Reduced E-cadherin expression correlates with disease progression in Paget's disease of the vulva but not Paget's disease of the breast

Article (PDF Available)inModern Pathology 21(10):1192-9 · June 2008with29 Reads
DOI: 10.1038/modpathol.2008.50 · Source: PubMed
Abstract
The growth and metastasis of many cancers is due in part to loss of cell-cell adhesion. E-cadherin, plakoglobin and beta-catenin are important in cell adhesion. Our aim was to examine the presence of these molecules in Paget's disease of the vulva and Paget's disease of the breast, and to correlate any differences in their expression with the presence of invasive disease or an underlying carcinoma. Sixty-three archival cases of Paget's disease of the vulva, including eight associated with invasive disease, and 23 archival cases of Paget's disease of breast, which included 10 cases with ductal carcinoma in situ alone, four cases with both ductal carcinoma in situ and invasive carcinoma, and five cases with underlying invasive carcinoma alone, were analysed immunohistochemically for expression of E-cadherin, plakoglobin and beta-catenin proteins. The respective mRNAs were also detected by in situ hybridisation using digoxigenin-labelled cRNA probes. Seventy-six percent (41/54) of Paget's disease of vulva cases had >50% of Paget cells expressing the E-cadherin protein, compared with 28 % (2/7) of Paget's disease vulva with invasive disease. This result was significant, with a P-value of 0.039. Twenty-five percent (14/55) of the intraepidermal Paget's disease of the vulva cases had >50% of Paget cells expressing the plakoglobin protein, compared with 12% (1/8) of cases of Paget's disease of vulva with invasive disease, and for beta-catenin, 9% (5/55) of the non-invasive Paget's disease of the vulva had >50% of Paget cells expressing beta-catenin, compared with 12% (1/8) of Paget's disease of the vulva cases with invasive disease. Sixty-five percent (15/23) of the Paget's disease of the breast had >50% of Paget cells expressing E-cadherin, and for plakoglobin and beta-catenin it was 17% (4/23) and 28% (6/21), respectively. The results were not significant. The results suggest that reduced expression of E-cadherin may have a role to play in the pathogenesis of invasive Paget's disease of the vulva. Abnormal plakoglobin expression may be involved in the formation of some cases of Paget's of the vulva and the breast.
Reduced E-cadherin expression correlates
with disease progression in Paget’s disease of
the vulva but not Paget’s disease of the breast
Patricia E Ellis
1
, Salvador Diaz Cano
2
, Mark Fear
2
, David P Kelsell
2
, Lucy Ghali
2
,
Julie C Crow
1
, Christopher W Perrett
1
and Allan B MacLean
1
1
Department of Obstetrics and Gynaecology, Royal Free and University College Medical School (Hampstead
Campus), University College London, London, UK and
2
Centre for Cutaneous Research, Institute of Cell and
Molecular Sciences, Barts and The London Queen Mary’s School of Medicine and Dentistry, London, UK
The growth and metastasis of many cancers is due in part to loss of cell–cell adhesion. E-cadherin, plakoglobin
and b-catenin are important in cell adhesion. Our aim was to examine the presence of these molecules in
Paget’s disease of the vulva and Paget’s disease of the breast, and to correlate any differences in their
expression with the presence of invasive disease or an underlying carcinoma. Sixty-three archival cases of
Paget’s disease of the vulva, including eight associated with invasive disease, and 23 archival cases of Paget’s
disease of breast, which included 10 cases with ductal carcinoma in situ alone, four cases with both ductal
carcinoma in situ and invasive carcinoma, and five cases with underlying invasive carcinoma alone, were
analysed immunohistochemically for expression of E-cadherin, plakoglobin and b-catenin proteins. The
respective mRNAs were also detected by in situ hybridisation using digoxigenin-labelled cRNA probes.
Seventy-six percent (41/54) of Paget’s disease of vulva cases had 450% of Paget cells expressing the E-
cadherin protein, compared with 28 % (2/7) of Paget’s disease vulva with invasive disease. This result was
significant, with a P-value of 0.039. Twenty-five percent (14/55) of the intraepidermal Paget’s disease of the vulva
cases had 450% of Paget cells expressing the plakoglobin protein, compared with 12% (1/8) of cases of Paget’s
disease of vulva with invasive disease, and for b-catenin, 9% (5/55) of the non-invasive Paget’s disease of the
vulva had 450% of Paget cells expressing b-catenin, compared with 12% (1/8) of Paget’s disease of the vulva
cases with invasive disease. Sixty-five percent (15/23) of the Paget’s disease of the breast had 450% of Paget
cells expressing E-cadherin, and for plakoglobin and b-catenin it was 17% (4/23) and 28% (6/21), respectively.
