Construction and Evaluation of a Clostridium thermocellum ATCC 27405 Whole-Genome Oligonucleotide Microarray

Article (PDF Available)inApplied biochemistry and biotechnology 137-140(1-12):663-74 · May 2007with46 Reads
DOI: 10.1007/s12010-007-9087-6 · Source: PubMed
Abstract
Clostridium thermocellum is an anaerobic, thermophilic bacterium that can directly convert cellulosic substrates into ethanol. Microarray technology is a powerful tool to gain insights into cellular processes by examining gene expression under various physiological states. Oligonucleotide microarray probes were designed for 96.7% of the 3163 C. thermocellum ATCC 27405 candidate protein-encoding genes and then a partial-genome microarray containing 70 C. thermocellum specific probes was constructed and evaluated. We detected a signal-to-noise ratio of three with as little as 1.0 ng of genomic DNA and only low signals from negative control probes (nonclostridial DNA), indicating the probes were sensitive and specific. In order to further test the specificity of the array we amplified and hybridized 10 C. thermocellum polymerase chain reaction products that represented different genes and found gene specific hybridization in each case. We also constructed a whole-genome microarray and prepared total cellular RNA from the same point in early-logarithmic growth phase from two technical replicates during cellobiose fermentation. The reliability of the microarray data was assessed by cohybridization of labeled complementary DNA from the cellobiose fermentation samples and the pattern of hybridization revealed a linear correlation. These results taken together suggest that our oligonucleotide probe set can be used for sensitive and specific C. thermocellum transcriptomic studies in the future.

Full-text (PDF)

Available from: Zhili He, Oct 03, 2014
Construction and Evaluation of a Clostridium
thermocellum ATCC 27405 Whole-Genome
Oligonucleotide Microarray
STEVEN
D. BROWN,
1
BABU
RAMAN,
2
CATHERINE
K.
M
CKEOWN,
2
SHUBHA P. KALE,
3
ZHILI HE,
1,4
AND JONATHAN
R. MIELENZ*
,2
1
Microbial Ecology and Physiology Group;
2
Bioconversion Science and
Technology Group, Biosciences Division, Oak Ridge National Laboratory,
Oak Ridge, TN, E-mail: mielenzjr@ornl.gov;
3
Department of Biology,
Xavier University of Louisiana, New Orleans, LA; and
4
Current address:
Institute of Environmental Genomics, Department of Botany
and Microbiology, University of Oklahoma, Norman, OK
Abstract
Clostridium thermocellum is an anaerobic, thermophilic bacterium that
can directly convert cellulosic substrates into ethanol. Microarray technol-
ogy is a powerful tool to gain insights into cellular processes by examining
gene expression under various physiological states. Oligonucleotide
microarray probes were designed for 96.7% of the 3163 C. thermocellum
ATCC 27405 candidate protein-encoding genes and then a partial-genome
microarray containing 70 C. thermocellum specific probes was constructed
and evaluated. We detected a signal-to-noise ratio of three with as little
as 1.0 ng of genomic DNA and only low signals from negative control
probes (nonclostridial DNA), indicating the probes were sensitive and spe-
cific. In order to further test the specificity of the array we amplified and
hybridized 10 C. thermocellum polymerase chain reaction products that rep-
resented different genes and found gene specific hybridization in each
case. We also constructed a whole-genome microarray and prepared total
cellular RNA from the same point in early-logarithmic growth phase from
two technical replicates during cellobiose fermentation. The reliability of
the microarray data was assessed by cohybridization of labeled comple-
mentary DNA from the cellobiose fermentation samples and the pattern of
hybridization revealed a linear correlation. These results taken together
suggest that our oligonucleotide probe set can be used for sensitive and
specific C. thermocellum transcriptomic studies in the future.
Index Entries: Biomass; cellulose; ethanol; fermentation; transcriptomics.
Applied Biochemistry and Biotechnology 663 Vol. 136–140, 2007
Copyright © 2007 by Humana Press Inc.
All rights of any nature whatsoever reserved.
0273-2289/1559–0291 (Online)/07/136–140/663–674/$30.00
*Author to whom all correspondence and reprint requests should be addressed.
