been described previously (18, 19, 28, 52). The generation of
two self-complementary vector plasmids expressing either the gfp gene from a
CMV promoter or the human alpha-1 antitrypsin (hAAT) gene from a Rous
sarcoma virus promoter will be described in detail elsewhere (D. Grimm, L.
Wang, J. S. Lee, T. A. Storm, and M. A. Kay, unpublished data). For the cloning
of helper plasmids expressing shuffled cap genes, the entire AAV-8 cap gene was
removed from the AAV-8 helper construct by cutting with SwaI and PmeI (both
create blunt ends; SwaI cuts 9 nt upstream of the VP1 gene start codon, and
PmeI cuts 53 nt downstream of the polyadenylation signal). The novel cap genes
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5889
were amplified from the respective TOPO constructs (see above) via PCR using
the forward primer 5 AAAT CAGGT N
25
3 (the underlined nucleotide se
-
quence restored the SwaI site to maintain correct reading frames, and N
25
denotes the first 25 nt of each cap gene, ATGGCTGCCGATGGTTATCTT
CCAG for AAV-DJ, AAV-2, AAV-8, and AAV-9). The reverse primer was 5
AAAC GAATTCGCCCTTCGCAGAGACCAAAGTTCAACTGAAACGAA
TCAACCGG TTTATT GATTAACAGGCAA N
23
3 (the nucleotides restoring
the PmeI site are underlined, the polyadenylation signal is shown in bold, and
N
23
denotes the last [3] 23 nt of the shuffled capsid genes, TTACAGATTAC
GGGTGAGGTAAC for AAV-DJ [3-to-5 orientation]). PCRs were performed
using DeepVent DNA polymerase (NEB), creating blunt ends allowing straight-
forward insertion into the linearized AAV-8 helper plasmid. Insert junctions and
correct orientation were confirmed via DNA sequencing (Biotech Core). Vector
production and particle titration (by dot blotting) were performed as described
previously (53); yields for all vectors including AAV-DJ and the HBD mutants
typically exceeded 6 10
13
total physical particles per 50 T225 flasks (2 10
9
cells). HBD mutant plasmids (see Fig. 6A) were generated by A585X and B588Y
site-directed mutagenesis using a QuikChange II kit (Stratagene), with A and B
representing the native residues and X and Y representing the new residues. The
gain or loss of heparin binding ability was confirmed via a standard heparin
binding assay using type I heparin agarose (Sigma) (data not shown). Due to an
unknown deficiency, the AAV-9/AAV-2 chimeric mutant (AAV-9/2) could not
be produced in sufficient amounts for in vivo evaluation.
Helper plasmids for peptide display. Prior to the generation of AAV peptide
display libraries, we mutated the AAV-DJ helper plasmid to permit the insertion
of oligonucleotides encoding seven amino acids after residue R588. In parallel,
we created (using the cloning strategy for cap described above) and also mutated
an AAV-2 helper. We basically adapted a multistep mutagenesis strategy first
described for AAV-2 by Mu¨ller and colleagues (50), with the exception that we
additionally mutated R585 into a glutamine (as in AAV-8). Accordingly, our
mutagenesis primers were identical to those described above, except for the final
(third) primer pair, which was 5 CAACCTCCAGCAAGGCCAGAGAGGCC
AAGGCCCAGGCGGCCACCGCAG 3 (nucleotides changing R585 to Q585
are underlined and shown in bold) and 5 CTGCGGTGGCCGCCTGGGCCT
TGGCCTCTCTGGCCTTGCTGGAGGTTG 3. The resulting AAV-2/AAV-DJ
helper plasmids carried two unique SfiI sites permitting the straightforward insertion
of 21-mer oligonucleotides encoding specific peptides. Notably, another SfiI site
normally present in the AAV-2 rep gene was absent in the helper plasmid back-
bone used here (it had to be mutated in the original cloning strategy [50]; see also
below). The oligonucleotides corresponding to the two lead peptides in this study
were as follows: for the peptide NSSRDLG, 5 AGGCAACTCAAGCCGAGAC
CTAGGAGCCCAGG 3 and 5 GGGCTCCTAGGTCTCGGCTTGAGTTGCC
TCTC 3, and for MVNNFEW, 5 AGGCATGGTCAACAATTTTGAGTGGGC
CCAGG 3 and 5 GGGCCCACTCAAAATTGTTGACCATGCCTCTC 3
(nucleotides encoding the respective seven amino acids are underlined and
shown in bold). Each oligonucleotide pair was annealed and then ligated into the
SfiI-cut AAV-DJ helper plasmid. The presence of the correct inserts was con-
firmed upon sequencing with the HBD primer 5 GTCATGATTACAGACGA
AGAGGAAATC 3 (binding upstream of the HBD-encoding sequences in the
AAV-2 and AAV-DJ cap genes).
Creation of viral peptide display libraries based on AAV-2 and AAV-DJ. The
actual libraries of infectious AAV plasmids carrying random 21-mer oligonucle-
otides were again created in a multistep approach, similar to the generation of
our shuffled library. First, we destroyed the SfiI site in wild-type AAV-2 rep in the
context of the pTR18 plasmid (carrying AAV-2 rep and cap) (27). Primers used
were 5 GTGAGTAAGGCACCGGAGGCCC 3 and 5 GGGCCTCCGGTGC
CTTACTCAC 3 (the nucleotide change disrupting the SfiI site is underlined
and shown in bold). The mutated rep gene was then PCR amplified using the
same BglII site-containing forward primer described above and, as the reverse
primer, 5 GGTAGC AGATCT GTTTAAAC CATTTATTGTTCAAAGATGC
AGTC 3 (the BglII site is in bold, the PmeI site is underlined and shown in bold
italics, and the AAV-2 rep stop codon is underlined and shown in italics). This
fragment was inserted into BglII-cut pTRUF3 to become flanked by AAV-2
ITRs. The resulting construct was linearized by cutting with HindIII and PmeI,
and the mutated AAV-2 and AAV-DJ cap genes (containing two adjacent SfiI
sites but lacking any insert) were inserted as HindIII/PmeI fragments. In a final
step, we then cloned a library of 21-mer oligonucleotides encoding random
peptides into the two plasmids. The 21-mers were flanked by sequences com-
prising BglI sites, so that after cleavage they would be compatible with the
SfiI-cut AAV rep-cap plasmids. The full sequence of the forward primer was 5
CAGTCGGCCAGAGAGGC (NNB)
7
GCCCAGGCGGCTGACGAG 3 (BglI
sites are underlined and shown in bold), with B representing the nucleotide T, C,
or G (see Results). To create a double-stranded oligonucleotide for actual BglI
cleavage and cloning, primer 5 CTCGTCAGCCGCCTGG 3 was used in a
second-strand synthesis reaction as described previously (50). The presence of
random 21-mer inserts or of 21-mer inserts selected after biopanning (see below)
in individual clones was confirmed using the HBD sequencing primer.
AAV protein analyses. Western blot and immunofluorescence analyses were
carried out as reported previously (29) by using the monoclonal B1 antibody
(useful because its 8-amino-acid epitope [see Fig. 2D and Fig. S4 in the supple-
mental material] is largely conserved across known AAV serotypes) for the
detection of immobilized AAV capsid proteins. For immunofluorescence studies,
polyclonal antisera were diluted 1:200 in 1 phosphate-buffered saline (PBS)
while monoclonal antibodies (B1, A20, and 303.9) were used undiluted. Atomic
structure models were created using DeepView Swiss-PdbViewer software ver-
sion 3.7 (www.expasy.org/spdbv) and VIPER (viperdb.scripps.edu/oligomer_multi
.php).
In vitro transduction, binding, and cleavage assays. All transformed cell lines
were maintained in Dulbecco’s modified Eagle’s medium (Gibco) containing 10%
fetal calf serum, 2 mM
L-glutamine, and 50 IU each of penicillin and streptomycin/ml
at 37°C in 5% CO
2
. Fresh primary human hepatocytes (in 6-well plates without
Matrigel) were obtained from Admet (Durham, NC) and maintained in hepatocyte
basal medium (Cambrex, Walkersville, MD) with recommended supplements. The
titration of gfp-expressing recombinant AAV particles was performed in 96-well
plates (27), following the normalization of each virus stock to 2 10
9
particles/ml.
For in vitro neutralization studies, 50-l aliquots of each vector preparation were
incubated with serial 10-fold dilutions of IVIG or mouse sera (following a 1-h heat
inactivation step at 56°C) for1hat37°C prior to titration on cells. Titers of
neutralizing antibodies were calculated as reported previously (29). Details of the
cell binding and cathepsin B digestion were reported recently (2).
In vivo biopanning. Wild-type FVB mice (6 to 8 weeks old; Jackson Laboratory,
Bar Harbor, ME) were inoculated with the shuffled or peptide-displaying libraries at
the doses indicated below. The mice also received different volumes (see Results) of
wild-type adenovirus stocks purchased from the American Type Culture Collection
(ATCC; Manassas, VA): human adenovirus C deposited as adenovirus 5 (catalog
number VR-5) and mouse adenovirus (catalog number VR-550). Total inoculum
volumes were 300 lof1 PBS for liver panning (injected via the tail vein) and 50
lof1 PBS for lung panning. For the latter, the mice were briefly anesthesized
using an isoflurane vaporizer and placed on their backs. The virus suspension was
then carefully pipetted directly onto both nostrils, resulting in the rapid aspiration of
the suspension within a few seconds. Typically, 7 days postinfection, the mice were
sacrificed and the organs were harvested, minced, and frozen in aliquots in liquid
nitrogen. Total genomic DNA was prepared (as reported in reference 27) from one
aliquot for subsequent PCR amplification of AAV DNA by using Platinum Pfx
polymerase (Invitrogen) and specific primers flanking the entire capsid gene. For the
shuffled cap genes, the primers were identical to those used before for in vitro
biopanning. For the peptide-encoding cap genes, we used the same forward primer
but a serotype-specific reverse primer: for AAV-2, 5 TTACAGATTACGAGTCA
GGTATC 3, and for AAV-DJ, 5 TTACAGATTACGGGTGAGGTAAC 3.As
before, the cap genes were then cloned using the Zero Blunt TOPO PCR
cloning kit and sequenced using either T3 and T7 primers for the shuffled
genes or the HBD sequencing primer for the peptide-expressing clones.
Another aliquot was freeze-thawed three times in liquid nitrogen in 200 lof
1 PBS and additionally homogenized to release intact AAV particles. Tis-
sue debris was spun down (16,000 g for 5 min), and the supernatant was
heat inactivated (30 min at 65°C to kill amplified adenovirus) and then used
for reinoculation into new mice (for liver tissue, up to 100 l, and for lung
tissue, 25 l), together with freshly added helper adenovirus. In some cases
(see below), the supernatant (50 l) was depleted of murine immunoglobulin
G (IgG) prior to reinfection by using a commercial kit (ProteoPrep immu-
noaffinity albumin and IgG depletion kit) according to the instructions pro-
vided by the manufacturer (Sigma, St. Louis, MO).
Expression studies with mice. Wild-type female C57BL/6 mice (6 to 8 weeks old)
were purchased from the Jackson Laboratory (Bar Harbor, ME). Recombinant
AAVs expressing the hFIX or hAAT genes in 300 lof1 PBS were administered
via tail vein infusion. Blood was collected at the indicated time points via retro-
orbital bleeding, and plasma hFIX or hAAT levels were determined via an enzyme-
linked immunosorbent assay as described previously (28, 52). Recombinant AAVs
expressing the firefly luciferase gene in 300 lof1 PBS were infused via the tail
vein for liver transduction or administered nasally in 50 lof1 PBS for lung
transduction. Luciferase experiments were conducted with wild-type female FVB/NJ
mice (6 to 8 weeks old) from the Jackson Laboratory (Bar Harbor, ME), and
expression in live animals was monitored as described previously (28). Recombinant
AAV-DJ variants expressing the lacZ gene were also given nasally. Two weeks later,
animals were euthanized, the tracheas were cannulated, and lungs were inflated with
2% low-melting-point agarose and then sectioned with a Vibratome sectioning
5890 GRIMM ET AL. J. VIROL.
system into 100-m slices, which were fixed overnight at 4°C in 4% paraformalde-
hyde. For -galactosidase detection, lung slices were washed three times for 5 min
each time in a solution of 1 PBS, 2 mM MgCl
2
, 0.02% NP-40, and 0.01% sodium
deoxycholate and then incubated overnight at room temperature in the dark in a
solution containing the -galactosidase substrate X-Gal (5-bromo-4-chloro-3-indo-
lyl--
D-galactopyranoside). Lungs were postfixed in 4% paraformaldehyde and
stored at 4°C in 1 PBS. All procedures were approved by the Animal Care
Committee at Stanford University. Genomic DNA was extracted from mouse tissues
and analyzed via Southern blotting using hFIX gene-specific probes as reported
previously (53).
Immunologic in vivo assays. For passive immunization studies, mice were
injected intravenously (via the tail vein) with 40 l (low dose) or 200 l (high
dose) of IVIG (100 mg/ml) diluted in 1 PBS in a total volume of 300 l and,
24 h later, infused (via the tail vein) with 2 10
11
recombinant hFIX gene-
expressing AAV particles. For cross-neutralization studies, mice were immu-
nized against individual AAV serotypes by the peripheral infusion of 10
11
re
-
combinant hAAT gene-expressing particles. Three weeks later, mouse sera were
collected for in vitro neutralization assays before the mice were reinfused with
10
11
(or 5 10
11
for AAV-2) (see below) recombinant hFIX gene-expressing
AAV particles. In an experiment for which the data are not shown, the two AAV
injections were carried out in the reverse order (first hFIX-expressing particles
and then hAAT-expressing particles); the conclusions substantiated those pre-
sented below (see Fig. 9C).
RESULTS
Generation of an AAV capsid library via DNA family shuf-
fling. A chimeric AAV capsid library was generated from eight
parental wild-type viruses of human, primate, or nonprimate
origin (Fig. 1A). In line with our primary goal, to evolve novel
AAV capsids on liver cells in vitro, they were chosen based on
performance in culture (AAV-2) or in liver tissue (AAV-8 and
AAV-9), their substantial sequence divergence from AAV-2
(AAV-4, AAV-5, and avian, bovine, and caprine AAVs), or
their low prevalence in the human population (all but AAV-2
and AAV-5). The conditions for AAV DNA family shuffling
were established in small-scale studies (schematically depicted
in Fig. 1B and C) in order to optimize parameters, including
the choice of DNA polymerases for the PCRs and the lengths
of the subgenomic capsid fragments (see Materials and Meth-
ods for details). The best conditions were then upscaled to
yield a hybrid capsid-encoding plasmid library with a complex-
ity of 7 10
5
distinct sequences. Packaging via the cotrans
-
fection of 293 cells with an adenoviral helper plasmid resulted
in the final viral library, with a particle titer of 8.2 10
11
genomes/ml (total volume, 4 ml from 10
9
cells, i.e., 3,300
particles per cell).
The isolation and sequencing of 48 randomly chosen clones
confirmed extensive genetic diversity and validated the pres-
ence of all eight parental viruses in the final pool (see Fig. S1
and S2 in the supplemental material). Importantly, there was
no apparent bias toward particular serotypes or combinations
thereof in our library, nor did we obtain evidence for preferred
FIG. 1. Generation of an AAV capsid library via DNA family shuffling. (A) Phylogram tree (created using PhyloDraw [http://pearl.cs
.pusan.ac.kr/phylodraw/#test]) showing the eight AAV serotypes used as parents for DNA family shuffling (numbers denote lengths of capsid
genes, in nucleotides). Branch lengths are proportional to the amounts of evolutionary change, calculated in ClustalW (http://www.ebi.ac
.uk/clustalw/#). CAAV, AAAV, and BAAV, caprine, avian, and bovine AAVs, respectively. (B) Individual steps for generation of the library
(scheme). Full-length cap genes were PCR amplified and subcloned for further amplification (1) and then isolated (2) and DNase I digested
(3). Two consecutive PCRs without (4) or with (5) conserved primers were performed to reassemble shuffled full-length cap genes. These
genes were inserted (6) into a plasmid carrying AAV-2 ITRs and a rep gene. The transfection of 293 cells with the resulting plasmid library
(7) together with an adenoviral helper resulted in a viral library. One possible selection scheme used in this study was the coinfection of
cultured liver cells (8) with the library and helper adenovirus under stringent conditions, resulting in the amplification of specific AAV
capsids. Viral DNA can then be isolated (9) and cloned into an AAV helper plasmid carrying the AAV-2 rep gene without ITRs (10) for
subsequent vector production. Ad5, helper adenovirus type 5. (C) Examples of shuffled cap genes in an initial small-scale library. DNA was
extracted from 24 randomly chosen clones, and 5 and 3 ends of the individual cap genes were sequenced (using T3/T7 primers binding in
the plasmid backbone). Shown, per end, are six representative alignments with the eight parents.