The results were not significant. The results suggest that reduced expression of E-cadherin may have a role to
play in the pathogenesis of invasive Paget’s disease of the vulva. Abnormal plakoglobin expression may be
involved in the formation of some cases of Paget’s of the vulva and the breast.
Modern Pathology (2008) 21, 1192–1199; doi:10.1038/modpathol.2008.50; published online 9 May 2008
Keywords:
E-cadherin; Paget’s disease; vulva
Paget’s disease of the vulva was described 100 years
ago.
1
It is rare and there still is a limited under-
standing about its association with cancer. Most
cases of Paget’s disease of the vulva are adenocarci-
noma in situ disease; however, in some cases there is
an associated invasive adenocarcinoma present.
Previous studies
2,3
have suggested that the fre-
quency of occurrence of an associated underlying
carcinoma is of the order of 10–30%. Some theories
suggest that intraepidermal adenocarcinoma cells
have metastasised to the overlying surface from the
underlying carcinoma, whereas others have sug-
gested that Paget cells migrate downwards to
develop invasive disease.
4
In contrast to Paget’s
disease of the vulva, the general consensus for
Paget’s disease of the breast, which was originally
described by Sir James Paget in 1874,
5
is that almost
all cases are associated with a ductal carcinoma in
situ (DCIS) or an invasive ductal carcinoma.
6
Cells within the epidermis are held together by a
number of adhesion complexes and their associated
proteins. The growth of many cancer cells has been
linked to the loss of negative regulation of cell
proliferation conferred by cell–cell adhesion. The
reduced expression or lack of cell adhesion molecules
has therefore been implicated in the invasion and
Received 01 October 2007; revised and accepted 01 February
2008; published online 9 May 2008
Correspondence: Dr PE Ellis, MBBS, MD, c/o Professor Allan
MacLean, Department of Obstetrics and Gynaecology, Royal Free
and University College Medical School (Hampstead Campus),
University College London, Rowland Hill Street, London NW3
2PF,UK. E-mail: peellis@hotmail.com
Modern Pathology (2008) 21, 11921199
&
2008 USCAP, Inc All rights reserved 0893-3952/08
$30.00
www.modernpathology.org
metastatic process.
7
Loss or decreased cell adhesive-
ness has been demonstrated in cancers and thought to
represent a greater risk of tumour dissemination.
8
E-cadherin is a member of a multifunctional
family of calcium-dependent, transmembrane gly-
coproteins, which promote and maintain cell adhe-
sion.
9
In vitro experiments have demonstrated
E-cadherin to have invasion-suppressing proper-
ties.
10,11
Downregulation of E-cadherin expression
has been documented in breast
12
and oesophageal
carcinomas,
7
squamous cell carcinomas of the skin
13
and bladder carcinomas.
14
Plakoglobin and b-catenin
are closely related proteins that have a key role in
cell adhesion (adherens junctions),
15
activation of
transcriptional factors, for example, T-cell factor
(Tcf)
16
and in the Wnt wingless-signalling path-
ways,
17
an important pathway in the development of
the cell and cancer.
The objective of this study was to determine
whether expression of E-cadherin, plakoglobin and
b-catenin correlated with disease progression in
Paget’s disease of the vulva and Paget’s disease of
the breast, in order to investigate the role of the
proteins as potential diagnostic markers. This study
complements our other work investigating the role
of the cell cycle and angiogenesis in Paget’s disease
of the vulva and Paget’s disease of the breast.
18,19
Materials and methods
Tissue Specimens
Ethical approval has been granted by the Royal Free
Hospital NHS Trust.
Sixty-three cases of Paget’s disease of the vulva,
including eight associated with invasive disease,
and 23 cases of Paget’s disease of the breast, which
included 10 cases with DCIS alone, four cases with
both DCIS and invasive carcinoma, five with an
underlying invasive carcinoma, and four with
Paget’s disease of the breast alone, were analysed
for expression of E-cadherin, plakoglobin and
b-catenin. These cases were retrieved from the
Histopathology Department at the Royal Free Hamp-
stead NHS Trust, and from collaborators as listed in
the acknowledgement section. The cases were
diagnosed and treated between 1984 and 2000.
The archival cases had all been formalin-fixed and
paraffin wax-embedded. Drs Diaz-Cano (SDC) and
Julie C Crow (JCC; collaborating Histopathologists)
reviewed all haematoxylin and eosin-stained
slides of the cases to confirm diagnosis of Paget’s
disease.
Immunohistochemistry
The streptavidin–biotin–peroxidase detection sys-
tem was employed for immunohistochemistry.