Introduction
In 2004, 3.4 billion gal of ethanol was blended into gasoline, which
was approx 2% of gasoline sold in the United States by volume or 1.3%
(2.5 × 10
17
J) of its energy content (1). Transportation ethanol is derived
primarily from corn; however, there is need to develop an emerging
industry to produce ethanol from lignocellulosic biomass to meet
expected future demand (2). Because of the complexities of biomass,
extraction and hydrolysis of the cellulose requires thermochemical pre-
treatment of the biomass followed by the addition of enzymes needed to
hydrolyze these polymers to simple sugars that can be fermented to
ethanol by an added fermentative microorganism (3). However, a game-
changing technology is being developed for a process to simultaneously
convert the cellulosic component of biomass to end products with a
single processing step that consolidates cellulase enzyme production, cel-
lulose hydrolysis, and fermentation (4). Particularly important is that no
added cellulase enzymes are needed, thus avoiding the added cellulose
production costs, recently been reported in the range of 10–20 ¢/gal of
ethanol produced (5). Central to this consolidated bioprocessing
approach is a thermophilic (high-temperature) bacterium called Clostridium
thermocellum, which has the critical ability to produce its own cellulases
that permit it to very rapidly hydrolyze cellulose, using a structure
called the cellulosome, for growth and energy. In fact, C. thermocellum
exhibits the highest rate of cellulose hydrolysis known and as a result
the protein chemistry of this process has been extensively studied for
20 yr (6).
There has been significant for cellulosome structural biology, and cel-
lulose fermentation (6), however, little is known regarding key enzyme
expression levels that might be either bottlenecks or key catalytic steps
that will serve as targets for further metabolic engineering of this organism
to maximize ethanol yields from biomass. Therefore, this article outlines
initial progress aimed at investigating the intrinsic biology of this unique
organism, especially toward gene expression during cellobiose and cellu-
lose fermentation.
The application of microarray technology to study gene expression at
the level of whole transcriptome has been widely used for many years (7,8)
and more recently transcriptomic studies have been conducted in ethanolo-
genic bacteria and yeast (9–14). The availability of the 3.8 Mb C. thermocellum
genome sequence (http://genome.ornl.gov/microbial/cthe) predicted to
encode 3163 candidate protein-encoding genes permitted the development
of a whole-genome microarray, thus allowing the application of microarray
technology to investigate patterns of gene expression during fermentation
of cellulose to ethanol in C. thermocellum. As a first step, in this study, we
present the design, fabrication, and assessment of a whole-genome
microarray for C. thermocellum ATCC 27405.
664 Brown et al.
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Materials and Methods
Bacterial Strains, Culture Conditions, and Chemicals
C. thermocellum strain ATCC 27405 was a kind gift from Prof. Herb
Strobel, University of Kentucky, Lexington, KY. A 1 : 25 dilution of a fresh
overnight culture (16 h, optical density [OD
600
] approx 0.9) of C. thermocellum
was used to inoculate 2 L of MTC medium containing 5.0 g/L cellobiose
and 1.0 g/L yeast extract in a Braun BioStat B fermentor (Sartorius BBI
Systems Inc., Bethlehem, PA), essentially as described previously (15),
except that C. thermocellum was cultured at 58°C and pH 7.0 (controlled
through addition of 3 N NaOH) with an agitation of 250 rpm. Reagent grade
chemicals were obtained from Sigma (St. Louis, MO) unless indicated oth-
erwise. Cell free culture supernatants were analyzed by high-performance
liquid chromatography (Waters Corp, Milford, MA) to measure cellobiose,
acetate, lactate, and ethanol concentrations.
Whole-Genome DNA Microarray Construction and Design
of Polymerase Chain Reaction Primers
DNA sequences for the 3163 C. thermocellum ATCC 27405 predicted
protein-encoding genes were obtained from The Joint Genome Institute
(http://genome.ornl.gov/microbial/cthe/17nov03_obsolete/) using sequence
assembled in November 2003. Oligonucleotide probes that represented the
whole genome of C. thermocellum were designed using the CommOligo soft-
ware (16,17) and were commercially synthesized without modification (MWG
Biotech, High Point, NC) in 96-well plates. The concentration of the probes was
adjusted to 100 pmol/µL, transferred to 384-well printing plates in a final con-
centration of 50% dimethyl sulfoxide using a BioMek FX liquid handling robot
(Beckman-Coulter, Fullerton, CA) and then spotted onto UltraGAPS glass slides
(Corning Life Sciences, Corning, NY) using a BioRobotics Microgrid II microar-
rayer (Genomic Solutions, Ann Arbor, MI) in a dust-free clean room maintained
at 21°C and 50% relative humidity. Spotted DNA was stabilized on slides by
ultraviolet crosslinking using an Ultraviolet 1800 Stratalinker (Stratagene, La
Jolla, CA) according to slide manufacturer’s instructions (Corning Life
Sciences). A partial genome microarray that contained 16 replicates for 72 C.