V
OL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5891
FIG. 2. Molecular evolution of AAV vectors via DNA family shuffling. (A) The AAV capsid library was serially amplified on primary or
transformed human liver cells. Purified human Igs (IVIG) were added to increase the selection pressure and to force vector evolution. Each scheme
yielded a distinct pool of viral capsids (pools A to C). The alignment of 96 clones per pool with the sequences of the eight parental viruses
confirmed the enrichment with specific sequences in association with increasing selection pressure. 5x, five times. (B) First 217 amino acids of the
VP1 capsid protein for each pool. Colors represent the relationships to the parental strains (serotypes 2, 4, 5, 8, and 9), as also shown and detailed
in Fig. S3 in the supplemental material. Arrowheads represent point mutations. Start codons for all three capsid proteins are shown. Pool C
contained a single clone, designated AAV-DJ. (C) Putative atomic structure for each pool (the previously reported AAV-2 structure [Protein Data
Bank file 1LP3 {http://www.rcsb.org}] was used as the basis for modeling; this structure lacks the residues represented in panel B). Thin green lines
indicate sequence homology among the AAV-2, AAV-8, and AAV-9 parents. Residues shown as colored balls were derived from a subset of
parental strains (see panel B for color codes; note that beige symbolizes AAV-5 in pool A here). AAV capsid symmetry axes (pool A) and four
of the five loops (pool B) are shown. The location of two arginines as part of the conserved HBD (37) at the tip of loop IV is shown for AAV-DJ
(pool C). (D) Capsid protein sequence of AAV-DJ. The three parental viruses are shown as thin lines above the sequence (AAV-2, red; AAV-8,
blue; AAV-9, orange). Locations of the capsid loops, VP start codons, and the first residue of the atomic structure are indicated. A20 and B1
epitopes are boxed in blue and red, respectively (two mutations in the A20 epitope are shown by blue asterisks). Two recently identified
immunogenic AAV-2 peptides (47) are boxed in yellow (AAV-DJ carries three point mutations, indicated by asterisks). Residues in green boxes
form the conserved AAV-2 HBD (asterisks denote two arginines mutagenized in this study). Red asterisks denote residues previously discovered
using other methods and believed to determine AAV-2 immunogenicity (see the text).
5892 GRIMM ET AL. J. V
IROL.
hot spots for recombination. Instead, all eight parents were
found in a random pattern, which is the ideal result. We were
especially pleased to find recombinants with elements from
very diverse serotypes, such as AAV-4 and AAV-5 (see data
for clone S8 in Fig. S1 in the supplemental material), as it
confirmed the potential of DNA family shuffling to create
hybrids from parents differing by as much as 50%. As a
result, the capsids in our library reflected and recapitulated the
diversity of natural AAVs, exemplified by the fact that the
levels of clonal homology to the AAV-2 prototype ranged
anywhere from 46 to 93% (see Fig. S1 and S2 in the supple-
mental material). This wide sequence diversity positively dis-
tinguishes our methodology from previous AAV libraries, in
which all resulting particles remained over 99% identical to the
single parental virus, usually AAV-2 (46, 50, 58, 59, 76) (see
also Discussion). Last but not least, we observed several point
mutations in individual clones but found no evidence for lethal
mutations or frameshifts. This outcome was in line with our
expectations, as a hallmark of DNA family shuffling is the
in-frame recombination of related functional sequences. This
result further distinguishes our methodology from prior AAV
evolution approaches, particularly those based on error-prone
PCR, in which the offspring were frequently not viable (46, 59).
Stringent selection of AAV variants on human liver cells. To
screen for capsids with enhanced efficiency in liver cells, we
serially (five times) amplified our library on human primary
hepatocytes (Fig. 2A, pool A) or hepatoma cells (Huh-7 and
HepG2) (Fig. 2A, pools B and C) as detailed in Materials and
Methods. The extraction and sequencing of viral DNA from up
to 192 clones per cell type (384 clones total) yielded 369 full-
length capsid genes, whose compositions are shown in Fig. 2B
and C. Strikingly, all clones showed predominant homology to
five of the eight starting viruses, serotypes 2, 4, 5, 8, and 9, and
had retained an HBD from the AAV-2 parent. Notably, this
domain, whose function is binding to the primary AAV-2 re-
ceptor heparan sulfate proteoglycan (72), was clearly under-
represented in the unselected library, where it was found in
only 3 of 48 clones (6%) (see, e.g., data for clone S8 in Fig.
S2 in the supplemental material), in line with the random
presence of AAV-2 sequences. The enrichment with and con-
servation of the HBD during selection on cultured cells sug-
gested its crucial role for in vitro transduction. Indeed, vectors
made from 10 individual capsids gave infectious titers similar
to those of wild-type AAV-2 and exceeding those of HBD-
deficient serotypes 8 and 9 (data not shown).
Despite the similarity of pools A (primary cells) and B (cell
lines), we recovered only a single capsid sequence twice (Fig. 3,
lane A), while all other 367 clones differed from each other by
at least three amino acids (defined as our redundancy cutoff).
In a direct comparison of the two pools, we noted the increased
accumulation of serotype-specific residues, together with a re-
duction of random point mutations, in the capsids from the
hepatocyte cell lines (Fig. 2B and C). This finding likely re-
flected the fact that HepG2 and Huh-7 cell lines are substan-
tially more homogenous than primary human hepatocytes,
which often vary among batches and donors. Nonetheless, the
clonal heterogeneity even in the more evolved pool B pre-
vented the reasonable selection and study of single sequences.
To further force the evolution of individual capsids, we thus
applied additional strong negative selection pressure to our
library via incubation with pooled human antisera (IVIG) prior
to reamplification (see Fig. S3 in the supplemental material).
The high-level neutralizing activity of our particular IVIG
batch (GamimuneN [10%]; Bayer) against multiple serotypes,
especially AAV-2, implied its potential to eliminate capsids
displaying prevalent epitopes from the library. Any surviving
capsids were deemed to be useful in humans, with regard to the
high frequency of neutralizing anti-AAV-2 antibodies in the
population (63).
The sequencing of 96 clones after five passages under IVIG
pressure revealed successful enrichment with a single chimera.
This clone, termed AAV-DJ, displayed predominant sequence
homology to serotypes 2, 8, and 9 (Fig. 2B and D) at levels (85
to 92%) similar to those of the homology of these wild types to
one another (Table 1). Notably, AAV-DJ was distinguished
from its closest natural relative, AAV-2, by a total of 60 amino
acids (8% of the VP1 capsid protein). It was thus substan-
tially more divergent than, and compared highly favorably to,
the bulk of previously evolved capsids, which typically differed
from their single parent by only up to seven residues (depend-
ing on the library type, but in all cases corresponding to 1%
of the capsid protein). AAV-DJ also showed 60% identity to
the other five parental viruses, explained by the fact that all
eight wild-type AAVs used in our study were at least 50%
FIG. 3. In vitro analysis of selected shuffled capsids. Following five
consecutive amplifications of the AAV library on primary human
hepatocytes, viral DNA was extracted from 10 randomly chosen clones
(with the exception of the clone corresponding to lanes A, which was
recovered twice from pool A), and the cap genes were subcloned into
an AAV helper plasmid. (A) Western blot (using B1 antibody) show-
ing differences in the expression levels and sizes of the individual VP
proteins compared to those of wild-type AAVs (wtAAV). (B) Results
from titration of infectious gfp-expressing particles. The helper plasmids
described above were used to package a gfp-expressing AAV vector plas-
mid, and titers of recombinant particles in crude cell extracts were deter-
mined (n 3) as detailed in Materials and Methods. All shuffled clones
gave higher titers than the AAV-8 or AAV-9 helpers. No linear correla-
tion between VP protein expression levels (A) and titers (B) could be
made, suggesting that the various chimeras differed in their packaging
efficacy, infectivity, and/or other parameters.
V
OL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5893
homologous to one another (Table 1). As a result, many indi-
vidual residues in the AAV-DJ sequence could not be assigned
to a particular parent.
Clearly, AAV-DJ was more evolved than the clones ob-
tained in the absence of IVIG, as was already evident from the
data in Fig. 2B and C and as was further confirmed by se-
quence homology comparisons to pool A (from primary hu-
man hepatocytes). Indeed, the 10 clones in pool A displayed
higher relative similarities to AAV-2, while AAV-DJ was more
homologous to AAV-8 (Table 2). This finding validated our
initial assumption that IVIG pressure would lead to an elimi-
nation of AAV-2 epitopes from our library. Concurrently,
AAV-DJ was only 88 to 90% homologous to pool A, which
further highlights its divergence from capsids evolved under
less stringent conditions (the use of heterogeneous primary
cells and the lack of IVIG pressure for pool A).
Molecular evolution affects mostly exposed capsid regions.
AAV capsids are complex three-dimensional protein struc-
tures, suggesting that the majority of amino acid changes re-
sulting from our evolution process would occur on the exterior
of the virion, at positions accessible to the selection pressure.
Indeed, the bulk of the 60 non-AAV-2 residues in AAV-DJ
were located in the loops extruding from the particle, espe-
cially in the major loop IV (Fig. 2C and D and also see Fig. S4
in the supplemental material). Consequently, the overall iden-
tity of AAV-DJ to its eight parents dropped from 31% (for
the total VP1 protein) to only 18% in this exposed capsid
region. Importantly, the AAV capsid loops contain most of the
residues critical for natural receptor binding or for antibody
recognition or escape. This arrangement explains the observed
lack of AAV-DJ detection by the AAV-2-specific A20 anti-
body, as the conformational epitope of the A20 antibody (80)
was dispersed over three of the five capsid loops and disrupted
by two point mutations in AAV-DJ (Fig. 4). In contrast, the
highly conserved residues constituting the capsid core re-
mained mostly unchanged in AAV-DJ, as their inaccessible
location on the inside of the assembled particle protected them
from synthetic (or natural) AAV evolution. This arrangement
also explains why all eight parental AAVs in our study (and
perhaps all naturally occurring AAVs) showed 31% overall
identity and at least 50% homology in pairwise comparisons
(see Fig. S4 in the supplemental material and Table 1).
The critical roles of the residues in the capsid loops were
further apparent upon alignments of AAV-DJ sequences with
TABLE 1. Sequence homology of AAV-DJ and wild-type AAV capsid proteins
a
Vector
% Homology of capsid protein of indicated vector to capsid protein of:
DJ (737) 2 (735) 8 (738) 9 (736) 4 (734) 5 (724) A (743) B (736) C (296)
DJ 100
2 92 100
8 88 82 100
9 85 81 85 100
4 61 606362100
5 57 57585753100
A 57 5757585454100
B 58 595859765554100
C 47 4649454286 44 43100
a
Shown are percentages of homology between the capsid protein of AAV-DJ and those of the eight parental wild-type AAVs. Numbers in parentheses indicate
overall lengths of the various capsid proteins (in amino acids). AAV-DJ showed the highest levels of homology to wild types 2, 8, and 9 but also 50 to 60% homology
to the other five parents. High degrees of homology of 81 to 85% were also evident for the three most efficient (in vitro and/or in murine liver) wild types, AAV-2,
AAV-8, and AAV-9. Not surprisingly, these three serotypes were the predominant AAV-DJ parents (see the text). Notably, all five other wild types showed 40 to
60% homology to one another or to the AAV-2-AAV-8-AAV-9 group, exemplifying the overall close relationship of all naturally occurring AAVs. The levels of
homology were higher for the even more closely related AAV-4 and bovine AAV, as well as for AAV-5 and goat AAV, as reported before. Note that only a subfragment
(888 bp) of goat AAV which covered the diverse loops III and IV was used in this study, explaining the seemingly lower degrees of homology of other isolates to this
serotype. A, avian AAV; B, bovine AAV; C, caprine (goat) AAV; 2, 8, 9, 4, and 5, wild-type AAV serotypes.
TABLE 2. Homology of pool A and C and wild-type AAV capsid genes and proteins
a
Vector
% Homology of capsid gene/protein of indicated vector to gene/protein of:
DJ
(2,214/737)
A4
(2,211/736)
A11
(2,208/735)
D4
(2,208/735)
C8
(2,211/736)
G6
(2,208/735)
G5
(2,217/738)
B3
(2,211/736)
B4
(2,208/735)
G12
(2,208/735)
C3
(2,211/736)
DJ 100/100 89/90 89/91 89/91 87/88 89/91 88/91 88/90 91/93 88/88 88/89
2 90/92 92/94 90/93 94/96 88/90 96/96 93/94 90/93 91/94 92/93 94/95
8 87/88 82/84 81/84 82/83 82/85 81/84 85/87 83/87 84/85 81/83 81/84
9 81/85 81/83 87/88 83/85 85/85 81/84 80/84 84/86 82/86 82/84 80/83
a
Shown are the percentages of homology between pairs of full-length AAV capsid genes (first numbers) and proteins (second numbers). The designations in the
column heads indicate 10 individual clones from pool A (selected on primary human hepatocytes in the absence of IVIG) (Fig. 2A). The numbers in parentheses show
the total lengths of each capsid gene (first number, in nucleotides) and protein (second number, in amino acids). Clone A4 was independently recovered twice from
pool A. Data for AAV-DJ are included for comparison. With the exception of clone C8, all clones from pool A showed higher levels of homology to wild-type AAV-2
(underlined values) than did AAV-DJ. In contrast, of all the clones, AAV-DJ showed the highest degree of homology to wild-type AAV-8 (underlined values). Both
findings together suggest that stringent selection under IVIG pressure (i.e., that in the case of AAV-DJ) led to the elimination of AAV-2 sequences from the library
and to a concurrent accumulation of AAV-8 residues. Also note that pool A (10 clones) and pool C (AAV-DJ) are on average only 88 to 90% homologous (first row),
which is lower than the degree of homology of pool A clones to wild-type AAV-2 (92 to 94%) (second row). This result further highlights the divergence of AAV-DJ
not only from wild-type AAVs but also from capsids evolved under less stringent conditions. 2, 8, and 9, wild-type AAV serotypes.
5894 GRIMM ET AL. J. VIROL.
those of the 10 clones from pool A (Fig. 5). As mentioned
above (Table 2), most clones from pool A had preserved
AAV-2 sequences, while AAV-DJ was more related to sero-
types 8 and 9 than the pool A clones were. In analogy to the
results of the previous wild-type comparison, we noted that the
greatest sequence diversity occurred in the exposed regions,
with many of the changes clustered within loops I, IV, and V.
Intriguingly, our alignments confirmed 6 of the 12 previously
reported hypervariable regions (HVRs) in the AAV capsid
gene (11, 16) but, moreover, identified several further hot
spots of sequence diversity (Fig. 5 and also see Fig. S4 in the
supplemental material). Most of them were located in the N
termini of VP1 and VP2, while others were dispersed among
the areas corresponding to HVRs 2 to 5. Our observation of
multiple differences between the N termini of AAV-DJ and
pool A was not surprising, as the N-terminal region is tempo-
rarily exposed during the AAV life cycle (7, 40, 68) and thus
potentially subject to evolution pressure.
Notably, the phospholipase 2A domain in the VP1 N termi-
nus, critical for particle infectivity (7, 86), remained highly
conserved, with the single exception of clone C8 from pool A.