Paraffin wax-embedded sections of Paget’s tissue,
5-mm thick, were cut and mounted on aminopropyl-
triethoxysilane-coated glass slides. The sections
were deparaffinised in xylene (2 5 min) and rehy-
drated in graded solutions of ethanol (100, 90 and
70%, 3 min each). To block endogenous peroxidase,
sections were immersed in 3% hydrogen peroxide
in methanol for 10 min. The sections were then left
in running water (2 min). Conditions for antigen
retrieval, incubation times and the primary anti-
bodies used are described in Table 1. Sections were
incubated with the secondary antibody, biotinylated
rabbit anti-mouse IgG (1:50 dilution in phosphate
buffered-saline, PBS; Dako) for 30 min and washed
in PBS (3 5 min). Addition of streptavidin–biotin–
horseradish peroxidase complex (Dako) to the
sections (1:500 dilution in Tris-buffered saline) for
30 min was followed by a further wash in PBS
(3 min). Antibody binding was visualised with a
solution containing the chromogen 3,3
0
-diamino-
benzidine (Sigma-Aldrich, Poole, UK). The sections
were counterstained with Mayer’s haematoxylin
(Merck, Lutterworth, UK). Finally, slides were
rehydrated in graded ethanol rinses, cleared in
xylene and mounted in DPX.
Normal vulval skin was used as positive control
for cases of Paget’s disease of the vulva, and normal
breast skin was for cases of Paget’s disease of the
breast. Apocrine and eccrine glands were used as
internal controls. For negative controls, the primary
antibodies were replaced by PBS. Sections were
stained on two separate occasions and scored
separately by two individuals (SDC, PEE) to ensure
reproducibility. There was o5% variation between
sections and observers.
Table 1 Antibodies used, antigen retrieval and incubation times used for immunhistochemistry. Forward and reverse primer sequences
used for PCR
Antigen Source Clone Working dilution
a
Antigen retrieval Incubation time Primer
E-cadherin Zymed 36 1:250 Microwave
Pressure cooking
h TTAGGTTAGAGGGTTATCGCGT
TAACTAAAAATTCACCTACCGAC
Plakoglobin Zymed 15 1:100 Microwave
Pressure cooking
h GCCTGCCTTCTTCTTGTGTC
CTGAAGCTTTAGTGGCCAGG
b-Catenin Zymed 14 1:50 None h GGAGGTCTCCTTGGGACTC
ACTAGTCGTGGAATGGCACC
a
Diluted in PBS.
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1193
Modern Pathology (2008) 21, 11921199
The location of the pattern of staining of the
protein was recorded as one of the following:
membranous, diffuse cytoplasmic, paranuclear and
nuclear. To score, initially four quarters as a
percentage of Paget cells expressing each protein
were used. However, since the numbers were small
in each group, 50% positivity was used as threshold.
The intensity of staining was also recorded as either
nil, mild or strong.
In Situ Hybridisation
Paraffin-wax-embedded sections (5-mm thick) were
cut on Superfrost slides (Merk). Sections were
deparaffinised, microwaved in pre-warmed 10%
citrate buffer (10 min) and pre-hybridised at 421C
for 4 h. Following this, sections were hybridised
with 40 ng/ml of digoxigenin-labelled cRNA probe in
pre-hybridisation buffer containing 20% dextran
sulphate for overnight at 421C, using a Hybaid
Omnislide machine. Following stringency washes
to 0.1 SCC/50% formamide, sections were stained
with anti-digoxigenin-alkaline phosphatase Fab
fragments. After washing, sections were developed
with nitroblue tetrazolium chloride/bromo-chloro-
idoly-phosophate (Sigma) chromogen solutions.
Stained sections were scored for intensity of the
mRNA signal at the intracellular junctions. Nuclear
and cytoplasmic staining were recorded separately.
Sections were stained on two separate occasions and
the results analysed by two independent observers
(PEE and Lucy Ghali (LG)). There was o5%
variation between sections and observers. The
surrounding apocrine glands and epidermal cells
were used as positive controls. The sense (mRNA)
probe was used as the negative control. Primer
sequences for E-cadherin, plakoglobin and b-catenin
are described in Table 1.
Statistical Analysis
Statistical analysis was performed by w
2
and Fisher’s
exact tests, as appropriate. A P-value of o0.05 was
considered significant.
Results
Evaluation of E-cadherin, Plakoglobin and b-Catenin
in Paget’s Disease of the Vulva Without Invasive
Disease
Forty-one of the 54 (76%) cases of Paget’s disease of
the vulva without invasive disease had 450% of
Paget cells expressing E-cadherin (Figure 1). The
staining pattern was membranous and the intensity
of staining was mostly strong.
Six cases were suitable for scoring E-cadherin
mRNA. Decreased mRNA signal in the Paget cells
(Figure 2) was noted in all cases, as compared with
the surrounding apocrine glands and epidermal
cells.