thermocellum and control probes was constructed initially, and subsequently,
whole-genome microarrays were fabricated, which contained two replicates per
probe on each slide. The Primer3 software (http://frodo.wi.mit.edu/cgi-
bin/primer3/ primer3_www.cgi) was used to design primers to amplify gene
specific polymerase chain reaction (PCR) products for hybridizations.
Nucleic Acid Isolation and Preparation of Labeled
complementary DNA Targets
Early-exponential phase (OD
600
, 0.25) batch cultures were used
for RNA isolation. Total cellular RNA was isolated using a lysozyme
Construction and Evaluation of Clostridium thermocellum 665
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
coupled with TRIzol reagent (Invitrogen, Carlsbad, CA) treatment as
described previously (18). Precipitated RNA was further treated with
RNase-free DNase I (Qiagen, Valencia, CA) to digest any residual chro-
mosomal DNA, and subsequently purified with RNeasy Mini kit
according to the manufacturer’s instructions (Qiagen). C. thermocellum
genomic DNA was isolated using the DNeasy Tissue kit (Qiagen). The
concentration and purity of the extracted nucleic acids was deter-
mined at OD
260
and OD
280
with a NanoDrop ND-1000 spectropho-
tometer (NanoDrop Technologies, Wilmington, DE). Purified RNA was
used as the template to generate complementary DNA (cDNA) copies
labeled with either Cy3-dUTP or Cy5-dUTP (Amersham Biosciences,
Piscataway, NJ) and in a duplicate set of reactions the fluorescent Cy
dyes were reversed for the different technical replicates to analyze
dye-specific variations in hybridization signal intensity. Genomic
DNA and PCR products were labeled with Cy-3dUTP and Cy-5dUTP,
respectively, using a Bioprime Labeling kit (Invitrogen) with random-
primers and then purified using a Qiaquick PCR kit (Qiagen) (19). The
labeled and purified cDNA were then dried using the SDP1010
SpeedVac System (ThermoSavant, Holbrook, NY). The sequences for
the oligonucleotides used to amplify the probe-specific PCR products
are shown in Table 1.
Microarray Hybridization, Scanning, Image Quantification,
and Data Analysis
Preliminary microarray quality assessments were made by staining the
microarrays with a 1 : 1000 dilution of Syto61 dye (Invitrogen) pure con-
taining 10.0 µg/mL of bovine serum albumin (New England Biolabs,
Ipswich, MA) for 20 min at room temperature, followed by two 0.1X SSC
(Ambion, Austin, TX) washes. Hybridization and washing conditions for
oligonucleotide microarrays have been described elsewhere (20). Microarray
images were scanned using a ScanArray Express (PerkinElmer) scanner, and
spot signal, quality, and background fluorescent intensities were quantified
using ImaGene version 6.0 (Biodiscovery, Marina Del Rey, CA). Signal-to-
noise ratio were calculated as described previously (21) in Microsoft Excel,
and GeneSpring 7.0 (Agilent Technologies, Palo Alto, CA) was used to trans-
form microarray data with the locally weighted scatterplot smoothing method
of normalization and to remove poor/empty spots.