In striking contrast to the N termini of the rest of the capsids,
the AAV-DJ capsid N terminus was almost entirely derived
from AAV-2, while the clones in pool A carried multiple dis-
persed residues from AAV-8 or AAV-9. These amino acids,
especially the new clusters identified by our alignments, and
their roles in the infection cycle should be very interesting
targets for future AAV studies. These findings and consider-
ations highlight the vast potential of DNA family shuffling, not
only as a means to evolve viral vectors, but also as a functional
genomics tool, useful to unravel basic virus biology.
In summary, we have cloned, sequenced (fully or partially),
and compared a total of 513 candidates from our library before
and after various selection schemes. Of the 465 clones from
pools A to C, one was recovered twice (from pool A), while the
96 clones from pool C were completely identical (AAV-DJ).
All other clones differed from one another by at least three
amino acids and were not identified among the 48 clones from
the unselected library. Likewise, AAV-DJ was found neither in
pools A and B nor in the original library, confirming its specific
evolution under stringent IVIG selection.
Recombinant AAV-DJ vectors mediate superior in vitro
transduction. We next generated gfp-expressing vectors from
the AAV-DJ capsid gene and compared their in vitro infectiv-
ities to those of the eight most commonly used wild-type AAVs
(serotypes 1 through 6, 8, and 9), including five of the AAV-DJ
parents (serotypes 2, 4, 5, 8, and 9). Impressively, titration on
14 cell types from different species and tissues, including pri-
mary human hepatocytes, melanoma cells, and embryonic stem
cells, showed that AAV-DJ vectors were not only superior to
all HBD-negative wild-type viruses (up to 100,000-fold better
than AAV-8 or AAV-9), but also substantially better than
AAV-2 (Table 3 and data not shown). Ratios of total to infec-
tious particles were frequently far below 500, highlighting the
extreme efficiency of AAV-DJ in vitro and suggesting its par-
ticular usefulness for ex vivo gene transfer applications. The
only exceptions on which AAV-DJ was not most efficient were
human monocytes and dendritic cells (Table 3). On these cells,
AAV-1 and AAV-6 outperformed the other vectors, albeit
AAV-DJ was among the most efficient capsids. Our data for
AAV-1 confirm and extend the findings of a recent study in
which this serotype also surpassed AAV-2 to AAV-5 on mu-
rine hematopoietic stem cells (87). As expected, AAV-DJ
transduction was largely unaffected by IVIG (similar to AAV-8
and AAV-9 transduction) (data not shown).
To investigate the role of the AAV-DJ HBD, we mutated
two crucial arginines (37, 56) into the respective residues in
AAV-8 or AAV-9 (Fig. 6A and B). Green fluorescent protein
expression from the resulting mutants was reduced by several
orders of magnitude and was as low as that from serotypes 8
and 9 (Fig. 6C and Table 3) (results for mutants DJ/8 and DJ/9
were identical). The drop in infectivity correlated well with
reduced binding to cells (Fig. 6D). However, cell attachment
alone cannot explain the unusual infectivity of AAV-DJ, as
AAV-2 actually bound 10-fold more efficiently. We rather as-
sume a synergistic or additive effect from sharing beneficial
properties from all AAV-DJ parents, resulting in the enhance-
ment of multiple steps in AAV-DJ transduction. One likely
outcome was the combination of efficient primary receptor
binding (from AAV-2, compared to AAV-8 and AAV-9) with
rapid virus processing and uncoating (from AAV-8) (73) (Fig.
FIG. 4. Presentation of epitopes on the AAV-DJ capsid. Shown at
the top are the putative AAV-2 epitope for the monoclonal antibody
A20 (a conformational epitope comprising three distinct peptides [see
also Fig. 2D]) and the corresponding sequences in AAV-DJ, AAV-8,
and AAV-9 (amino acid changes compared to the sequence of AAV-2
are highlighted in red [AAV-DJ] or orange [AAV-8 and AAV-9]). The
bottom panels show results from immunofluorescence studies of cells
cotransfected with the various helper constructs and an adenoviral
helper plasmid (to boost gene expression from the AAV plasmids).
The two amino acid changes in AAV-DJ were already sufficient to
abolish the binding of the A20 antibody, validating and narrowing
down the A20 epitope (80) and thus exemplifying the potential of
DNA family shuffling as a reverse-genetics tool. AAV-DJ cross-re-
acted with both the polyclonal anti-AAV-2 and anti-AAV-8 sera, as
expected from its chimeric structure. Similar cross-reactivity with these
sera was also observed for wild types 2, 8, and 9. The fact that AAV-
DJ, AAV-8, and AAV-9 were detected by the B1 antibody (initially
raised against AAV-2 capsid proteins) was not surprising considering
the high degree of conservation of its epitope in natural AAVs (see
Fig. S4 in the supplemental material). All mono- and polyclonal anti-
AAV antibodies were described previously (78, 79), except for the
polyclonal rabbit anti-AAV-8 antiserum. 303.9, anti-Rep; B1, anti-VP;
AAV-2, anti-AAV-2 VP serum; A20, anti-AAV-2 capsids; AAV-8,
anti-AAV-8 VP serum.
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5895
5896 GRIMM ET AL. J. VIROL.
6E). A further explanation may be that the juxtaposition of
subunits from different parents created a unique property, such
as the use of an unidentified coreceptor for faster capsid in-
ternalization (see also Discussion and Fig. 12 below). An im-
portant role in infectivity was likely also played by the unique
AAV-DJ N terminus, which differed from those of all other
recovered clones (see above).
AAV-DJ yields robust hFIX expression in mouse liver tissue.
Based on the high level of efficacy of the AAV-DJ capsid in
vitro, we became interested in evaluating vectors based on this
novel chimera in mouse liver tissue in vivo. For this purpose,
we produced recombinant AAV-DJ particles expressing the
hFIX gene from a robust liver-specific promoter (53). Controls
were wild-type capsids of serotypes 2, 8, and 9 and mutants
DJ/8, DJ/9, and 2/8 (HBD negative) and 8/2 (HBD positive)
(see above and Fig. 6A and D). Immunocompetent C57BL/6
mice were infused via the tail vein with particle doses of each
virus ranging over four orders of magnitude (5 10
9
to 1
10
12
particles), and plasma hFIX levels were monitored for up
to 4 months.
We observed dose-dependent expression from the AAV-DJ
capsid at levels equivalent to those from AAV-8 and AAV-9,
the best two naturally identified AAVs for liver tissue reported
thus far (18, 19, 52) (Fig. 7A and data not shown for the 5
10
9
dose). All three viruses readily outperformed the AAV-2
prototype at any dose and expressed over 100% of normal
hFIX levels already after the intravenous injection of 5 10
10
particles (AAV-2 matched these levels only at a dose of 10
12
particles, i.e., a 20-fold-higher dose). Quantification and anal-
yses of persisting vector DNA confirmed the similarity of
AAV-DJ, AAV-8, and AAV-9 and their comparable degrees
of superiority over AAV-2 (see Fig. S5 in the supplemental
material). These results were verified in analogous experi-
ments using two alternative expression cassettes (data not
shown).
Curiously, the two DJ HBD mutants were indistinguishable
from AAV-DJ (and serotypes 8 and 9) at these doses, while the
corresponding AAV-2 mutant (2/8) was inferior to wild-type
AAV-2 (Fig. 7B and C). Different expression levels for AAV-8
and the HBD-positive 8/2 mutant were also noted, albeit here,
FIG. 5. Protein sequence alignments for AAV-DJ and 10 clones from pool A. Shown are full protein alignments for the 10 clones described
in the legend to Fig. 3. (The clones correspond to lanes A to J in Fig. 3 and are listed in order; e.g., clone A4 corresponds to lanes A, and clone
A11 corresponds to lanes B, etc.). AAV-DJ served as the standard to highlight the different degrees of evolution between pools A and C (in which
clones were selected with [pool C] or without [pool A] IVIG [Fig. 2A]). The clone A4 sequence is shown as a full sequence, as clone A4 was
recovered twice from pool A. Residues identical in A4 and AAV-DJ are colored in red, while changes are shown in yellow. Only amino acids
divergent from AAV-DJ are shown for the other nine clones (for the origin of these residues, see the wild-type sequences in Fig. S4 in the
supplemental material and also see the text). The horizontal bars indicate the capsid loops (see Fig. S4 in the supplemental material). Note that
many changes in the 10 clones from pool A were clustered in these loops, as could be expected. Moreover, the gene regions corresponding to six
of these cluster regions were identical to 6 of the 12 previously reported HVRs (HVRs 1, 3, 4, 5, 11, and 12 among the previously described HVRs
1 to 12, identified by green boxes) in the AAV capsid gene. Intriguingly, our alignments also identified several further regions of sequence diversity
not described before, especially in the VP1 and VP2 N termini. The dotted orange lines mark a highly conserved phospholipase 2A domain in the
VP1 N terminus; note the unique amino acid change (D97H) in clone C8 (yet the capsid was infectious [see Fig. 3]). The three purple boxes show
the A20 epitope; note that almost all clones had fully maintained the respective consensus sequence from AAV-2 (H in the first and V in the second
part of the epitope) but that AAV-DJ had not (compare Fig. 4). The blue box shows the location of two of the five residues (two arginines) which
constitute the HBD; they were fully conserved in all clones.
TABLE 3. In vitro infectivities of AAV-DJ and wild-type vectors
a
Cell line Tissue or cell type
Infectivity of vector:
AAV-1 AAV-2 AAV-3 AAV-4 AAV-5 AAV-6 AAV-8 AAV-9 AAV-DJ AAV-DJ/8
Huh-7 hu liver 4e3 5e2 2e4 2e6 4e5 5e3 7e4 7e6 1e2 3e5
293 hu kidney 2e3 5e2 2e4 7e5 4e5 1e4 7e4 7e5 1e2 2e5
HeLa hu cervix 7e4 2e3 1e5 2e6 3e4 2e5 1e6 2e6 3e2 1e6
HepG2 hu liver 2e6 5e4 3e5 2e7 3e6 1e6 2e7 ND 4e3 1e7
Hep1A mu liver 1e4 2e3 1e6 2e5 2e6 2e5 1e6 2e7 5e2 2e6
911 hu retina 6e3 1e3 9e3 5e5 7e5 6e3 1e6 ND 2e2 4e5
CHO ha ovary 1e4 1e4 7e4 7e5 3e3 2e4 1e5 1e6 4e1 2e5
COS si kidney 3e3 1e3 3e3 3e4 2e4 7e3 5e4 2e5 2e2 3e5
MeWo hu skin 2e3 2e2 1e3 7e4 3e3 2e3 2e4 1e5 7e0 2e4
NIH3T3 mu fibroblasts 2e5 2e4 7e5 7e5 7e6 2e5 7e6 ND 4e3 2e7
A549 hu lung 7e4 1e4 5e4 ND 2e6 1e5 2e6 7e6 1e3 2e7
HT1180 hu fibroblasts 5e4 1e4 1e5 7e6 3e6 3e4 2e6 1e7 3e3 5e6
Monocytes hu primary monocytes 9e5 1e7 ND ND 8e6 7e5 ND ND 1e7 ND
Immature DC hu monocyte-derived DC 8e5 2e7 ND ND 9e6 7e5 ND ND 1e7 ND
Mature DC hu monocyte-derived DC 9e5 2e7 ND ND 6e6 6e5 ND ND 2e7 ND
a
Each cell line was infected with 10-fold serial dilutions of each serotype, AAV-DJ, or the mutant AAV-DJ/8 expressing a gfp reporter gene. Vector preparations
were normalized to contain 2 10
9
total (vector DNA-containing) particles per ml prior to infection. Three days later, green fluorescent protein-expressing cells were
counted and infectious titers were determined by taking into account the dilution factor. Numbers shown are average ratios (rounded) of total to infectious AAV
particles from at least three independent titrations. Lower numbers indicate higher levels of infectivity. For each cell line, values corresponding to the most efficient
AAV are underlined, while boldface indicates the lowest level of efficiency. AAV-DJ vectors showed the highest levels of infectivity on all tested cell lines. hu, human;
mu, murine; ha, hamster; si, simian; DC, dendritic cells; ND, not detectable (2 10
7
).
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5897
the wild type performed better (Fig. 7C). This finding sug-
gested an essential function of heparin binding for liver gene
expression from AAV-2, corroborating previous findings with
this serotype (37), but a redundancy for more efficient natural
or synthetic capsids (those of AAV-DJ and serotypes 8 and 9).
Moreover, together with our data from the in vitro assays (see
above), these results exemplified the differential effects of the
HBD on AAV transduction in culture and in organisms.
The AAV HBD plays a multifaceted role in vivo. Interest-
ingly, additional studies indicated an even more complex role
for the HBD in vivo. At a maximal dose of 7 10
12
particles,
the transduction profiles of the most efficient viruses became
unique. All HBD-negative variants showed faster transduction
kinetics than AAV-DJ, although all viruses eventually (after
1.5 months) gave similar expression levels (Fig. 7D). A sim-
ilarly slow response at extreme particle doses with a resulting
lag phase had previously been reported for AAV-2 (53, 67) and
was confirmed here (data not shown). The fact that AAV-DJ
and AAV-2 share the HBD suggests a common molecular
mechanism involving this domain, likely at the level of post-
vector entry (e.g., particle trafficking or uncoating). However,
this idea warrants further investigation in view of studies re-
FIG. 6. In vitro analyses of AAV-DJ and HBD mutants. (A) Two
arginine residues (numbers refer to positions in AAV-2) in AAV-2,
AAV-8, AAV-9, or AAV-DJ were mutagenized to eliminate or introduce
an HBD (37). (B) Western blots (using B1 antibody) confirming correct
VP protein expression from all HBD mutants. AAV-8 and AAV-DJ (wild
types and mutants) expressed proteins more strongly than AAV-2 or
AAV-9, for reasons unknown. , with; , without. (C) Titration of in-
fectious particles on 293 cells confirmed the role of the HBD in infection
in culture. The mutation of the HBD in AAV-2 or AAV-DJ reduced
infectivity, measured the ratio of total to infectious AAV particles, by 2 to
3 logs. However, including an HBD in AAV-8 and AAV-9 did not further
increase the infectivity of these vectors. (D) Results from cell binding
assays confirming the role of the HBD in attachment to cultured cells
(HeLa or Huh-7). The drop in binding with the AAV-2 and AAV-DJ
mutants correlated well with the transduction data presented in panel C.
Surprisingly, the HBD-positive AAV-8 and AAV-9 mutants bound sev-
eralfold more efficiently than AAV-2 on HeLa cells and, in all cases, far
better than wild types 8 and 9 but transduced much less efficiently. Cell
attachment and transduction thus do not necessarily correlate, suggesting
that additional intracellular factors and steps contributed to the superior
transduction efficiency of AAV-DJ. (E) AAV particle digestion with the
endosomal proteinase cathepsin B (cath. B) (2) yielded distinct patterns
for the individual serotypes in a Western blot analysis using polyclonal
anti-AAV-2 VP serum. AAV-DJ showed a hybrid pattern with bands
from AAV-2 and AAV-8 (white and black arrows, respectively), further
supporting the idea that its properties resulted from synergistic or additive
effects from its parents (cell binding from AAV-2 and rapid uncoating
from AAV-8).
FIG. 7. hFIX expression from AAV-DJ in mice. (A) Dose-depen-
dent and liver-specific hFIX expression. C57BL/6 mice (n 3to8)
were infused with all four hFIX-expressing vectors via peripheral tail
vein injection. Gray shading indicates the range from 1 to 100% of
normal hFIX levels in humans (0.05 to 5 g/ml). Levels over 1% are
considered to be therapeutic in hemophiliacs. Note that AAV-8,
AAV-9, and AAV-DJ vectors exceeded the 100% level already at the
lowest dose, whereas AAV-2 required a 20-fold-higher dose. (B) hFIX
expression from the AAV-DJ HBD mutants (n 3 per group). Shown
are results from two representative doses; there was no significant
difference from the results for AAV-DJ. (C) In contrast, the AAV-2 or
AAV-8 HBD mutants expressed less hFIX than the corresponding
wild types (n 3 per group). (D) AAV-DJ showed unique transduc-
tion kinetics at a maximum dose of 7 10
12
particles. The onset of
gene expression was delayed compared to that from AAV-8 or AAV-9,
yet hFIX levels became similar after 40 days (n 3 per group). The
AAV-DJ HBD mutants showed intermediate kinetics; stable hFIX
levels were eventually also similar to those from AAV-8 and AAV-9
(and AAV-DJ). pi, postinjection.