Fourteen of 55 (25%) cases had 450% of Paget
cells expressing plakoglobin compared with 74%
with a score of o50% (Figure 3). In most cases the
staining pattern was membranous and the staining
intensity mild. Ten Paget’s disease of the vulva cases
were analysed for plakoglobin mRNA, but only eight
were suitable for scoring. All cases had decreased
mRNA signal in the Paget cells, compared with in
the apocrine and epidermal cells.
Only 5 of 55 (9%) cases had 4 50% of Paget cells
expressing the b-catenin protein, compared with 50
of 55 (91%) of cases with o50% (Figure 4). Again,
staining was membranous and intensity was mild.
Fifteen cases were analysed for b-catenin mRNA, but
only nine were suitable for scoring. Eight cases
revealed decreased mRNA signal in the Paget cells,
compared with the surrounding apocrine glands and
epidermal cells.
Figure 1 E-cadherin protein expression in non-invasive Paget’s
disease of the vulva ( 200) with a score of o50%.
Figure 2 E-cadherin mRNA signal in Paget cells in non-invasive
Paget’s disease of the vulva ( 200).
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1194
Modern Pathology (2008) 21, 11921199
Paget’s Disease of the Vulva with Invasive Disease
Two of seven (28%) cases had 450% of Paget cells
expressing E-cadherin. This result was significant,
P-value ¼ 0.039, when compared with 41/54 (76%)
of Paget’s disease of the vulva cases without invasive
disease.
One of eight (12%) cases had 450% of Paget cells
expressing the plakoglobin and b-catenin protein,
respectively. The results were not significant when
comparing with Paget’s disease of the vulva cases
without invasive disease. The staining pattern was
found to be membranous, cytoplasmic and nuclear,
and staining intensity was mild. One case of
invasive Paget’s disease of the vulva was suitable
for scoring E-cadherin and plakoglobin mRNA.
Decreased mRNA signal in the Paget cells was noted
in both cases as compared with the surrounding
apocrine glands and epidermal cells. The results are
presented in Table 2.
Evaluation of E-cadherin, Plakoglobin and b-Catenin
Expression in Paget’s Disease of the Breast
In Paget’s disease of the breast with DCIS alone
(10 cases), 5 cases (50%) had 450% of Paget cells
expressing E-cadherin. Only one case (10%) had
450% of Paget cells expressing plakoglobin, and 2
cases (20%) expressed b-catenin. Of the four cases of
Paget’s disease of the breast with DCIS and invasive
disease, all (100%) had 450% of Paget cells
expressing E-cadherin, and 2 (50%) had 450% of
Paget cells expressing plakoglobin and b-catenin.
There were five cases of Paget’s disease of the
breast with invasive disease, of which four (80%)
had 450% of Paget cells expressing E-cadherin.
One case (20%) had 450% of Paget cells expressing
plakoglobin and two cases (40%) had 450% of
Paget cells expressing b-catenin. Of the four cases of
Paget’s disease of the breast alone, two (50%) had
450% of Paget cells expressing E-cadherin (Figure 5).
Plakoglobin and b-catenin were not expressed in
450% of Paget cells (Figure 6). There was no
significant difference between the subsets of Paget’s
disease of the breast expressing E-cadherin, plako-
globin and b-catenin proteins. Table 2 shows the
subsets’ combined expression of E-cadherin, plako-
globin and b-catenin proteins. Nine of the 14 Paget’s
disease of breast cases, which included 4 with
associated DCIS, 4 with invasive carcinoma and one
case of Paget’s disease of the breast only, analysed
were suitable for E-cadherin mRNA scoring. In all
cases, the mRNA signal was found to be reduced in
the Paget cells as compared with the surrounding
apocrine glands and epidermal cells.
Figure 3 Plakoglobin protein expression in non-invasive Paget’s
disease of the vulva, with a score of o50%.
Figure 4 b-Catenin protein expression in non-invasive Paget’s
disease of the vulva ( 200) with a score of o50%.
Table 2 E-cadherin, plakoglobin and b-catenin expression in Paget’s disease of the vulva and Paget’s disease of the breast
Protein expression Paget’s disease of the vulva
with invasive disease
(threshold of positivity)
Paget’s disease of the vulva
without invasive disease
(threshold of positivity)
P-value Paget’s disease of the
breast (threshold of
positivity)
E-cadherin 2/7 ( 450%) 41/54 (450%) P ¼ 0.039
significant
15/23 (450%)
Plakoglobin 1/8 (450%) 14/55 (450%) P ¼ 0.77 4/23 (450%)
b-Catenin 1/8 (450%) 5/55 (450%) P ¼ 0.96 6/21 (450%)
P-value for Paget’s disease of the vulva with invasive disease compared with Paget’s disease without invasive disease.