Results and Discussion
C. thermocellum Cellobiose Fermentations
Initially, we investigated the growth of C. thermocellum during
fermentation of cellobiose. Cells were grown in amended MTC medium
and growth was monitored for approx 12 h. Two independent experiments
666 Brown et al.
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Applied Biochemistry and Biotechnology 667 Vol. 136–140, 2007
Table 1
Oligonucleotides Used to Amplify Gene-Specific PCR Products
Number
a
Gene Forward primer (5’–3’) Reverse primer (5’–3’) Gene product
1 Ct3187 GCATAGGAACATCCCTGTGTG CATTGTCCACAGGAAGCAAG Phosphoglycerate kinase
2 Ct0462 GCTGTCAATTCCACTGCAAA CGCAATCGGCATATACAAAG Phosphotransacetylase
3 Ct0463 TCACAAGCTTGCCATACAGG CGGAGCCAGTTCAACACAAT Acetate kinase
4 Ct3150 GGACTTTTTCTGTGGCAAGG ACATTCCCCGTTTGTACAGG Iron-containing alcohol
dehydrogenase
5 Ct3185 TGTACAACAAACTGCCTTGCTC TGAGTTGCAGTTGTAGCGTGT Glyceraldehyde-3-phosphate
dehydrogenase
6 Ct3012 CGGGAGGAGAAGGTACCAG TTCAGAAGTTCAATAATATGCTCCA Nucleotidyl transferase
7 Ct1135 GTGGAGCTGCACACATATCG GCACCCGCAGTTTTAACATC L-lactate dehydrogenase
8 Ct2924 ATTATTGGCGAACACGGTGA AATCTGCTCCTCGCACTGAT
L-lactate dehydrogenase
9 Ct3589 TCGTTCTGCCTGAGAAACCT CCCCTTCGGCAACTATAACA 6-Phosphofructokinase
10 Ct3735 ACAGGGAAGAATTTkCGAGA TGGAATGAGTGGGAAAGCAT Glucose-6-phosphate
isomerase
a
Corresponds to labeled PCR targets in Fig. 3 and primer pairs that will be used for Q-PCR for genes involved in cellulose fermentation identi-
fied in Fig. 6.
based on culture turbidity measurements and high-performance liquid chro-
matography analysis of substrate (cellobiose) consumption and byprod-
uct (acetate and ethanol) formation, indicated that batch cultures of
C. thermocellum had typical bacterial growth cycle kinetics (Fig. 1). Total
cellular RNA was extracted from two technical replicates at the same
point in early-logarithmic growth phase during single cellobiose fermenta-
tion (Fig. 1).
C. thermocellum Microarray Probe Design
Unique 70-mer oligonucleotide probes were designed for 94.2% of the
3163 C. thermocellum candidate protein-encoding genes by the CommOligo
software (16). A further 10 probes were designed for groups of highly sim-
ilar genes, so that 96.7% of the putative coding sequences were repre-
sented and only 104 coding sequences remained unrepresented on the
whole-genome microarray. The C. thermocellum genome sequence contains a
large number of putative genes whose products are predicted to encode pro-
teins with transposon-related functions (22). Wherein sequences were highly
similar, such as for genes encoding proteins with transposon-related func-
tions, individual gene probes could not be designed. Group probes 1–10 rep-
resented putative hypothetical, transposase, transposase (IS116/IS110/IS902),
phage/plasmid primase P4, hypothetical, transposase (mutator type),
668 Brown et al.
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Fig. 1. C. thermocellum cellobiose fermentations. OD at 600 nm (OD
600
) (blue lines),
cellobiose (red lines), acetate (pink lines), and ethanol (green lines) concentration (g/L)
is plotted against fermentation time (h). Open and closed symbols correspond to data
from two independent fermentations. Arrow indicates sample harvest time for total
RNA isolation.
transposase (IS3/IS911), transposase (mutator type, transposase (IS30
family), and transposase proteins, respectively. The percentage of C. thermocel-
lum probes designed for the whole genome is similar to several recently con-
structed whole-genome microarrays for Desulfovibrio vulgaris (Hildenborough)
and Shewanella oneidensis MR-1, which had 98.6 and 94.3% probe coverage of
the genomes, respectively (20,23). The group probe design feature of
CommOligo enabled probes to be designed for highlyhomologous sequences,
thus extending the fraction of gene expression comparisons that will be able
to be made in the future.
Microarray Probe Specificity and Sensitivity
Initially, a subset of the whole-genome microarray probes was tested
for sensitivity and specificity by producing partial-genome microarrays that
contained 70 C. thermocellum probes representing the range of functional
diversity in the predicted gene products. The DNA stain Syto61 was used to
assess the quality of the partial-genome microarrays and to confirm signal
was observed from negative control probes (Fig. 2A). PCR products designed
to hybridize to individual probes that represented specific genes were labeled
with Cy-5 and hybridized to the partial array to confirm signal specificity of
the designed oligonucleotide probes (Fig. 2B). In each case the 10-labeled
PCR products gave signal-to-noise ratios of more than three, or positive for
probe-target hybridization interaction (24), whereas only low values and
SNRs below three were observed from negative control probes (Fig. 3).