5898 GRIMM ET AL. J. V
IROL.
porting blunted dose responses also for AAV-1 and AAV-5,
which both lack a consensus HBD (52).
A second function of the HBD became apparent upon anal-
yses of vector DNA biodistribution (Fig. 8A and Table 4). We
corroborated previous reports of unrestricted tropism of
AAV-8 and AAV-9 (HBD negative) (17, 18, 34, 52, 60), which
readily transduced all tested tissues at a dose of 10
12
particles
per mouse. In striking contrast, AAV-2 and likewise AAV-DJ
(both HBD positive) were restricted to liver tissue and, to a
lesser extent, heart, kidney, and spleen tissues and were near or
below the detection limit in all other tissues. In fact, the quan-
tification of double-stranded vector DNA (using liver tissue as
an internal standard for each group) showed that AAV-DJ
transduced lung, brain, pancreas, and gut tissue about two- to
fourfold less efficiently than wild types 8 and 9 (Table 4). The
effect of the HBD on viral tropism was best exemplified by
comparing AAV-DJ to the DJ/8 mutant: HBD deletion alle-
viated the liver restriction and expanded transduction to all
nonhepatic tissues, including the brain, identical to the trans-
duction patterns of AAV-8 and AAV-9. These findings not
only corroborate but also may help explain a series of reports
on the wide tissue dissemination of vectors based on HBD-
negative natural serotypes (AAV-1 and AAV-4 to AAV-9) in
mice, dogs, and monkeys (17, 29, 37, 52, 60), in contrast to that
of the HBD-positive AAV-2. Notably, AAV-DJ also trans-
duced nonhepatic tissues at the maximum dose of 7 10
12
particles but still to a lesser extent than the HBD-negative
viruses, in particular AAV-9 (Fig. 8A and Table 4). Impor-
tantly, even at this dose, brain and also lung transduction
remained marginal.
Additional side-by-side comparison of all liver vector
DNA levels showed similar dose responses for the non-
AAV-2 viruses at doses between 5 10
10
and 1 10
12
particles (Fig. 8B), in agreement with our expression data
(see above). However, at 7 10
12
particles, the HBD-
negative viruses persisted at slightly higher copy numbers
than AAV-DJ. The data in Fig. 7D, as well as our previous
FIG. 8. Vector DNA biodistribution and dose response. (A) Genomic
DNA extracted from nine tissue types (li, liver; lu, lung; h, heart; k,
kidney; s, spleen; b, brain; p, pancreas; g, gut; and m, muscle) was
analyzed for the presence of hFIX-expressing vector DNA. The results
and the reference standard shown are representative of data for the
two highest doses used here. The AAV-DJ transduction pattern was
more restricted to liver, heart, kindey, and spleen tissues than those of
AAV-8, AAV-9, and the HBD mutants. At the highest dose (7 10
12
particles), AAV-DJ spillover into nonhepatic tissues was also less obvious
than that of the other vectors. The HBD-negative AAV-2/8 mutant gave
increased heart transduction compared to wild-type AAV-2, confirming
previous data (37) (an unknown production deficiency prevented evalu-
ation at the highest dose). (B) Comparison of vector DNA levels in liver
following transduction with increasing particle doses (from left to right,
5 10
10
,2 10
11
,1 10
12
, and 7 10
12
particles). AAV-DJ showed a
blunted response at the highest dose, likely correlating with its slower
onset of gene expression (Fig. 7D).
TABLE 4. Relative levels of transduction of nonhepatic tissues with AAV vectors
a
Vector
Dose
(no. of particles)
Level of AAV DNA in:
Lung Heart Kidney Spleen Brain Pancreas Gut Muscle
AAV-2 1e12 ND 0.7 0.1 0.8 0.1 0.2 0.0 ND ND ND ND
7e12 ND 1.5 0.03 2.0 0.3 1.0 0.2 ND ND ND ND
AAV-8 1e12 0.5 0.0 1.2 0.2 0.9 0.2 0.3 0.0 0.2 0.0 0.2 0.0 0.3 0.0 0.7 0.1
7e12 2.5 0.3 2.5 0.2 2.6 0.3 1.5 0.2 1.5 0.2 1.2 0.2 1.2 0.2 1.9 0.2
AAV-9 1e12 0.7 0.1 1.3 0.2 1.1 0.2 0.4 0.0 0.2 0.0 0.2 0.0 0.3 0.0 0.8 0.1
7e12 2.6 0.3 3.6 0.4 3.8 0.4 1.5 0.2 1.8 0.2 1.3 0.2 1.9 0.2 3.0 0.3
AAV-DJ 1e12 0.2 0.0 1.3 0.2 0.8 0.2 0.5 0.1 ND 0.1 0.0 0.1 0.0 0.2 0.0
7e12 0.6 0.1 2.3 0.2 2.1 0.2 1.5 0.2 0.4 0.0 0.5 0.0 0.5 0.0 0.8 0.1
AAV-DJ/8 1e12 0.6 0.0 1.3 0.2 0.8 0.2 0.2 0.0 0.2 0.0 0.1 0.0 0.2 0.0 0.7 0.1
7e12 2.6 0.3 2.5 0.3 2.3 0.3 1.6 0.3 1.8 0.2 1.2 0.2 1.3 0.2 2.0 0.2
a
Vector copy numbers (per diploid genomic equivalent) were determined via phosphorimager scan analyses of Southern blots as shown in Fig. 8A. At least three
independent mice per applied dose were analyzed. Copy numbers are shown as average percentages (rounded to one decimal place) standard deviations relative to
copy numbers in liver tissue within each group, allowing comparison between vectors and doses. For AAV-2, most signals were below the detection limit of the Southern
blot analyses (0.03 copies of double-stranded AAV DNA per cell), preventing the calculation of relative transduction in these cases (ND, not determined).
Underlining highlights values for doses or tissues for which relative AAV-DJ transduction levels differed by at least twofold from those for serotypes 8 and 9, as well
as for the AAV-DJ HBD mutant.
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5899
findings with AAV-8 (52), imply that this outcome resulted
from faster transduction with the HBD-negative viruses
than with the HBD-positive viruses. This effect in turn likely
increased the steady-state levels of viral DNA. Because the
levels of expression from all viruses eventually became sim-
ilar (Fig. 7D), we further hypothesize that the majority of
additional genomes were silenced over time. While the lat-
ter conclusion is also supported by the results of our earlier
work (52), more detailed studies are needed to prove the
ensuing opposite idea, that a higher proportion of vector
DNA copies from AAV-DJ transduction than from trans-
duction with HBD-negative viruses remains transcription-
ally active in the liver.
AAV-DJ partly escapes humoral neutralization in mice. We
next quantified liver transduction in the presence of human
serum to assess AAV-DJ’s ability to evade neutralization in
vivo. Therefore, we passively immunized mice with IVIG prior
to the infusion of hFIX-expressing AAV-2, AAV-8, AAV-9, or
AAV-DJ. As predicted, AAV-2 expression was nearly com-
pletely abolished. In contrast, transduction with AAV-DJ,
AAV-8, or AAV-9 was inhibited in a dose-dependent manner,
with AAV-DJ showing intermediate resistance at the high
IVIG dose and efficient evasion (similar to that by serotypes 8
and 9) at the low IVIG dose (Fig. 9A). These results were
essentially confirmed with a second independent IVIG batch
from another vendor (Carimune [12%]; Behring AG) (data
not shown). Interestingly, the DJ HBD mutants were fully
neutralized, comparable to AAV-2 (Fig. 9B). This observation
suggested that the HBD affected the display of epitopes on the
capsid, thus implying yet another role of this domain for the
AAV particle. Alternatively, published data for wild-type
AAVs (17), as well as our own preliminary findings (data not
shown), indicate that this domain may determine in vivo vector
pharmacokinetics by enhancing the clearance of HBD-positive
capsids from the blood and, thus, reducing their exposure to
neutralizing antibodies.
Lastly, we assessed the feasibility of repeatedly administer-
ing the different viruses to mice to evaluate capsid cross-neu-
tralization (Fig. 9C). As expected, we saw no gene expression
upon the reinfusion of any of the capsids into animals already
treated with the same serotype. However, we noted that
AAV-8 and AAV-9 also efficiently blocked each other, sub-
stantiating prior data (18). This result may argue against the
use of vectors based on these wild types in readministration
protocols, although the vectors could be combined with
AAV-2. In contrast, primary infusion with AAV-DJ allowed
subsequent expression (at up to 18% of the respective PBS
control) from AAV-2, AAV-8, or AAV-9, likely due to the fact
that AAV-DJ shares only a limited number of epitopes with
each wild-type virus. Surprisingly, in the reverse experiment,
AAV-DJ vectors were inhibited in animals immunized with
AAV-8 or AAV-9 while giving detectable expression in AAV-
2-treated mice. This result implied a stronger or broader im-
mune response from primary infusion with serotype 8 or 9 than
from that with serotype 2. Intriguingly, AAV-DJ was more
resistant to the corresponding mouse sera in culture than in
vivo (Fig. 9D), and we also noted less cross-reactivity between
AAV-8 and AAV-9 in culture than in vivo. These findings are
perhaps due to the display of distinct epitopes in vitro and in
vivo. This scenario may likewise explain the different degrees
of neutralization of all three viruses with IVIG in cells and in
mice.
Creation of a viral peptide display library based on AAV-DJ.
An intriguing property of the AAV-DJ capsid revealed by our
in vitro assays is the inverse correlation of cell binding and
transduction efficacies (Fig. 6). Together with the unique en-
dosomal cathepsin B cleavage pattern, this finding suggests
that the superior efficacy of the AAV-DJ capsid is due at least
partially to faster uptake or enhanced intracellular processing.
FIG. 9. In vivo and in vitro neutralization of AAV-DJ and wild-
type AAVs. (A) Mice (n 4 per group) passively immunized with
IVIG (4 or 20 mg) were injected with hFIX-expressing AAV. Plasma
hFIX levels per virus and time point are shown as percentages of
corresponding levels in control mice (those receiving PBS instead of
IVIG). (B) Mice (n 4 per group) immunized with the higher IVIG
dose were also injected with the AAV-DJ HBD mutants. AAV-2,
AAV-9, and AAV-DJ were included as controls. hFIX expression from
the HBD mutants was marginal, comparable to that from AAV-2.
(C) Mice (n 4 per group) were injected with PBS or 10
11
particles of
hAAT-expressing AAV-2, AAV-8, AAV-9, or AAV-DJ (x axis), and 3
weeks later, they were reinjected with 10
11
particles of hFIX-express
-
ing viruses (5 10
11
for the least efficient AAV-2, due to the enzyme-
linked immunosorbent assay detection limit of 10 ng/ml). Shown are
stable hFIX levels for each group as measured 6 weeks after the second
injection. (D) Sera were taken from the mice described in the legend
to panel C at the time of reinjection (bars H [higher dose]), as well as
from a parallel group injected with a lower dose (bars L) of 2 10
10
particles. Titers of neutralizing antibodies (NAb) against the wild-type
AAVs or AAV-DJ were determined as detailed in Materials and
Methods. pi, postinjection.
5900 GRIMM ET AL. J. V
IROL.
Conversely, attachment receptor binding seems less limiting
for AAV-DJ transduction (in the presence of a functional
HBD) than for transduction with the other vectors, as implied
by the consistently high potency of AAV-DJ in multiple dis-
tinct cell types. This finding suggested AAV-DJ as a promising
candidate for tissue retargeting approaches via viral peptide
display, in analogy to prior work with the AAV-2 prototype.
Importantly, by using AAV-DJ as a parental virus, we hoped to
overcome the two main drawbacks of AAV-2: the high preva-
lence of neutralizing antibodies and the typically slow intracel-
lular processing limiting transduction efficacy.
In addition to the use of an optimized capsid, we further
threefold improved our strategy over those described in the
prior reports by Michelfelder et al., Mu¨ller et al., Perabo et al.,
and Waterkamp et al. (48, 50, 58, 76). Firstly, we wanted to
ensure that the HBD in AAV-DJ was nonfunctional to in-
crease the likelihood that any new cell tropism was truly me-
diated by the displayed peptides. Previously, the loss of the
heparin binding capability of the AAV-2 capsid had been
achieved indirectly and incompletely, through steric hindrance
and conformational effects resulting from the peptide inser-
tion. Here, we additionally mutated one of the two critical
arginines in this domain (R585) to fully abolish binding to
heparin or the heparan sulfate proteoglycan receptor. Sec-
ondly, we assembled our random peptide library based on an
(NNB)
7
oligonucleotide, where B symbolizes the nucleotide C,
G, or T. Compared to the (NNK)
7
scheme (where K represents
G or T) used in three of the four previous studies (48, 50, 76),
our design further decreases the statistical risk of the unwanted
incorporation of a stop codon (only one, TAG, remains pos-
sible among 48 triplets), from 3.1% (NNK) to 2.1% (NNB).
Notably, our library still closely mimicks the natural amino acid
distribution (see Fig. S6 in the supplemental material). Thirdly
and most importantly, we reckoned that using AAV-DJ as a
highly efficient parental capsid would permit the biopanning of
our library under the physiologically most relevant conditions,
i.e., in mice in vivo. This was a critical improvement over all
previously reported selection schemes, in which AAV libraries
were panned exclusively on cultured cells in vitro. For this goal,
we chose the lung as a second target because it offers the extra
benefit that it is a natural site of adenovirus infection, implying
the feasibility of productively coamplifying AAV and helper
virus particles in this organ in vivo.
The AAV-DJ peptide display library was constructed by
modifying the basic three-step cloning scheme devised for
AAV-2 by Mu¨ller et al. (50), with the two mentioned improve-
ments of an additional R585Q mutation and the use of (NNB)
7
21-mers for peptide coding. However, we maintained the con-
cept of displaying the targeting peptide ligands after residue
R588, a locale successfully used by many groups. The resulting
plasmid library had a diversity of 3 10
7
clones, which is well
in the range of the four previously described AAV-2 counter-
parts (with estimated diversities of 1.2 10
7
to 1.7 10
8
clones) (48, 50, 58, 76). Analyses of 24 individual clones con-
firmed the complete randomization of the inserted oligonucle-
otides and the absence of repetitive sequences in our library
(data not shown). Of the 168 triplets in these clones, only three
carried the single possible stop codon TAG, representing a
1.8% frequency in our plasmid library (see Fig. S6 in the
supplemental material). This level was even below the theo-
retical prediction for the (NNB)
7
design (2.1%) and also
slightly below previous results with an AAV-2 (NNK)
7
library
(about 2%, with a theoretical possibility of 3.1%) (50, 76).
Very similar data (not shown) were obtained for an AAV-2-
based library that we generated in parallel, by following the
same rules, as a control for the AAV-DJ library. Both plasmid
libraries were then packaged into virions (in 2 10
9
cells, to
maintain library diversity), resulting in large and complex viral
libraries with titers of 5 10
12
(AAV-2) and 5.8 10
12
(AAV-DJ) particles/ml, matching or in fact slightly exceeding
(in the case of AAV-DJ) the highest numbers reported previ-
ously (5.5 10
12
) (76).
In vivo biopanning of peptide-modified AAV capsids in
mouse lung tissue. Critical to the success of AAV capsid evo-
lution is to find an ideal multiplicity of infection giving minimal
target cell transduction with a single or only a few particles,
which are subsequently amplified by the helper virus. This
approach will avoid the uncoupling of genotypes and pheno-
types, which can occur if cells are initially infected with excess
AAV particles and which will hamper the selection process.