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1195
Modern Pathology (2008) 21, 11921199
Eight of 11 cases of Paget’s disease of the breast,
which included 5 with associated DCIS, 4 with
invasive carcinoma and 2 with Paget’s disease of the
breast only, were suitable for scoring mRNA plako-
globin. The mRNA signal was noted to be decreased
or absent in the Paget cells, as compared with the
surrounding apocrine glands and epidermal cells.
Thirteen cases of Paget’s disease of the breast were
analysed for b-catenin mRNA, which included 6
with associated DCIS, 4 with invasive carcinoma
and 2 with Paget’s disease of breast only. In the 12
cases that were suitable for scoring, mRNA signal
was noted to be decreased in 10 cases as compared
with the surrounding apocrine glands and epider-
mal cells (Figure 7). The signal was found to be
similar in intensity in both the antisense and sense
slides in two cases.
Discussion
E-cadherin Expression in Paget’s Disease of the Vulva
This is the largest study of E-cadherin, plakoglobin
and b-catenin expression in Paget’s disease of the
vulva and Paget’s disease of the breast of which we
are aware. Since loss of expression of E-cadherin has
been suggested as one of the mechanisms contribut-
ing to development of invasion and metastasis of
cancer cells, its expression has been investigated in
several cancers with a view to correlating lack of
expression with invasive disease. Only two smaller
studies have examined this role in Paget’s disease of
the vulva. The Shirahama et al study
20
found that
E-cadherin was not expressed in their three cases of
Paget’s disease of the vulva, and Tada and co-
workers
21
showed decreased expression of E-cadherin
in their invasive Paget’s disease of the vulva (four
cases) compared with the in situ cases (four cases).
In the current study we found similar results.
E-cadherin expression was significantly reduced
(P ¼ 0.039) in the intraepidermal compartment of
the Paget’s disease of the vulva cases with invasive
disease when compared with the intraepidermal
compartment of Paget’s disease of the vulva cases
without invasive disease. Loss of E-cadherin expres-
sion is likely to lead to reduced cell adhesiveness
and therefore detachment of Paget cells from the
intraepidermal lesion, the result being invasive
disease. There appeared to be no significant differ-
ence in the cellular localisation of the proteins
between non-invasive and invasive Paget’s disease
of the vulva.
There was a decrease in mRNA signal intensity
when compared with the surrounding apocrine
glands and epidermal cells, in both non-invasive
Paget’s disease of the vulva, and in those cases
associated with invasive disease, suggesting de-
creased transcriptional regulation of the protein
Figure 6 b-Catenin protein expression in Paget’s disease of the
breast alone ( 200) with a score of o50%.
Figure 7 b-Catenin mRNA signal in Paget’s disease of the breast
alone ( 100).
Figure 5 E-cadherin protein expression in Paget’s disease of the
breast alone ( 200) with a score of 450%.
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1196
Modern Pathology (2008) 21, 11921199
rather than factors affecting its stability and degra-
dation.
Plakoglobin Expression in Paget’s Disease of the Vulva
The reduced expression of cell adhesion molecules
has been implicated in promoting invasion and
metastasis.
22,23
There is a paucity of information
regarding expression of plakoglobin, E-cadherin and
b-catenin in Paget’s disease of the vulva and, as
such, the role of these molecules has not been
clearly established in Paget’s disease of the vul-
va.
20,21,24
To our knowledge, only one study has
examined the expression of plakoglobin in Paget’s
disease of the vulva. Tada et al
24
examined the
expression of desmoglein I and plakoglobin in skin
carcinomas, which included 11 cases of extramam-
mary Paget’s disease; only one case was from a
female of which the location was documented as the
pudendum. This case was negative for plakoglobin.
In the current study, fewer Paget cells expressed
plakoglobin in the intraepidermal compartment of
the Paget cases with invasive disease when com-
pared with the intraepidermal compartment of
Paget’s disease cases without invasive disease,
although this did not reach statistical significance.
Plakoglobin mRNA signal was also decreased com-
pared with the surrounding apocrine glands. These
findings may suggest a possible dysfunction in the
regulation of plakoglobin in Paget’s disease of the
vulva with invasive disease, as compared with those
cases without invasion. Nuclear and diffuse cyto-
plasmic staining of the plakoglobin protein was
noted in 13 of the cases, with only one case being
associated with invasive disease.
b-Catenin Expression in Paget’s Disease of the Vulva
The transcriptional activity of b-catenin and its
degradation are regulated by the Wnt pathway. In
normal epithelial cells, b-catenin is localised at the
cell membrane. The unbound b-catenin is degraded
by the ubiquitin–proteasome system, which
involves the GSK-3b. Stabilisation of cytoplasmic
b-catenin by aberrant activation of Wnt signalling
leads to its accumulation, complex with lymphoid
enhancer factor/Tcf (LEF/Tcf) transcription factors
and transactivation of LEF/Tcf target genes. Activa-
tion of these genes can lead to cell proliferation or
inhibition of apoptosis. Nuclear accumulation of
b-catenin can be the result of gene mutations.