The hybridization of different amounts of C. thermocellum genomic
DNA labeled with Cy-dye to C. thermocellum partial microarrays showed
that as little as 1.0 ng of genomic DNA could be labeled and give signal-to-
noise ratios more than three (Fig. 4). A signal-to-noise ratio more than three
is a general criterion considered as the minimum probe signal necessary that
can be quantified accurately (24). Our results were in keeping with other
studies (25,26) and were indicative of the C. thermocellum microarray probes
Construction and Evaluation of Clostridium thermocellum 669
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Fig. 2. Specificity of C. thermocellum microarray probes. C. thermocellum partial-genome
microarray stained with nonspecific Syto61 dye for DNA (A) and hybridized with
gDNA labeled with Cy3 dye (green), which hybridizes to all C. thermocellum probes and
Ct3187 PCR product labeled with Cy5 dye (red) that hybridizes to replicates of Ct3187
probe (B).
670 Brown et al.
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Fig. 3. Hybridization of PCR products for specific C. thermocellum genes to partial-
genome microarray. Signal-to-noise ratios for gene-specific probes: 1, Ct3187; 2,
Ct0462; 3, Ct0463; 4, Ct3150; 5, Ct3185; 6, Ct3012; 7, Ct1135; 8, Ct2924; 9, Ct3589; 10,
Ct3735; and 11, remaining C. thermocellum probes. Primer sequences used to amplify
PCR products and probe descriptions are given in Table 1.
Fig. 4. Hybridization of C. thermocellum genomic DNA to C. thermocellum partial
microarray. Average of all C. thermocellum probes, and regression plot; negative
control 1, ; negative control 2, .
Construction and Evaluation of Clostridium thermocellum 671
being sensitive as well as specific. In order to further assess the reliability of
the microarray data we constructed a whole-genome microarray and cohy-
bridized cDNA prepared from total cellular RNA extracted from two tech-
nical replicates from the same C. thermocellum cellobiose fermentation in
early-logarithmic growth phase. The pattern of hybridization revealed a lin-
ear relationship between the samples and 97.4% of the genes fell within a
twofold threshold after data normalization and poor/empty spot removal
by GeneSpring (Fig. 5). This value may be further improved on in future
studies, as one potential source of variation was average incorporation of
the Cy-dye, which was less than 1 pmol/µL of purified target DNA. In this
experiment only three of the 1708 genes were slightly outside the bounds of
a threefold change in expression value between samples. Overall, the results
described above suggest our oligonucleotide probe set can be used for sen-
sitive and specific C. thermocellum transcriptomic studies in the future.
Conclusion
To our knowledge this is the first whole-genome microarray for a
thermophile capable of converting cellulose to ethanol in a consolidated
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Fig. 5. Scatterplot of whole-genome microarray data. The upper and lower green
lines represent twofold levels of differential expression and the middle green line
represents no change in expression.
process. The PCR products shown in Table 1 were chosen not only to verify
the quality of the C. thermocellum microarray, but also for future quantitative-
PCR primer analysis of key genes in the pathway from cellulose to the
final metabolic end products of ethanol, lactic acid, and acetic acid (Fig. 6).
672 Brown et al.
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
Fig. 6. Metabolic pathway for conversion of cellulose to ethanol, lactic acid, and
acetic acid. The numbered genes correspond to PCR products in Table 1 and their loca-
tion in this metabolic pathway.
Future transcriptomics using the whole-genome microarray will provide
insight into the expression genes whose products are thought to be important
for cellulose fermentation and also potentially provide insight into the roles
of other genes whose importance cannot be inferred by a priori assumptions.
Interestingly, such experiments will answer questions whether both genomic
copies of lactate dehydrogenase are expressed (Table 1, genes 7 and 8) or if
transcription occurs from only one locus during fermentation of either cel-
lobiose and/or cellulose. Information on these and other genes contribut-
ing to or detracting from the pathway for ethanol production will be
invaluable as the complexities of C. thermocellum metabolic circuits are
unraveled. In conclusion, the application of transcriptomic profiling, along
with other molecular biology tools and physiological studies offer the
opportunity to better understand fundamental biology of ethanologenic
bacteria and the potential for improved production of ethanol.
Acknowledgments
Research sponsored by the Laboratory Directed Research and
Development Program of Oak Ridge National Laboratory (ORNL), managed
by UT-Battelle, LLC for the US Department of Energy under Contract
No. DE-AC05-00OR22725. S.P.K was supported by the DOE Faculty
Sabbatical Program sponsored by the DOE Office of Science. We thank Liyou
Wu for assistance with microarray printing.