Likewise crucial is to find a helper virus dose resulting in
efficient yet slow infection, giving the AAVs enough time for
productive amplification. To optimize these parameters, we
nasally coinfected mouse lungs with various multiplicities of
infection of the AAV-2- and AAV-DJ-based libraries, ranging
from 10
9
to 10
11
physical particles, together with escalating
volumes (0.2, 1, and 5 l) of human or murine adenovirus
stocks (from the ATCC). Our aim was to find the virus dose
combination that would allow PCR detection of amplified
AAV particles in helper virus-infected mice but not in controls
lacking the adenovirus. The mice were maintained for 4 or 7
days before their lungs were harvested. At the highest dose of
murine adenovirus (5 l of ATCC stock VR-550), all lungs had
macroscopic evidence of tissue inflammation. In contrast, mice
inoculated with the human adenovirus lacked any gross signs of
infection, and their lungs looked normal under all conditions
(doses and time points).
A comparison of the results with various AAV doses showed
that inoculation with 10
10
AAV-DJ library particles gave the
ideal result, i.e., a clear band for the murine helper virus-
treated mice but no or very faint signals in the absence of
adenovirus (data not shown). Conversely, we did not obtain
bands with the same dose of the AAV-2 library, regardless of
the absence or presence of helper virus, and there was also no
detectable AAV amplification in any mice infected with the
human helper virus. Together, these findings confirmed that
the AAV-DJ particles had successfully replicated their ge-
nomes in the mouse lungs in the presence of the appropriate
murine helper. Moreover, the fact that we observed AAV-2
amplification only from a 10-fold-higher starting dose of 10
11
particles validated our hypothesis that using AAV-DJ as a
parental capsid would increase the in vivo fitness of an AAV
library compared to that of a library based on the convention-
ally used serotype 2.
We next cloned the amplified AAV-DJ genomes from three
mice and sequenced 15 to 24 clones per mouse. We were able
to read 46 full sequences, whose translation and alignment are
shown in Table 5 (for amino acid compositions, see Fig. S6 in
the supplemental material). Clearly, the most notable obser-
vation was the enrichment with peptides NSSRDLG and ND
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5901
VRAVS in the first mouse. This result was curious, as the
identical peptides had previously been isolated independently
from an AAV-2-based library after in vitro passaging on two
other cell types, coronary arterial and venous endothelial cells
(50, 76). Several other findings were also interesting. Firstly, we
noted the recurrence of particular peptide motifs composed of
the amino acids D-V-R and S-R-D-G in different arrange-
ments among all three mice (Table 5). The two lead peptides
from mouse 1 were also enriched with S-R-D(-G-V) residues
in distinct permutations. Secondly, we discovered an elevated
frequency (3-fold over that predicted) of arginines (R) in
positions 4 of the peptides, especially apparent again in the two
lead candidates. Thirdly, the frequency of glycine (G) residues
was also markedly increased (from a predicted 6% to 15 to
20%) in multiple positions, particularly 1 and 7 (the start and
end points of the peptides), but also 4. As a result of the G/R
increase in positions 4, the overall frequency of hydrophilic
amino acids in this spot was also elevated (from a predicted 55
to 61%), like that of positively charged residues (from a pre-
dicted 15 to 26%). A last remarkable finding was a drop in
negatively charged polar amino acid frequency from a pre-
dicted 10% to 2 and 4% for positions 6 and 7, respectively, and
a concurrent mild increase in the frequency of noncharged
polar residues (from 30% to 33 and 35%). Conversely, the
frequency of hydrophilic amino acids was lowest (46%, down
from a predicted 55%) in positions 6.
Generally, we noted high-level diversity among the peptide
sequences from different mice or even among those from the
same animal. This finding was not surprising, in light of iden-
tical and consistent prior results from in vitro biopannings of
AAV-2 libraries on cultured cells (48, 50, 58, 76). As discussed
later, there are several possible explanations for this sequence
diversity, especially the very complex lung architecture, with
multiple cells and receptors. Another important factor was that
the sequences in Table 5 were obtained after a single infection
round, implying that consecutive in vivo reamplification may
result in further enrichment with specific peptides. However,
we actually failed to detect AAV DNA signals in new animals
infected with whole-lung protein extracts. The most likely rea-
son was the generation of neutralizing antibodies in the pri-
mary immunocompetent mice, and this possibility was indeed
corroborated by the lack of signs of adenovirus infection in
secondary animals, even after prolonged incubation. We there-
fore pooled the extracts from mice 1 and 2 from the first round
and depleted the extracts of murine Igs by using a commercial
kit. The cleared eluates were then used for reinfection, to-
gether with freshly added murine helper virus. This approach
resulted in the expected lung infection and inflammation at day
7 and enabled us to PCR amplify and clone replicated AAV
genomes from total lung DNA. Surprisingly, we found all 24
analyzed clones from the second round to be identical and to
encode the peptide MVNNFEW. This sequence was unique
and had been observed neither in the original unselected li-
brary nor in the three primary mice.
Analyses of lung cell tropisms of peptide-modified AAV-DJ
vectors. Our next goal was to study whether the isolated pep-
tides would confer new tropism on the AAV-DJ capsid in
murine lungs in vivo. We therefore engineered luciferase-ex-
pressing recombinant AAV-DJ vectors to display the NSS
RDLG peptide (the peptide most frequently recovered in the
first round) (Table 5) or the MVNNFEW peptide (the peptide
from the second round) and infused them by nasal aspiration
at a dose of 10
11
particles per mouse. As controls, we applied
the identical vector genomes corresponding to unmodified DJ
capsids, the DJ-2/8 HBD mutant capsid, or the wild-type
AAV-8 capsid. In vivo luciferase expression was monitored
starting at day 1 and continuing over 4 weeks, before all major
tissues including lungs were extracted and imaged separately.
The representative mice shown in Fig. 10A exemplify an
approximate twofold variation in overall lung transduction ef-
TABLE 5. Peptide sequences from in vivo biopanning in
murine lungs
a
Mouse
(no. of clones)
Peptide
(frequency)
Charge pattern
Hydrophobicity
pattern
1 (19) NSSRDLG (4) xxx⫹⫺yy ⫺⫺⫺⫺⫺⫹⫹
NDVRAVS (3) xyyyx ⫺⫺⫹⫺⫹⫹⫺
NWLLDSG xyxxxy ⫺⫹⫹⫹⫺⫺⫹
NTQDVNK xxxyx ⫺⫺⫺⫺⫹⫺⫺
GLEGSSN yyyxxx ⫹⫹⫺⫹⫺⫺⫺
GEQSSFG yxxxyy ⫹⫺⫺⫺⫺⫹⫹
SADRQGP xy⫺⫹xyy ⫺⫹⫺⫺⫺⫹⫹
DELQGCT ⫺⫺yxyxx ⫺⫺⫹⫺⫹⫺⫺
VLDGMCR yyyyx ⫹⫹⫺⫹⫹⫺⫺
DNNGLVV xxyyyy ⫺⫺⫺⫹⫹⫹⫹
ADWLCRA yyyxy ⫹⫺⫹⫹⫺⫺⫹
GKEKDTI y⫹⫺⫹⫺xy ⫹⫺⫺⫺⫺⫺⫹
HCMVRPC xyyyx ⫺⫺⫹⫹⫺⫹⫺
KMEGIFN yyyyx ⫺⫹⫺⫹⫹⫹⫺
2 (16) YGGSRSN xyyxxx ⫺⫹⫹⫺⫺⫺⫺
DLRVQGC yxxyx ⫺⫹⫺⫹⫺⫹⫺
DFSVSFV yxyxyy ⫺⫹⫺⫹⫺⫹⫹
HDVRWAV yyyyy ⫺⫺⫹⫺⫹⫹⫹
WVRDVML yy⫹⫺yyy ⫹⫹⫺⫺⫹⫹⫹
ARATDRV yyxyy ⫹⫺⫹⫺⫺⫺⫹
VALGRES
yyyy⫹⫺x ⫹⫹⫹⫹⫺⫺⫺
FVLTVGG yyyxyyy ⫹⫹⫹⫺⫹⫹⫹
SYRVQTS xxyxxx ⫺⫺⫺⫹⫺⫺⫺
ICEGHSR yxyx ⫹⫺⫺⫹⫺⫺⫺
GLRQPFS yyxyyx ⫹⫹⫺⫺⫹⫹⫺
ASSVYWY yxxyyyy ⫹⫺⫺⫹⫺⫹⫺
VIISPTS yyyxyxx ⫹⫹⫹⫺⫹⫺⫺
KDIVRKV ⫹⫺yy⫹⫹y ⫺⫺⫹⫹⫺⫺⫹
KPGGNQL yyyxxy ⫺⫹⫹⫹⫺⫺⫹
GTGTQSD yxyxxx- ⫹⫺⫹⫺⫺⫺⫺
3 (11) RDVDVGR ⫹⫺yyy ⫺⫺⫹⫺⫹⫹⫺
DVGRIRD yyy⫹⫺ ⫺⫹⫹⫺⫹⫺⫺
GDVDSNK yy-xx ⫹⫺⫹⫺⫺⫺⫺
GKFGSGP yyyxyy ⫹⫺⫹⫹⫺⫹⫹
SMEPRLC xyyyx ⫺⫹⫺⫹⫺⫹⫺
DGSTLTR
yxxyx ⫺⫹⫺⫺⫹⫺⫺
LYKDSGY yx⫹⫺xyy ⫹⫺⫺⫺⫺⫹⫺
EAERGRY y⫺⫹yx ⫺⫹⫺⫺⫹⫺⫺
IDGGWMI yyyyyy ⫹⫺⫹⫹⫹⫹⫹
CWWQEYN xyyxxx ⫺⫹⫹⫺⫺⫺⫺
LKASVLW yyxyyy ⫹⫺⫹⫺⫹⫹⫹
a
Shown are 46 peptide sequences from AAV genomes isolated from mouse
lungs (from three individual animals) after in vivo biopanning of the AAV-DJ-
based peptide display library. The peptides NSSRDLG and NDVRAVS were
isolated four and three times, respectively, from the same mouse (all others were
isolated once). Residues or short sequence motifs that were enriched in all three
animals (see the text) are in bold or underlined. Also shown is the pattern of
amino acid side chains, with the following classifications: , positively charged;
, negatively charged; x, uncharged polar; and y, nonpolar. Moreover, their
classification according to hydrophobicity is listed, in which represents hydro-
phobic and represents hydrophilic.
5902 GRIMM ET AL. J. VIROL.
ficacies among the five vectors, with the NSSRDLG mutant
peptide (and the AAV-8 capsid) typically yielding slightly be
tter results than the other three DJ variant forms. This finding
was corroborated by the imaging of isolated lungs (Fig. 10B).
Notably, analyses of all other main tissues gave no evidence for
vector spillover beyond the lung (data not shown).
In a parallel biodistribution study, we systemically infused all
vectors at an intermediate dose of 2 10
11
particles via
peripheral tail vein injection (Fig. 10C). Whole-body imaging
revealed comparable levels of liver transduction for most DJ
vectors and AAV-8, corroborating our hFIX expression data
(see above) (Fig. 7). The only exception was the MVNNFEW
mutant vector, which consistently gave two- to threefold-lower
luciferase levels than the others. The imaging of all other
major tissues gave no clear evidence for the retargeting of the
two peptide mutants to a particular organ, including the lungs,
from this injection route (data not shown). Intriguingly, this
finding seems to contradict the results of a prior study in which
the NSSRDLG peptide mediated systemic AAV-2 detargeting
from the liver and retargeting to the heart (50). As discussed
later, these discrepancies may be due to several crucial differ-
ences between the two studies.
The luciferase data had validated lung transduction with all
vectors but gave no information on the infected cell types. We
thus nasally infused a new set of vectors based on all four DJ
variants, expressing -galactosidase from a CMV promoter.
Two weeks later, the lungs were perfused with agarose, sec-
tioned, and X-Gal stained. A number of salient observations
are depicted in Fig. 10D. Firstly, both the unmodified DJ and
the HBD mutant (a control lacking a peptide insert) strongly
FIG. 10. Analyses of in vivo transduction with peptide-displaying AAV-DJ capsid variants. (A) Wild-type FVB mice were nasally infected with
luciferase-expressing AAV vectors as described in the text. Shown are representative examples of lung-directed luciferase expression (numbers
below the image are photon counts) 7 days after the inoculation. The black arrow highlights an example of very occasionally observed vector
spillover into the stomach (an artifact from the installation procedure). DJ, parental AAV-DJ; NSS, NSSRDLG mutant; MVN, MVNNFEW
mutant; HBD, HBD-negative AAV-DJ/8 mutant; 8, wild-type AAV-8. (B) In vitro imaging of isolated lungs confirmed the similarity of luciferase
expression levels among all vectors and the mild trend toward higher numbers with the NSSRDLG variant. C, control. (C) Representative examples
of results for wild-type FVB mice 7 days after peripheral injection (via the tail vein) with all luciferase-expressing vectors as described in the text.
Note the slight (two- to threefold) drop in expression from the MVNNFEW mutant compared to that from the other vectors. (D) Histological
analyses (by X-Gal staining) of murine lungs 2 weeks after nasal infection with -galactosidase-expressing AAV-DJ variants (5 10
10
particles
per mouse). Shown are various representative examples of different sections at different magnifications (100 or 200) for each mouse. Black
arrows highlight the predominantly transduced cell type for each capsid: (putative) alveolar type II cells for the NSSRDLG variant and alveolar
macrophages for the MVNNFEW peptide. The arrows in the images corresponding to the AAV-DJ/8 mutant-infected mouse (labeled HBD)
point at occasionally observed positive alveolar cells, while the main transduction target was pulmonary endothelial or smooth muscle cells (top
frame), identical to the target of the parental AAV-DJ capsid (the middle frame corresponding to the AAV-DJ-infected mouse shows a vessel
cross-section). Sections from an uninfected control mouse (rightmost frames) showed no background signals, with the exception of very faint
macrophage staining that was also found in sections from the other mice (not visible here, except in those from the MVNNFEW mutant-infected
mouse, which had stronger and more clustered signals than sections from the other mice).
V
OL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5903
transduced cells of the vasculature (likely pulmonary endothe-
lial cells or smooth muscle cells), whereas these particular cells
were entirely negative with the two peptide mutants. Secondly,
the HBD mutant but not wild-type DJ additionally infected
occasional alveolar cells, which by size, morphology, and loca-
tion appeared to be type II cells. Thirdly, these specific cells
were in fact the main and only distinct target of the NSSRDLG
mutant. This obvious contrast to DJ or the HBD mutant high-
lights the retargeting effect (from endothelial to alveolar cells)
mediated by this particular peptide. Yet, both endothelial and
alveolar cells in lungs infected with the MVNNFEW mutant
were conspicuously negative. Instead, we observed a mild in-
crease in the staining of yet another dispersed cell type, alve-
olar macrophages. In fact, these cells stained faintly positive in
all mice (not visible in Fig. 10D), including an uninfected
control (right panels) which was otherwise entirely negative.
Even so, the apparent increase in alveolar macrophage trans-
duction with the MVNNFEW mutant may well explain the
origin of luciferase expression depicted in Fig. 10A and B, as
well as the loss of liver signals (Fig. 10C). Moreover, the evo-
lution of macrophage tropism during AAV passaging in the
presence of helper virus would be highly reasonable, as these
cells are a main target for adenovirus infection in the lung.
AAV capsid library biopanning in all major organs. Encour-
aged by the results with lung tissue, we performed a pilot study
to assess the potential of our libraries for biopanning in all
major tissues of a mouse. We therefore injected two mice each
with 5 10
11
particles from the original shuffled library or the
AAV-DJ-derived peptide display library. A week later, we
harvested nine major tissue types and screened total genomic
DNA for the presence of AAV viral DNA via PCR. As seen in
Fig. 11, we could clearly detect AAV cap genes in all samples,
although we noted differences among the individual tissues and
animals (note that the PCR was not quantitative). Strong sig-
nals were consistently observed in liver, heart, kidney, and
spleen tissues, the typical AAV targets (compare Fig. 8). How-
ever, we also obtained good bands for all four brain DNA
samples, exemplifying the potential of our unselected libraries
to infect tissues that are otherwise inaccessible to the majority
of AAVs (in particular, from peripheral virus application).