25
In
colon cancers, disruption of the Wnt-signalling
pathway by mutations of either the adenomatous
polyposis coli or the b-catenin gene plays a crucial
part in the early stage of tumorigenesis.
26
In the
current study, diffuse cytoplasmic and paranuclear
staining of the b-catenin protein was found in 11
and four cases of Paget’s disease of the vulva,
respectively. Three of these cases were of Paget’s
disease of the vulva with invasion. These results
may suggest involvement of aberrant activation of
the Wnt-signalling pathway in some cases of Paget’s
disease of the vulva.
E-cadherin Expression in Paget’s Disease of the Breast
The role of E-cadherin in breast cancers is debatable.
Reduced expression of E-cadherin has been reported
to be associated with poor outcome,
27
whereas other
investigators have demonstrated no independent
prognostic value for E-cadherin in breast carcino-
mas.
28,29
To our knowledge, only one study
21
has
examined the expression of E-cadherin in Paget’s
disease of the breast, and both cases were negative
for the protein. In contrast, in our larger study, 65%
of the Paget’s disease of the breast cases in our study
had 450% of Paget cells expressing E-cadherin. It is
therefore unlikely that reduced E-cadherin-
mediated cell–cell adhesion is an important factor
in the pathogenesis of Paget’s disease of the breast.
Plakoglobin Expression in Paget’s Disease of the Breast
Plakoglobin has not been examined in Paget’s
disease of the breast, although it has been examined
in primary breast carcinomas.
30–33
Loss of hetero-
zygosity and reduced expression of plakoglobin
associated with disease progression have been
demonstrated in breast cancer. In the current study,
only 17% of the cases of Paget disease of the breast
had 450% of Paget cells expressing plakoglobin.
This implicates a possible role for plakoglobin in the
formation of Paget’s disease of the breast. There was
good correlation between plakoglobin mRNA and
protein expression.
b-Catenin Expression in Paget’s Disease of the Breast
Few studies have sought to examine the role of
b-catenin in breast carcinomas,
30,31
and none have
examined b-catenin in Paget’s disease of the breast.
Forty-eight percent of our cases of Paget’s disease of
the breast had nuclear and paranuclear staining of
b-catenin protein. The extramembranous accumula-
tion could be due to mutation in the b-catenin gene
or its lack of degradation by the APC/GSK3b/
proteasome system. Except in one case, there was
good correlation between mRNA signal and protein
expression.
The adhesive function of cadherins is dependent
on their interaction with catenins. Some reports
have revealed reduced expression of both cadherins
and catenins in certain tumours, for example, oral
squamous cell carcinoma.
34
In the current study,
there appeared to be no correlation between reduced
expression of E-cadherin and b-catenin.
In summary, reduced expression of E-cadherin
may a have a role in the pathogenesis of Paget’s
disease of the vulva with invasive disease, unlike in
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1197
Modern Pathology (2008) 21, 11921199
Paget’s disease of the breast, where in the majority of
cases, normal expression of the protein was demon-
strated. Abnormal plakoglobin expression may be
involved in some cases of Paget’s disease of the
vulva and Paget’s disease of the breast. These results
suggest that there may be different mechanisms
underlying the aetiology of these two diseases, and
loss of cell–cell adhesion may be an important factor
in their development.
Acknowledgement
We thank the following for their assistance in
obtaining cases of Paget’s disease of the vulva and
Paget’s disease of the breast: Dr C Andrews (The
General Infirmary, Leeds), Dr S Andrews (Hope
Hospital, Manchester), Dr L Brown (Leicester Royal
Infirmary, Leicester), Dr E Courtauld (Farrer-Brown
Laboratory, London), Dr P Cross (Queen Elizabeth
Hospital, Gateshead), Dr A Desai (Whittington
Hospital, London), Dr R Dino (Queen Charlotte’s
and Chelsea Hospital, London), Dr A Flanagan
(St Mary’s Hospital, London), Dr J Johnson (Nottingham
City Hospital, Nottingham), Professor T Krauz
(Hammersmith Hospital, London), Dr S Lakhani
(University College London), Professor D Lowe
(St Bartholomew’s Hospital, London), Dr P Millard
(The John Radcliffe Hospital, Oxford), Dr N Nasseri
(The Royal Marsden Hospital, London), Dr J Smith
(The Northern General Hospital, Sheffield), Dr P
Trott (The London Clinic, London), Professor M
Wells (The Royal Hallamshire Hospital, Sheffield),
Dr G Wilson (Manchester Royal Infirmary, Manche-
ster), Dr M Young (St George’s Hospital, London).
Partial support for P Ellis came from the South Essex
Medical Education and Research Trust, UK.
Duality of interest
There was no duality of interest in this study.