Our next question was whether we would also be able to
enrich optimized capsids or further targeting peptides from
these organs. For proof of the concept, we performed the
following injections (route and tissue harvested are shown in
parentheses): (i) shuffled library (intranasally, lung), (ii) shuf-
fled library (intravenously, liver), and (iii) AAV-2 peptide li-
brary (intravenously, liver). We chose the AAV-2-based library
since AAV-DJ had already been evolved on liver cells, lower-
ing the chances of recovering hepatotropic peptides. We in-
jected one mouse each for injections i and ii (shuffled libraries)
with 5 10
11
particles, as well as one mouse for injection iii
(AAV-2 peptide library) with 2 10
12
particles. Because of
the overall lower level of in vivo fitness of the AAV-2 library,
we used a four-times-higher dose than that used before in the
biodistribution study with the AAV-DJ counterpart (Fig. 11) in
order to permit efficient PCR recovery of viral genomes. All
three mice were additionally coinfected with murine adenovi-
rus (5 l of ATCC stock VR-550) to help AAV genome am-
plification.
One week after virus installation, the two lungs and the liver
from each mouse were harvested, and potentially replicated
and enriched AAV genomes were cloned and sequenced (from
the 3 end over 500 nucleotides, including those correspond-
ing to the HBD and peptide insertion, respectively). Of 20
clones per mouse, we obtained readable sequences for 14 from
injection i (shuffled-library particles in lung tissue), 18 from
injection ii (shuffled-library particles in liver tissue), and 19
from injection iii (AAV-2 peptide particles in liver tissue). We
first performed alignments of the 32 sequences from the shuf-
fled library with the 8 parental viral genomes. Although the
numbers of mice and clones per group were too low for com-
prehensive statistical analyses, we observed markedly different
trends between the lung and liver samples. In lung samples, 6
of 14 clones had retained the AAV-2 HBD, whereas the others
were homologous in this region to AAV-8 (1 of 14), AAV-9 (1
of 14), or avian AAV (6 of 14) and thus lacked heparin binding
capability. Conversely, only 2 of 18 liver clones had the AAV-2
HBD region, while 6 of 18 carried the corresponding sequence
from AAV-8, 8 of 18 had that from AAV-9, and 2 of 18 carried
the sequence from avian AAV. In summary, 43% of lung
clones contained an HBD, as opposed to only 11% from the
liver tissue. Moreover, it was noteworthy that we unambigu-
FIG. 11. Biodistribution of AAV capsid libraries following periph-
eral delivery (via tail vein injection). Wild-type FVB mice were infused
with 5 10
11
particles of the shuffled (A) or AAV-DJ-based peptide
display (B) library, and 1 week later, all major organs were harvested
for the preparation of total genomic DNA. AAV DNA genomes were
detected via PCR using primers flanking the entire cap gene (2.2 kb;
arrows). Numbers (in kilobases) on the left refer to a DNA size
marker. Shown are results from two representative mice per injection
protocol. Note that AAV DNA signals could be detected in all ana-
lyzed tissues, including brain tissue, highlighting the potential for the
biopanning and evolution of AAV capsids in all major organs in vivo.
5904 GRIMM ET AL. J. V
IROL.
ously recovered avian AAV sequences in 8 of the 32 clones,
although this serotype was lost in our in vitro selection proto-
cols. The opposite was observed for serotypes 4 and 5, which
were present in clones after in vitro selection but missing in the
32 (partial) sequences from lung and liver tissues. Finally, it
was interesting that in all eight avian AAV sequence-contain-
ing clones, the 3 ends (bases 2069 to 2208) were identical and
were from AAV-2.
Curious results were also obtained with the 19 clones from
the AAV-2 peptide library from liver tissue (Table 6). As in
our prior findings with lung tissue, we recovered a specific
sequence twice, NRGYGAE. We also noted a significant in-
crease in glycine but also asparagine residues (G, 22.6% versus
6.3% predicted by the NNB design; N, 9.0% versus 4.2%), as
well as enrichment with a G-V motif in half of the clones (9 of
19). The glycine residues accumulated particularly in positions
1 and 3 to 5 of the peptides, whereas positions 1 were enriched
with N. This pattern was reminiscent of our lead peptides
recovered from lung tissue before and also similar to that of
many clones previously isolated by others from various cell
types (48, 50, 76), perhaps suggesting a general benefit from
asparagine in this spot (see Discussion). Concurrent with the
glycine accumulation in the center of the peptide, we found a
marked increase in hydrophobic nonpolar residues in positions
3 and 4 to about 80 and 60%, respectively (normal would be
45%).
In analogy to our lung work before, we finally tried to further
amplify the potentially enriched and replicated AAV genomes
in the liver extract from a second mouse. Yet, this time we
consistently failed to detect AAV signals in tissue from the
reinfected mouse, regardless of identical attempts to purify
anti-AAV and -adenovirus IgGs from the tissue extract. Our
most likely explanation is that unlike that in the lung, the
adenovirus used for coinfection had not been able to exert the
full helper function for the AAV particles in the liver. Inter-
estingly, the mouse had been visibly sick at the time of organ
harvesting, and the liver was pale, both observations indicative
of successful adenovirus infection. Thus, the inability to ream-
plify AAVs from the liver but not the lung implies a tissue-
specific block in the life cycle of AAV or adenovirus (or both),
preventing the production of infectious AAV progeny. Alter-
natively or in addition, it is possible that the infection condi-
tions for the first mouse (doses, ratios of adenovirus and AAV,
and time points) require further fine-tuning to increase the
amount of amplified AAV for reinoculation.
DISCUSSION
Our long-standing goal, to optimize the AAV vector system
for therapeutic liver transduction, has now led us to devise
novel methods for directed AAV diversification from a multi-
species set of wild-type viruses. The potent molecular evolu-
tion technologies reported here, DNA family shuffling and in
vivo biopanning, should significantly complement the current
strategies. Indeed, DNA family shuffling provides numerous
benefits, as is evident from a comparison of three key param-
eters: diversity, complexity, and versatility. First and foremost,
the diversity in our library, before and after selection, was
markedly enhanced over that described in all prior reports.
Individual capsids from our unselected library had as little as
50% homology to the AAV-2 prototype, and our lead can-
didate (AAV-DJ) differed from its closest natural relative,
AAV-2, by 60 residues (of 737 [8.1%]). This high degree of
diversity resulted from the recombination of largely different
parental viruses and was further increased by sporadic point
mutations. Also, data for wild-type AAVs (11, 18, 44) imply
that individual clones can recombine during library growth on
cells, further enhancing diversity and explaining the similarity
of our pools A and B. In striking contrast, the highest level of
diversity achieved before was a difference of only seven resi-
dues, in the case of peptide display libraries (50, 58, 76). More-
over, since all insertions occured at the same location, diver-
sification by continuous recombination was unlikely. A
maximum of six mutations prior to selection was the upper
limit for the second library type, created by error-prone PCR
amplification of the AAV-2 capsid gene (46, 59). Postselection,
respective lead candidates were 99.9% identical to wild-type
AAV-2, differing by only one or two residues. Hence, the sum
of all previous attempts at directed AAV evolution, including
four libraries and over 370 mutants from multiple groups (also
counting site-directed mutagenesis strategies [42]), did not
change more than 1% of capsid residues, at best.
DNA family shuffling also appears to be superior to all
nonlibrary strategies for the creation of AAV hybrids, includ-
ing transcapsidation, marker rescue, and rational domain
swapping (8, 30, 62, 64). From therapeutic and technical stand-
points, a drawback of the first two approaches is the poor
reproducibility, as the genetic templates are not recovered.
This problem is solved by the domain-cloning strategy, yet this
method can yield hybrids not only identical in phenotype to the
parental viruses but also sometimes being noninfectious alto-
gether (64, 85). Rational domain swapping also remains ham-
pered by our limited knowledge of the structure-function re-
TABLE 6. Peptide sequences from in vivo biopanning in murine
liver tissue
a
Peptide
(frequency)
Charge pattern Hydrophobicity pattern
NRGYGAE (2) xyxyy ⫺⫺⫹⫹⫹⫹⫺
NLTSGVY xyxxyyx ⫺⫹⫺⫺⫹⫹⫺
NSLGSTV xxyyxxy ⫺⫺⫹⫹⫺⫺⫹
NEARLQG xyyxy ⫺⫺⫹⫺⫹⫺⫹
NQVGKGT xxyyyx ⫺⫺⫹⫹⫺⫹⫺
GPGSYRE yyyxx⫹⫺ ⫹⫹⫹⫺⫺⫺⫺
GSPVGQR yxyyyx ⫹⫺⫹⫹⫹⫺⫺
GRAPSST yyyxxx ⫹⫺⫹⫹⫺⫺⫺
GSDGNMS yxyxyx ⫹⫺⫺⫹⫺⫹⫺
GVGVGGI yyyyyyy ⫹⫹⫹⫹⫹⫹⫹
RGGDGSW yyyxy ⫺⫹⫹⫺⫹⫺⫹
DRMVGEG ⫺⫹yyyy ⫺⫺⫹⫹⫹⫺⫹
STVGERV xxyy⫺⫹y ⫺⫺⫹⫹⫺⫺⫹
MDGNHRM yyx⫹⫹y ⫹⫺⫹⫺⫺⫺⫹
LRIGVAN yyyyyx ⫹⫺⫹⫹⫹⫹⫺
KNGVNAG xyyxyy ⫺⫺⫹⫹⫺⫹⫹
FNSAMSL yxxyyxy ⫹⫺⫺⫹⫹⫺⫹
HIRSQMA yxxyy ⫺⫹⫺⫺⫺⫹⫹
a
Shown are 19 peptide sequences from AAV genomes isolated from murine
liver tissue (from one animal, injected with 2 10
12
particles of the AAV-2-
based peptide display library). The peptide NRGYGAE was isolated twice, and
all others were isolated once. Residues or short sequence motifs that were
enriched are underlined. See Table 5 for the definition of symbols indicating
amino acid classifications.
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5905
lationships for most non-2 serotypes. The same issue continues
to restrict the expansion of peptide display into alternative
serotypes, with only a few reports of such expansion to date (4,
38). In this respect, a benefit of the AAV-2 HBD in AAV-DJ
was that it allowed the straightforward adaptation of peptide
display methodology. To our knowledge, we are in fact the first
to utilize a synthetic AAV capsid for peptide display and also
for library biopanning in vivo. Error-prone PCR is theoretically
easier to adapt than peptide-based strategies, as it does not rely
on sequence knowledge. Yet, the inherently low level of diver-
sity will pertain as a drawback regardless of the parental virus.
Thus, we believe that at this point, DNA family shuffling is the
only available method able to yield highly variable libraries
whose generation is neither serotype restricted nor limited by
our knowledge (or lack thereof) of capsid structures and func-
tions and which truly represent the viral diversity found in
nature.
Complexity, i.e., the number of diverse capsids in the library,
is a second crucial aspect of evolution methods. A good ap-
proximation is the number of bacterial colonies in the plasmid
DNA library. Yet, equally important factors that are often
ignored in the literature are the degree of interclonal diversity
and technical aspects. For example, the simplicity of peptide
insertions that require only direct cloning facilitates the cre-
ation of large bacterial libraries with up to 10
8
clones (50, 58,
76). This high level of efficacy was readily reproduced with our
own peptide libraries and their complexities of 3 10
7
clones. PCR randomization is also undemanding, well estab-
lished, and adaptable, thus easily yielding 10
6
to 10
7
capsid
mutants when used for AAV-2 diversification (46, 59). Yet,
such numbers may overestimate the true functional complex-
ity, due to contamination with wild-type AAV-2 or pheno-
copies that falsely raise the library titer. Also, many resulting
plasmids do not yield functional virions and are lost during
selection. A good measure for vitality is particle yield per
transfected cell during viral library production. Our high final
titer of 8.2 10
11
particles/ml, or 3.3 10
12
total virions, is
thus remarkable, as it translates into 3,300 full capsids/cell.
These numbers match or exceed the best prior results, indic-
ative of the high degree of vitality of our shuffled library. This
vitality was expected, as the principle of DNA family shuffling
is homology-based, in-frame recombination of functional se-
quences. Even so, we cannot technically rule out that our
library contained noninfectious clones, similar to observations
with domain swapping (64). Notably, our typical AAV-DJ vec-
tor yields (including those of all mutants) of 10
13
particles/ml
also exceeded those of earlier chimeras (e.g., reference 76),
further supporting the high degrees of vitality and stability of
the chimeric AAV sequences in our library. Accordingly, we
are pleased with the complexity of our pilot shuffled plasmid
library of 7 10
5
clones, especially as we had used extreme
parameters, i.e., eight parental AAVs with as little as 50%
homology. We can readily anticipate that future libraries based
on fewer and/or more-related serotypes will have even higher
levels of complexity. It will also always be feasible to increase
the titer and complexity by upscaling library production.
Together, diversity and complexity determine a third param-
eter, versatility. DNA family shuffling also excels here and
expands on existing technologies. We define versatility as the
sum of viral properties, particularly within a single capsid, that
can be molecularly evolved. Peptide display libraries are lim-
ited in this regard, as their main purpose is to improve a single
parameter, tropism. Some inserts may diminish antibody rec-
ognition (33) or affect intracellular processing, but it remains a
restriction that only receptor binding is subjected directly to
selection. Also, as the capsid gene itself remains unaltered,
there is no evolution pressure on the underlying AAV DNA
per se. In contrast, error-prone capsid gene mutation via PCR
can theoretically alter any residue. Yet, the random and inef-
ficient nature of this method limits library diversity, complex-
ity, and vitality and, thus, versatility. A main drawback is that
the technique will typically yield only one or two viable muta-
tions per capsid. Although single residue switches can alter the
AAV phenotype (42, 84), such events are probably rare and
hard to recap with such libraries. Considering the structure of
AAV capsids, with 60 subunits and up to 735 residues each,
it is statistically unlikely that all viral properties can be en-
hanced by random point mutation. In fact, the only two appli-
cations reported to date increased AAV-2 capsid resistance to
neutralizing antibodies (46, 58). This result was expected, as
prior work had already shown the role of specific residues in
antibody recognition (42, 84). Yet, it is unclear how the same
technique could be used to improve other properties, or even
multiple features at once, especially ones relying on several
dispersed residues or domains. The versatility of classical li-
braries is further restricted if they are derived from AAV-2 (as
are almost all to date), as the remaining 99% identity sug-
gests that all capsids will share some of the adverse features
that hamper AAV-2 use in humans, including susceptibility to
the prevalent immunity.
In conclusion, DNA family shuffling may be the most pow-
erful and potent library-based AAV evolution method to date.
With its hallmark of recombination of functional genes, it is an
ideal tool to molecularly breed novel viruses merging multiple
properties in a single capsid. This capacity is exemplified by our
lead candidate, AAV-DJ, which is best characterized as a mag-
nified AAV-2. It merges AAV-2 assets—high-level and broad-
range in vitro efficiency, binding to the AAV-2 receptor, and
relatively restricted in vivo biodistribution—with those of
AAV-8 and AAV-9—superb liver performance, plus the ability
to evade preexisting human immunity. By actually surpassing
the in vitro efficacy of the best parental wild-type AAVs,
AAV-DJ also demonstrates the great potential of DNA family
shuffling to create de novo gain-of-function phenotypes. At this
point, we are unaware of another synthetic capsid combining a
similar extent of valuable assets in a single sequence or any
other evolution method providing the same potential to con-
currently create high degrees of diversity and versatility (while
maintaining reasonable complexity and high-level vitality).