References
1 Dubreuilh W. Paget’s disease of the vulva. Br J
Dermatol 1901;13:407–413.
2 Chanda JJ. Extramammary Paget’s disease: prognosis
and relationship to internal malignancy. J. Am Acad
Dermatol 1985;113:1009–10013.
3 Bohem F, Morris JMCL. Paget’s disease and apocrine
gland carcinoma. Obstet Gynaecol 1971;38:185–192.
4 Fox H, Wells M. Recent advances in the pathology of
the vulva. Histopathology 2003;42:209–216.
5 Paget J. On the disease of the mammary areola
preceding cancer of the mammary gland. St Bartholo-
mew Hospital Reports 1874;10:87–89.
6 Fu W, Lobocki C, Silberberg B, et al. Molecular markers
in Paget’s disease of the breast. J Surg Oncol
2001;77:171–178.
7 Shiozaki H, Tahara H, Oka H, et al. Expression of
immunoreactive E-cadherin adhesion molecules in
human cancers. Am J Pathol 1991;139:17–23.
8 Conman CR. Adhesiveness and stickiness: two inde-
pendent properties of the cell surface. Cancer Res
1961;21:1436–1438.
9 Takeichi M. Cadherin cell adhesion receptors as a
morphogenetic regulator. Science 1991;251:1451–
1455.
10 Behrens J, Mareel MM, Van Roy FM, et al. Dissecting
tumour cell invasion: epithelial cells acquire invasion
properties after the loss of uvomorulin-mediated cell–
cell adhesion. J Cell Biol 1989;108:2435–2447.
11 Vleminck K, Vakaet Jr L, Mareel M, et al. Genetic
manipulation of E-cadherin expression by epithelial
tumour cells reveals invasion suppressor role. Cell
1991;66:107–119.
12 Charpin C, Garcia S, Bonnier P, et al. Reduced
E-cadherin immunohistochemical expression in
node-negative breast carcinomas. Am J Clin Pathol
1997;109:431–438.
13 Fuller LC, Allen MH, Montesu M, et al. Expression of
E-cadherin in human epidermal non-melanoma cuta-
neous tumours. Br J Dermatol 1996;134:28–32.
14 Bringuier PP, Umbas R, Schaafsma E. Decreased
E-cadherin immunoreactivity correlates with poor
survival in patients with bladder tumours. Cancer
Res 1993;52:5104–5109.
15 Ben Zee’ev A, Geiger B. Differential molecular inter-
actions of beta-catenin and plakoglobin in adhesion,
signalling and cancer. Curr Opin Cell Biol
1998;10:629–639.
16 Barker N, Morin PJ, Clevers H. The Yin-Yang of TCF/
beta-catenin signalling. Adv Cancer Res 2000;77:
1–24.
17 Willert K, Nusse R. Beta-catenin: a key mediator of
Wnt signalling. Curr Opin Genet Dev 1998;8:95–102.
18 Ellis PE, Wong Te Fong LF, Rolfe KJ, et al. The role of
p53 and Ki67 in Paget’s disease of the vulva and breast.
Gynecol Oncol 2002;86:150–156.
19 Ellis PE, Wong Te Fong LF, Rolfe KJ, et al. The role of
vascular endothelial growth factor-A (VEGF-A) and
platelet-derived endothelial cell growth factor/thymi-
dine phosphorylase (PD-ECGF/TP) in Paget’s disease
of the vulva and breast. Anticancer Res 2002;22:857–
861.
20 Tada H, Hatoko M, Muramatsu T, et al. Expression of
E-cadherin in skin carcinomas. J Dermatol 1996;23:
104–110.
21 Shirahama S, Furukawa F, Wakita H, et al. E- and
P-cadherin expression in tumour tissues and soluble
E-cadherin levels in sera of patients with skin cancer.
J Dermatol Sci 1996;13:30–36.
22 Oka H, Shiozaki H, Kobayashi K, et al. Expression of
E-cadherin cell adhesion molecules in human breast
cancer tissues and its relationship to metastasis.
Cancer Res 1993;53:1696–1701.
23 Miyata M, Shiozaki H, Iihara K, et al. Relationship
between E-cadherin expression and lymph node
metastasis in human oesophageal cancer. Int J Oncol
1994;4:61–65.
24 Tada H, Hatoko M, Tanaka A, et al. Expression of
desmoglein I and plakoglobin in skin carcinomas.
qJ Cutan Pathol 2000;27:24–29.
25 Sparks PJ, Korinek V, Barker N, et al. Activation of
b-catenin–Tcf signalling in colon cancer by mutations
b-catenin or APC. Science 1994;275:1787–1790.
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1198
Modern Pathology (2008) 21, 11921199
26 Morin P, Sparks A, Korinek V, et al. Activation of
b-catenin–Tcf signalling in colon cancer by mutations
in b-catenin or APC. Science 1997;275:1787–1790.
27 Oka H, Shiozaki H, Kobayashi K, et al. Expression of
E-cadherin cell adhesion molecules in human breast
cancer tissues and its relationship to metastasis.
Cancer Res 1993;53:1696–1701.
28 Lipponen P, Saarelainen E, Ji H, et al. Expression of
E-cadherin (E-CD) as related to other prognostic factors
and survival in breast cancer. J Pathol 1998;174:101–
109.
29 Soler AP, Knudsen KA, Salazar H, et al. P-cadherin
expression in breast carcinomas indicate poor survival.
Cancer 1999;86:1263–1272.
30 Bukholm IK, Nesland JM, Karesen R, et al. E-cadherin
and a-, b- and g-catenin protein expression in relation
to metastasis in human breast carcinoma. J Pathol
1995;185:262–266.
31 Zschiesche W, Schonborn I, Behrens J, et al. Expres-
sion of E-cadherin and catenins in invasive mammary
carcinomas. Anticancer Res 1997;17:561–567.
32 Sommers CL, Gelmann EP, Kemler R, et al. Alterations
in beta-catenin phosphorylation and plakoglobin ex-
pression in human breast cancer cells. Cancer Res
1994;54:3544–3552.
33 Aberle H, Bierkamp C, Torchard D, et al. The human
plakoglobin gene localizes on chromosome 17q21 and is
subjected to loss of heterozygosity in breast and ovarian
cancers. Proc Natl Acad Sci USA 1995;92:6384–6388.
34 Muzio LO, Staibano S, Pannore G, et al. Beta and
gamma catenin expression in oral squamous cell
carcinoma. Anticancer Res 1999;19:3817–3826.
E-cadherin expression in Paget’s disease of the vulva and breast
PE Ellis et al
1199
Modern Pathology (2008) 21, 11921199
    • "We have demonstrated that the cell adhesion molecule E-cadherin is significantly reduced (P = 0.039) in Paget's disease of the vulva cases with invasive disease when compared with Paget's disease of the vulva cases without invasive disease. E-cadherin expression was normal in PDB and there was no difference between those cases of PDB with or without DCIS or invasive disease [44]. These findings and the results from this current study demonstrate the critical steps involved in the pathogenesis of PDB and PDV may occur by different mechanisms. "
    [Show abstract] [Hide abstract] ABSTRACT: Our understanding of the pathogenesis of Paget's disease of the vulva and the breast remains limited. Current evidence supports the fact that angiogenesis plays an important role in the pathogenesis of several diseases. Therefore, we sought to define its role, as correlated with microvessel density, in Paget's disease of the vulva and the breast. Microvessels were analysed using anti-von Willebrand factor antibody in 105 cases of Paget's disease of the vulva and the breast comprising 71 cases of Paget's disease of the vulva, including 8 cases with invasive disease, and 34 cases of Paget's disease of the breast. The latter included 12 cases with DCIS, 5 cases with both DCIS and invasive carcinoma, and 6 with carcinoma alone. Eleven cases had no underlying tumour identified. Increased microvessel density was demonstrated in Paget's disease of the breast with DCIS and with carcinoma alone compared to Paget's disease of the breast alone, P < 0.08 and P < 0.013, respectively. There were no significant differences in microvessel density in the vulval cases. Neovascularisation is an important process in the development of Paget's disease of the breast. Other biological and molecular processes are more involved in the pathogenesis of Paget's disease of the vulva.
    Full-text · Article · Mar 2012
  • [Show abstract] [Hide abstract] ABSTRACT: This article highlights the common vulval problems encountered in postmenopausal women. In addition, the physiological basis for some of these changes are discussed. An up-to-date review of the literature of common conditions highlights recent changes in the demography and management of sevaral of these common conditions. Conditions such as lichen sclerosis, lichen planus, contact dermatitis and atrophic vulvo-vaginitis have been discussed in some detail. However, information on vulval carcinoma has not been included. Recent developments in the treatment of vulval intraepithelial neoplasia, in addition to rare disorders such as Paget's disease of the vulva, have also been briefly mentioned.
    Article · Oct 2008
  • [Show abstract] [Hide abstract] ABSTRACT: There is a growing body of evidence suggesting that alterations in the adhesion properties of neoplastic cells endow them with an invasive and migratory phenotype. Indeed, changes in the expression or function of cell adhesion molecules have been implicated in all steps of tumor progression, including detachment of tumor cells from the primary site, intravasation into the blood stream, extravasation into distant target organs, and formation of the secondary lesions. This review presents recent data regarding the role of cell adhesion molecules in tumor development and progress with concern to their clinical exploitation as potential biomarkers in neoplastic diseases.
    Article · Dec 2009
Show more