In addition, DNA family shuffling is a potent reverse-genet-
ics tool to study AAV biology. We have provided examples of
gain- and loss-of-function phenotypes that it can create and
that give insights into diverse viral properties, such as antibody
binding and protease cleavage. We also indirectly confirmed
key residues constituting the HBD (previously identified via
mutagenesis; R484-487-585-588 and K532 [37, 56]), based on
conservation in all our selected clones and the critical role of
the HBD in vitro. Many dispersed amino acids earlier identi-
fied as antigenic determinants in AAV-2 were also recognized
in AAV-DJ by alignment with clones evolved without IVIG.
5906 GRIMM ET AL. J. VIROL.
Examples are AAV-2 R471, N705, and V708, which are critical
for IVIG resistance (42), and R459, the mutation of which
permits escape from anti-AAV-2 antibodies (59). Our align-
ments also confirmed many of the HVRs in the capsid gene
(11, 16) and identified various new areas of diversity. We
recently reported the first AAV-8 receptor (LamR) (1), plus an
endosomal protease (cathepsin B) involved in intracellular
capsid processing (2), and had proposed before that rapid
nuclear uncoating is key to potent AAV-8 transduction (73).
Future comparisons of shuffled and wild-type capsids will help
to further unravel the sequences and mechanisms underlying
such viral properties.
Equally crucial for an AAV evolution approach is particle
selection and its stringency and clinical relevance, and both
were maximized in our study. We particularly consider our use
of pooled human antisera (IVIG) for selection an advance in
stringency and clinical relevance over approaches described in
prior reports, which relied solely on single antisera. These
single antisera do not represent the assortment of anti-AAV
antibodies in the human population, leaving the usefulness of
the evolved particles unclear. The necessity to use pools is
validated by a report by Huttner et al., who compared the
activities of 65 human serum samples toward AAV-2 mutants
(33). Depending on the peptide insertion site, they found sub-
stantial differences between individual sera in the ability to
bind and/or to neutralize AAV-2 capsids, implying that monos-
election is insufficient. As further evidence, AAV-2 variants
with point mutations evolved with a single antiserum varied
fourfold in their capacities for escape from seven other sera
(59).
A second benefit from IVIG was that it forced the evolution
of a single hybrid, AAV-DJ, that was not recovered under less
stringent conditions. Our key conclusion is that library growth
on cells already permissive for one or more parental AAVs is
insufficient to select individual capsids. Instead, we obtained
pools of related AAVs with homology to AAV-2 and inter-
spersed regions from other AAVs. Notably, we also isolated
similarly related derivatives of serotypes 2, 4, 5, 8, and 9 but no
single lead candidates from human embryonic kidney cells (293
cells) and mouse fibroblast (NIH 3T3) or liver (Hep1A) cells
(data not shown). Most likely key to our success, and likely
imperative for future attempts, was to combine stringent pos-
itive pressure (growth on cells) and negative pressure (IVIG).
Under these conditions, IVIG exerted dual functions. It forced
the elimination of immunogenic residues and favored the in-
fectious capsids best able to rapidly escape from neutralization.
This conclusion is supported by our result that IVIG was active
in culture for 12 h, maintaining pressure on the replicating
AAVs. It also explains the superiority of AAV-DJ in vitro,
because we inadvertently selected for a capsid that was ex-
tremely robust at transducing cells. Some prior evolution at-
tempts also yielded capsids more infectious than that of
AAV-2, but usually the increase was lower than that with
AAV-DJ (about twofold) (e.g., reference 59). These capsids
were also not tested thoroughly and mostly not in vivo. As of
now, we do not fully understand all the properties of the
AAV-DJ capsid, but most likely, they are determined by syn-
ergistic or additive contributions from the parental strains,
such as the juxtaposition of multiple peptide motifs potentially
involved in cell binding, viral uptake, and subsequent steps
(Fig. 12; also see below). Indeed, less-chimeric capsids (ob-
tained without IVIG pressure, e.g., those in pools A and B in
Fig. 3) yielded lower levels of gene expression in mice, more
like those yielded by AAV-2 (data not shown).
FIG. 12. Model of an AAV VP3 trimer (panel A, top view down the
threefold symmetry axis; panel B, side view) created using Swiss-Pdb-
Viewer (www.expasy.org/spdbv/text/getpc.htm) and the VIPER oligomer
generator (viperdb.scripps.edu/oligomer_multi.php), with the following
parameters: T1 capsid structure; selected matrices A5, A6, and A17;
and Protein Data Bank file no. 1LP3 (Fig. 2C) for the AAV-2 sequence.
Sequence motifs that may contribute to AAV receptor binding are col-
ored as follows (serotypes with the highest degree of conservation are
shown in parentheses): purple, HPD; red, motif with similarity to the
NSSRDLG peptide (in AAV-DJ and AAV-2, 534-NGRDSL-539; num-
bers refer to the AAV-DJ sequence) (compare Fig. 2D); blue, motif with
similarity to the NDVRAVS peptide (in AAV-DJ and AAV-2, 505-RV
S[KT]SADNNNS-516); and yellow, another motif with (partial) similarity
to the NSSRDLG peptide (in AAV-DJ and AAV-9, 277-SGGSSNDN-
284). Note how all four motifs are exposed on the capsid surface (B) and
how pairs of motifs are located in close proximity to each other (yellow
and red motifs or blue and purple motifs), as well as near the HBD
(purple), suggesting that they may act cooperatively in receptor binding.
Intriguingly, AAV-DJ has the only capsid combining all four motifs in one
sequence, perhaps contributing to its high level of efficacy (see the text).
V
OL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5907
Another key observation was that library growth on cultured
cells invariably led to enrichment with the AAV-2 HBD. This
bias is likely inherent in any in vitro selection strategy (pro-
vided that the library contains AAV-2), considering the role of
the HBD in culture. Whether or not its presence is ultimately
useful depends on the application. With the liver as our main
target, the presence of the HBD was highly rewarding due to
the multifaceted role of the HBD in vector biodistribution.
Restricted dissemination after intravenous delivery and mini-
mal brain transduction (unlike the transduction patterns oc-
curing with AAV-8 and AAV-9) are significant benefits for
human liver gene therapy. More work is needed to elucidate
the underlying mechanism(s), but an HBD may affect capsid
stability in the blood or the particles’ ability to traverse the
endothelial cell lining, two prerequisites to transducing remote
organs. Notably, a homologous domain was recently associated
with capsid-specific T-cell responses in nonhuman primates
injected intramuscularly with AAV-2 vectors (74). Yet, it re-
mains unclear whether and to what extent these monkey stud-
ies can explain findings in a clinical trial in which one patient
injected intraportally with an AAV-2 vector developed cyto-
lytic T cells against capsid-bearing hepatocytes. The authors of
the study attributed the incident to two immunogenic peptides
in the AAV-2 capsid (47). These are absent in AAV-DJ (Fig.
2D); instead, this capsid part is identical to AAV-8, which did
not elicit a T-cell response in the primate study. Yet, recent
findings suggest that non-2 serotypes may also be able to elicit
T-cell responses, depending on AAV-specific CD8
memory T
cells (49). Clearly, more work and in vivo data are needed to
truly understand the anti-AAV cellular immune response and
the potential role of the HBD. Importantly, as the constituting
residues are known, it is trivial to mutate lead capsids should
heparin binding be undesired for an application. Yet, another
asset will then also be lost, i.e., the usefulness of the HBD for
heparin affinity purification, a scalable and thus superior
method to CsCl gradient centrifugation.
Our preliminary data from in vivo biopanning in liver and
lung tissues revealed a set of crucial principles which may be
broadly applicable to other AAV evolution strategies. Firstly,
we noted that the outcomes of in vitro and in vivo evolution
can largely differ. For instance, we frequently recovered avian
AAV DNA in vivo, despite its absence after in vitro selection,
and vice versa for AAV-4 and AAV-5. This result also under-
scores the diversity and complexity of our initial library, which
evidently contained functional capsids derived from all par-
ents. Secondly, the dependencies on heparin binding differed
in vitro and in vivo and in distinct tissues. Our pilot data
suggest that heparin binding, which is critical for in vitro trans-
duction, may be more important in lung tissue than in liver
tissue. This possibility is in line with our results that at higher
doses, the HBD-deficient AAV-DJ mutants, as well as AAV-8
and AAV-9, transduced liver tissue better than AAV-DJ. We
also noted a much higher proportion of AAV-8 and AAV-9
sequences in liver tissue (14 of 18 sequences; 78%) than in lung
tissue (2 of 14 sequences; 14%), corroborating the fact that
AAV-8 and AAV-9 are the best-known AAVs for the liver. It
is also in line with the high percentage of AAV-8 and AAV-9
sequences in AAV-DJ (Table 2). On the other hand, the inhi-
bition of heparin binding hampered liver transduction with the
less efficient AAV-2 (Fig. 7C), and adding an HBD to AAV-8
was also disruptive. Thus, the addition or deletion of an HBD
must be considered carefully for each target (cell or tissue
type), application (ex or in vivo), and capsid.
A third set of key principles was evident from comparisons
to data in the literature. A salient finding was that our two
major peptides from lung tissue had previously been selected
from an AAV-2 peptide library on arterial or venous endothe-
lial cells (50, 76). Similar sequences were also isolated from
acute myeloid leukemia cells in a third study (48). We envision
multiple explanations for this phenomenon. One is that iden-
tical peptides confer distinct effects, e.g., on tropisms, upon
exposure on various AAV backbones. This factor may also
explain why in the AAV-DJ context, the NSSRDLG peptide
did not alter liver transduction while it detargeted AAV-2 (50).
Albeit unlikely, we also cannot technically rule out that our
lung sample was marginally contaminated with heart tissue and
that the lung tropisms were secondary. Yet, a more probable,
captivating possibility is that the NSSRDLG peptide and re-
lated motifs bind to a common receptor present on all cells
from which these sequences have been isolated to date: alve-
olar, coronary arterial, venous endothelial, and acute myeloid
leukemia cells. Indeed, we noted several conspicuous similar-
ities between our clones and many prior lead peptides, sup-
porting the idea of affinity for the same or related receptors.
These similarities include the observation that many peptides
were generally enriched with the amino acids A, D, G, L, N, R,
S, and V. Likewise, an N in the first position and an R in the
fourth position were noted suspiciously frequently in peptides
from lung tissue (also in our lead peptide from liver tissue,
NRGYGAE) as well as earlier. A third, indirect piece of evi-
dence for binding to widely present receptors is that some prior
lead peptides mediated good transduction levels across a panel
of cell lines (76).
Curious in this regard is the recent identification of a new
integrin V1 binding motif in AAV-2 and a few other sero-
types (5). Intriguingly, this motif (NGR) is part of a larger
sequence with striking similarity to the NSSRDLG peptide,
i.e., NGRDSL. The latter is fully conserved in AAV-2 and
AAV-DJ (and serotypes 3 and 10) and located on the capsid
exterior near the HBD, in line with its putative role in integrin
binding. Moreover, we identified two further intriguing motifs
within AAV-DJ VP, another one similar to NSSRDLG and
one resembling the second lead peptide identified in the
present study and that by Mu¨ller et al., NDVRAVS (50). Both
motifs are also displayed on the capsid (Fig. 12B); in fact, all
four (including the HBD) are located very close to one another
and near the threefold symmetry axis (Fig. 12A). Together with
our findings described above, these results make it tempting to
speculate that these three additional motifs contribute to the
binding of AAV receptors, e.g., integrins. An appealing ensu-
ing idea is that AAV-DJ’s superior efficacy on multiple cell
types is due in part to the fact that AAV-DJ combines all four
motifs in one sequence, unlike any wild-type AAV. The obser-
vation that the binding of AAV-DJ to cultured cells is in fact
inferior to that of AAV-2 would suggest that the putative
additional receptors act as entry, but not attachment, mole-
cules. This idea is in line with the roles of different integrins,
which cooperatively act as secondary entry receptors for many
viruses, including V1/V5 for AAV-2 (5). The high level of
efficacy of AAV-DJ may then indeed result from synergism
5908 GRIMM ET AL. J. VIROL.
from the juxtaposition of multiple parental properties: binding
to potent primary attachment and secondary entry receptors
and efficient intracellular processing. Further investigations
into the true nature of the receptors recognized by selected
peptides will certainly be very exciting and important.
In the future, the optimization of in vivo evolution schemes
should become a top priority, starting with the AAV helper
virus, for multiple reasons. Obvious factors are toxicity and
safety issues, but equally critical is the influence of the helper
virus on the outcome of selection. AAV libraries can amplify
only in coinfected cells, permitting the helper virus to dictate
and restrict the tropism of the evolving AAV particles. This
property is shown by our findings with lung tissue, in which our
lead candidates mimicked adenoviral biodistribution. An in-
triguing possible solution may be to clone and express the
adenoviral helper genes (E1, E2A, E4orf6, and VA genes)
from a second AAV library in parallel. Other promising steps
toward routine in vivo evolution would be the use of immuno-
deficient animals or mice with humanized tissues. It remains to
be tested whether this approach will help to overcome another
hurdle seen in our pilot studies, the block in the AAV or
adenoviral life cycle in the liver (and maybe elsewhere). For
adenovirus, this problem may also be solved by the expression
of the relevant genes from AAV.
Optimized selection schemes will then be useful to resolve
many key aspects of AAV vector evolution. For example, par-
allel in vivo screening of libraries based on different capsids
will clarify the role of the hosting virus and the locations and
flanking sequences for the displayed peptides. The use of
AAV-2-based libraries may be challenging due to the relatively
low level of in vivo fitness of the underlying virus, yet our data
for liver tissue already show the potential of this approach.
Better animal models will also help us to unravel the function
of our other lead peptide, MVNNFEW. Thus far, our data
imply tropism for alveolar macrophages, albeit this requires
validation due to the background staining of alveolar macro-
phages from even naı¨ve mice. Enrichment with this peptide
after IgG depletion suggests an alternative function, i.e., to
reduce the recognition of the hosting capsid by neutralizing
antibodies. This phenomenon was noted anecdotally before
(33) and may be due to sterical or conformational effects,
masking immunogenic residues or domains in the capsid. In
our case, it is possible that during IgG depletion of our primary
lung extract, we also eliminated all capsids still attached to the
antibodies, perhaps excluding the MVNNFEW virus which
could escape from this procedure. Alternatively, multiple cap-
sids may have evaded depletion but only the MVNNFEW
clone could also reamplify in the secondary lung. To distin-
guish these conceivable possibilites, we will now rescreen our
libraries in immunodeficient animals and will purify selected
target cells prior to AAV rescue and reamplification.
Finally, essential is the potential clinical usefulness of the
AAV clones evolved in this work. For our in vivo-selected
capsids, our proof-of-concept data may be too limited to sug-
gest specific uses, as more factors remain to be studied, includ-
ing biodistribution, doses, time points, delivery routes, and
comparisons to more wild-type AAVs. Further in vitro work
analogous to and beyond our experiments presented in Fig. 6
will also aim to unravel their mechanisms of transduction. On
the other hand, we can envision multiple ex or in vivo gene
therapy applications for AAV-DJ vectors. Their high-level ef-
ficacy at low doses, from a clinically feasible administration
route, implies a use for systemic therapies of hepatodeficien-
cies such as the hemophilias. The slower kinetics at extreme
doses are irrelevant because of the high-level efficiency, with a
minimal dose of 5 10
10
particles per mouse, or 2.5 10
12
particles/kg of body weight, already sufficing for the expression
of 400% of normal hFIX levels. This dose equals the highest
particle load in the clinical trial, although the inferior AAV-2
capsid produced only 12% of normal hFIX levels (still in the
therapeutic range) (47). Despite the blunted response, the
hFIX expression level of 300 g/ml from the highest
AAV-DJ dose exceeds most reported data for mice. Also, the
extreme dose at which AAV-DJ transduction became satu-
rated would correspond to a level of 2 10
16
particles in
humans, which is technically impossible to produce or admin-
ister. Finally, combining potent AAV capsids with efficient
self-complementary genomes will allow effective particle doses
to be lowered further by at least an order of magnitude (20, 26,
28, 54). Hence, we doubt that dosing will ultimately limit ther-
apies in humans and rather assume that issues such as biodis-
tribution will prevail. This conclusion already justifies the fur-
ther preclinical evaluation of AAV-DJ, despite the strong
competition from wild types 8 and 9. It was no surprise that the
in vivo efficacy of AAV-DJ did not exceed their in vivo efficacy,
considering that they have evolved to outperform most AAVs
in mammalian tissues (19, 52). It is still essential to have an-
other similarly efficient AAV at our disposal, due to the esca-
lating evidence that findings with mice are not inevitably pre-
dictive for higher species (17, 32, 54, 75). Consequently, the
next challenge will be to translate AAV-DJ for use in appro-
priate large animals and verify our results in a context more
relevant to humans.
Of note, AAV-DJ may prove very useful for an emerging
new clinical application, liver RNAi to treat hepatocellular
carcinoma or infection with hepatitis viruses (25, 28). We re-
cently evaluated AAV-8 vectors for this purpose and observed
lethalities in mice, caused by rapid high-level expression of
short hairpin RNAs (shRNAs) (28). Due to its more gradual
onset of gene expression at high doses, the use of AAV-DJ for
shRNA expression may minimize the risk of overloading the
cellular RNAi machinery (28) while yielding sufficient shRNAs
to achieve therapeutic effects. The reduced vector dissemina-
tion would further limit toxicity and enhance safety, especially
in combination with our latest liver-specific shRNA expression
cassettes (Giering et al., submitted for publication).
The ultimate task remains to engineer AAV capsids to
merge specificity with efficiency and safety and tailor them to
patient or disease profiles. We anticipate that DNA family
shuffling will play a major role in the future, as it is applicable
to all natural AAVs and can readily be adapted for directed
vector evolution toward many applications. With the rapidly
progressing discovery of multispecies AAVs, expanding our
repertoire of capsid genes, it should soon be embraced as the
most potent technology for AAV diversification. Moreover,
our promising pilot efforts toward in vivo biopanning may help
to pave the way for future evolution attempts under physio-
logically and clinically pertinent conditions. The key technol-
ogies and principles established here raise optimism that our
work will bring us several steps closer to all these critical goals.
VOL. 82, 2008 AAV VECTOR EVOLUTION VIA INTERBREEDING AND RETARGETING 5909
ACKNOWLEDGMENTS
We thank Brian Garrison for expert help with the cultivation of the
human hepatocytes and Kusum Pandey for excellent technical assis-
tance. We are very grateful to James Wilson for providing AAV-8 and
AAV-9 helper plasmids and express our gratitude to Jay Chiorini and
Rob Kotin for their kind gifts of plasmids harboring the avian or
bovine AAV capsid genes.
This work was supported by NIH grant HL64274 and the California
Institute for Regenerative Medicine.
REFERENCES
1. Akache, B., D. Grimm, K. Pandey, S. R. Yant, H. Xu, and M. A. Kay. 2006.
The 37/67-kilodalton laminin receptor is a receptor for adeno-associated
virus serotypes 8, 2, 3, and 9. J. Virol. 80:9831–9836.
2. Akache, B., D. Grimm, X. Shen, S. Fuess, S. R. Yant, D. S. Glazer, J. Park,
and M. A. Kay. 2007. A two-hybrid screen identifies cathepsins B and L as
uncoating factors for adeno-associated virus 2 and 8. Mol. Ther. 15:330–339.
3. Arbetman, A. E., M. Lochrie, S. Zhou, J. Wellman, C. Scallan, M. M.
Doroudchi, B. Randlev, S. Patarroyo-White, T. Liu, P. Smith, H. Lehmkuhl,
L. A. Hobbs, G. F. Pierce, and P. Colosi. 2005. Novel caprine adeno-associ-
ated virus (AAV) capsid (AAV-Go.1) is closely related to the primate
AAV-5 and has unique tropism and neutralization properties. J. Virol. 79:
15238–15245.
4. Arnold, G. S., A. K. Sasser, M. D. Stachler, and J. S. Bartlett. 2006. Meta-
bolic biotinylation provides a unique platform for the purification and tar-
geting of multiple AAV vector serotypes. Mol. Ther. 14:97–106.
5. Asokan, A., J. B. Hamra, L. Govindasamy, M. Agbandje-McKenna, and R. J.
Samulski. 2006. Adeno-associated virus type 2 contains an integrin 51
binding domain essential for viral cell entry. J. Virol. 80:8961–8969.
6. Bartlett, J. S., J. Kleinschmidt, R. C. Boucher, and R. J. Samulski. 1999.
Targeted adeno-associated virus vector transduction of nonpermissive cells
mediated by a bispecific F(ab’)
2
antibody. Nat. Biotechnol. 17:181–186.
7. Bleker, S., F. Sonntag, and J. A. Kleinschmidt. 2005. Mutational analysis of
narrow pores at the fivefold symmetry axes of adeno-associated virus type 2
capsids reveals a dual role in genome packaging and activation of phospho-
lipase A2 activity. J. Virol. 79:2528–2540.
8. Bowles, D. E., J. E. Rabinowitz, and R. J. Samulski. 2003. Marker rescue of
adeno-associated virus (AAV) capsid mutants: a novel approach for chimeric
AAV production. J. Virol. 77:423–432.
9. Buning, H., M. U. Ried, L. Perabo, F. M. Gerner, N. A. Huttner, J. Enssle,
and M. Hallek. 2003. Receptor targeting of adeno-associated virus vectors.
Gene Ther. 10:1142–1151.
10. Chang, C. C., T. T. Chen, B. W. Cox, G. N. Dawes, W. P. Stemmer, J.
Punnonen, and P. A. Patten. 1999. Evolution of a cytokine using DNA family
shuffling. Nat. Biotechnol. 17:793–797.
11. Chen, C. L., R. L. Jensen, B. C. Schnepp, M. J. Connell, R. Shell, T. J. Sferra,
J. S. Bartlett, K. R. Clark, and P. R. Johnson. 2005. Molecular character-
ization of adeno-associated viruses infecting children. J. Virol. 79:14781–
14792.
12. Choi, V. W., D. M. McCarty, and R. J. Samulski. 2005. AAV hybrid sero-
types: improved vectors for gene delivery. Curr. Gene Ther. 5:299–310.
13. Christians, F. C., L. Scapozza, A. Crameri, G. Folkers, and W. P. Stemmer.
1999. Directed evolution of thymidine kinase for AZT phosphorylation using
DNA family shuffling. Nat. Biotechnol. 17:259–264.
14. Crameri, A., S. A. Raillard, E. Bermudez, and W. P. Stemmer. 1998. DNA
shuffling of a family of genes from diverse species accelerates directed evo-
lution. Nature 391:288–291.
15. Crameri, A., E. A. Whitehorn, E. Tate, and W. P. Stemmer. 1996. Improved
green fluorescent protein by molecular evolution using DNA shuffling. Nat.
Biotechnol. 14:315–319.
16. Gao, G., M. R. Alvira, S. Somanathan, Y. Lu, L. H. Vandenberghe, J. J. Rux,
R. Calcedo, J. Sanmiguel, Z. Abbas, and J. M. Wilson. 2003. Adeno-associ-
ated viruses undergo substantial evolution in primates during natural infec-
tions. Proc. Natl. Acad. Sci. USA 100:6081–6086.
17. Gao, G., Y. Lu, R. Calcedo, R. L. Grant, P. Bell, L. Wang, J. Figueredo, M.
Lock, and J. M. Wilson. 2006. Biology of AAV serotype vectors in liver-
directed gene transfer to nonhuman primates. Mol. Ther. 13:77–87.
18. Gao, G., L. H. Vandenberghe, M. R. Alvira, Y. Lu, R. Calcedo, X. Zhou, and
J. M. Wilson. 2004. Clades of adeno-associated viruses are widely dissemi-
nated in human tissues. J. Virol. 78:6381–6388.
19. Gao, G. P., M. R. Alvira, L. Wang, R. Calcedo, J. Johnston, and J. M. Wilson.
2002. Novel adeno-associated viruses from rhesus monkeys as vectors for
human gene therapy. Proc. Natl. Acad. Sci. USA 99:11854–11859.
20. Gao, G. P., Y. Lu, X. Sun, J. Johnston, R. Calcedo, R. Grant, and J. M.
Wilson. 2006. High-level transgene expression in nonhuman primate liver
with novel adeno-associated virus serotypes containing self-complementary
genomes. J. Virol. 80:6192–6194.
21. Girod, A., M. Ried, C. Wobus, H. Lahm, K. Leike, J. Kleinschmidt, G.
Deleage, and M. Hallek. 1999. Genetic capsid modifications allow efficient
re-targeting of adeno-associated virus type 2. Nat. Med. 5:1052–1056.
22. Grifman, M., M. Trepel, P. Speece, L. B. Gilbert, W. Arap, R. Pasqualini,
and M. D. Weitzman. 2001. Incorporation of tumor-targeting peptides into
recombinant adeno-associated virus capsids. Mol. Ther. 3:964–975.
23. Grimm, D. 2002. Production methods for gene transfer vectors based on
adeno-associated virus serotypes. Methods 28:146–157.
24. Grimm, D., and M. A. Kay. 2003. From virus evolution to vector revolution:
use of naturally occurring serotypes of adeno-associated virus (AAV) as
novel vectors for human gene therapy. Curr. Gene Ther. 3:281–304.
25. Grimm, D., and M. A. Kay. 2006. Therapeutic short hairpin RNA expression
in the liver: viral targets and vectors. Gene Ther. 13:563–575.
26. Grimm, D., K. Pandey, and M. A. Kay. 2005. Adeno-associated virus vectors
for short hairpin RNA expression. Methods Enzymol. 392:381–405.
27. Grimm, D., K. Pandey, H. Nakai, T. A. Storm, and M. A. Kay. 2006. Liver
transduction with recombinant adeno-associated virus is primarily restricted
by capsid serotype not vector genotype. J. Virol. 80:426–439.
28. Grimm, D., K. L. Streetz, C. L. Jopling, T. A. Storm, K. Pandey, C. R. Davis,
P. Marion, F. Salazar, and M. A. Kay. 2006. Fatality in mice due to over-
saturation of cellular microRNA/short hairpin RNA pathways. Nature 441:
537–541.
29. Grimm, D., S. Zhou, H. Nakai, C. E. Thomas, T. A. Storm, S. Fuess, T.
Matsushita, J. Allen, R. Surosky, M. Lochrie, L. Meuse, A. McClelland, P.
Colosi, and M. A. Kay. 2003. Preclinical in vivo evaluation of pseudotyped
adeno-associated virus vectors for liver gene therapy. Blood 102:2412–2419.
30. Hauck, B., L. Chen, and W. Xiao. 2003. Generation and characterization of
chimeric recombinant AAV vectors. Mol. Ther. 7:419–425.
31. Hauck, B., and W. Xiao. 2003. Characterization of tissue tropism determi-
nants of adeno-associated virus type 1. J. Virol. 77:2768–2774.
32. Herzog, R. W. 2007. Immune responses to AAV capsid: are mice not humans
after all? Mol. Ther. 15:649–650.
33. Huttner, N. A., A. Girod, L. Perabo, D. Edbauer, J. A. Kleinschmidt, H.
Buning, and M. Hallek. 2003. Genetic modifications of the adeno-associated
virus type 2 capsid reduce the affinity and the neutralizing effects of human
serum antibodies. Gene Ther. 10:2139–2147.
34. Inagaki, K., S. Fuess, T. A. Storm, G. A. Gibson, C. F. McTiernan, M. A. Kay,
and H. Nakai. 2006. Robust systemic transduction with AAV9 vectors in
mice: efficient global cardiac gene transfer superior to that of AAV8. Mol.
Ther. 14:45–53.
35. Jang, J. H., K. I. Lim, and D. V. Schaffer. 2007. Library selection and
directed evolution approaches to engineering targeted viral vectors. Biotech-
nol. Bioeng. 98:515–524.
36. Kay, M. A., C. S. Manno, M. V. Ragni, P. J. Larson, L. B. Couto, A.
McClelland, B. Glader, A. J. Chew, S. J. Tai, R. W. Herzog, V. Arruda, F.
Johnson, C. Scallan, E. Skarsgard, A. W. Flake, and K. A. High. 2000.
Evidence for gene transfer and expression of factor IX in haemophilia B
patients treated with an AAV vector. Nat. Genet. 24:257–261.
37. Kern, A., K. Schmidt, C. Leder, O. J. Muller, C. E. Wobus, K. Bettinger,
C. W. Von der Lieth, J. A. King, and J. A. Kleinschmidt. 2003. Identification
of a heparin-binding motif on adeno-associated virus type 2 capsids. J. Virol.
77:11072–11081.
38. Koerber, J. T., J. H. Jang, J. H. Yu, R. S. Kane, and D. V. Schaffer. 2007.
Engineering adeno-associated virus for one-step purification via immobilized
metal affinity chromatography. Hum. Gene Ther. 18:367–378.
39. Kolkman, J. A., and W. P. Stemmer. 2001. Directed evolution of proteins by
exon shuffling. Nat. Biotechnol. 19:423–428.
40. Kronenberg, S., B. Bottcher, C. W. von der Lieth, S. Bleker, and J. A.
Kleinschmidt. 2005. A conformational change in the adeno-associated virus
type 2 capsid leads to the exposure of hidden VP1 N termini. J. Virol.
79:5296–5303.
41. Kwon, I., and D. V. Schaffer. 1 September 2007, posting date. Designer gene
delivery vectors: molecular engineering and evolution of adeno-associated
viral vectors for enhanced gene transfer. Pharm. Res. doi:10.1007/s11095-
007-9431-0.
42. Lochrie, M. A., G. P. Tatsuno, B. Christie, J. W. McDonnell, S. Zhou, R.
Surosky, G. F. Pierce, and P. Colosi. 2006. Mutations on the external sur-
faces of adeno-associated virus type 2 capsids that affect transduction and
neutralization. J. Virol. 80:821–834.
43. Loiler, S. A., T. J. Conlon, S. Song, Q. Tang, K. H. Warrington, A. Agarwal,
M. Kapturczak, C. Li, C. Ricordi, M. A. Atkinson, N. Muzyczka, and T. R.
Flotte. 2003. Targeting recombinant adeno-associated virus vectors to en-
hance gene transfer to pancreatic islets and liver. Gene Ther. 10:1551–1558.
44. Lukashov, V. V., and J. Goudsmit. 2001. Evolutionary relationships among
parvoviruses: virus-host coevolution among autonomous primate parvovi-
ruses and links between adeno-associated and avian parvoviruses. J. Virol.
75:2729–2740.
45. Lux, K., N. Goerlitz, S. Schlemminger, L. Perabo, D. Goldnau, J. Endell, K.
Leike, D. M. Kofler, S. Finke, M. Hallek, and H. Buning. 2005. Green
fluorescent protein-tagged adeno-associated virus particles allow the study of
cytosolic and nuclear trafficking. J. Virol. 79:11776–11787.
46. Maheshri, N., J. T. Koerber, B. K. Kaspar, and D. V. Schaffer. 2006. Di-
rected evolution of adeno-associated virus yields enhanced gene delivery
vectors. Nat. Biotechnol. 24:198–204.
47. Manno, C. S., G. F. Pierce, V. R. Arruda, B. Glader, M. Ragni, J. J. Rasko,
5910 GRIMM ET AL. J. VIROL.
M. C. Ozelo, K. Hoots, P. Blatt, B. Konkle, M. Dake, R. Kaye, M. Razavi, A.
Zajko, J. Zehnder, P. K. Rustagi, H. Nakai, A. Chew, D. Leonard, J. F.
Wright, R. R. Lessard, J. M. Sommer, M. Tigges, D. Sabatino, A. Luk, H.
Jiang, F. Mingozzi, L. Couto, H. C. Ertl, K. A. High, and M. A. Kay. 2006.
Successful transduction of liver in hemophilia by AAV-factor IX and limi-
tations imposed by the host immune response. Nat. Med. 12:342–347.
48. Michelfelder, S., M. K. Lee, E. DeLima-Hahn, T. Wilmes, F. Kaul, O.
Muller, J. A. Kleinschmidt, and M. Trepel. 2007. Vectors selected from
adeno-associated viral display peptide