Note Added in Proof
As this paper was going to press, the C. thermocellum ATCC 27405
genome was closed and finished. The finished genome sequence can be found
at http://genome.jgi.psf.org/finished_microbes/cloth/cloth.home.html.
References
1. Davis, S. C. and Diegel, S. W. (2004), In: Transportation Energy Data Book: Technical Report
No. ORNL-6973. Oak Ridge National Laboratory, Oak Ridge, TN.
2. http://www.ethanolrfa.org/industry/locations/. Accessed March 19, 2007.
3. Mielenz, J. R. (2001), Curr. Opin. Microbiol. 4, 324–329.
4. Lynd, L. R., van Zyl, W. H., McBride, J. E., and Laser, M. (2005), Curr. Opin. Biotechnol.
16, 577–583.
5. Greer, D. (2005), Biocycle 46, 61–65.
6. Lynd, L. R., Weimer, P. J., van Zyl, W. H., and Pretorius, I. S. (2002), Microbiol. Mol. Biol.
Rev. 66, 506–577.
7. DeRisi, J., Penland, L., Brown, P. O., et al. (1996), Nat. Genet. 14, 457–460.
8. Schena, M., Shalon, D., Heller, R., Chai, A., Brown, P. O., and Davis, R. W. (1996), Proc.
Natl. Acad. Sci. USA 93, 10,614–10,619.
9. Sonderegger, M., Jeppsson, M., Hahn-Hagerdal, B., and Sauer, U. (2004), Appl. Environ.
Microbiol. 70, 2307–2317.
10. Tomas, C. A., Welker, N. E., and Papoutsakis, E. T. (2003), Appl. Environ. Microbiol. 69,
4951–4965.
11. Sedlak, M., Edenberg, H. J., and Ho, N. W. Y. (2003), Enzyme Microbial Technol. 33, 19–28.
Construction and Evaluation of Clostridium thermocellum 673
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
12. Jewett, M. C., Oliveira, A. P., Patil, K. R., and Nielsen, J. (2005), Biotech. Bioprocess Eng. 10,
385–399.
13. Wahlbom, C. F., Otero, R. R. C., van Zyl, W. H., Hahn-Hägerdal, B., and Jonsson, L. J.
(2003), Appl. Environ. Microbiol. 69, 740–746.
14. Salusjärvi, L., Pitkänen, J. -P., Aristidou, A., Ruohonen, L., and Penttilä, M. (2006), Appl.
Biochem. Biotechnol. 128, 237–274.
15. Zhang, Y. -H. P. and Lynd, L. R. (2005), J. Bacteriol. 187, 99–106.
16. Li, X., He, Z., and Zhou, J. (2005), Nucleic Acids Res. 33, 6114–6123.
17. Bozdech, Z., Zhu, J., Joachimiak, M. P., Cohen, F. E., Pulliam, B., and DeRisi, J. L.
(2003), Genome Biol. 4, R9.
18. Tomas, C. A., Alsaker, K. V., Bonarius, H. P. J., et al. (2003), J. Bacteriol. 185, 4539–4547.
19. Pollack, J. R., Perou, C. M., Alizadeh, A. A., et al. (1999), Nat. Genet. 23, 41–46.
20. Chhabra, S. R., He, Q., Huang, K. H., et al. (2006), J. Bacteriol. 188, 1817–1828.
21. Tiquia, S. M., Chong, S. C., Fields, M. W., and Zhou, J. (2004), In: Molecular Microbial
Ecology Manual, Kowalchuk, G. A., de Bruijn, F. J., Head, I. M., Lakkennans, A. D., and
van Elsas, J. D. (eds.), Kluwer Academic Publishers, Dordrecht, The Netherlands, pp.
1743–1763.
22. http://genome.ornl.gov/microbial/cthe/.
23. Gao, H. C., Wang, Y., Liu, X. D., et al. (2004), J. Bacteriol. 186, 7796–7803.
24. Verdnik, D., Handran, S., and Pickett, S. (2002), In: DNA image analysis: Nuts & bolts,
Kamberova, G. (ed.), DNA Press, Salem, MA, pp. 89–98.
25. Tiquia, S. M., Wu, L., C. Chong, S. C., et al. (2004), BioTechniques 36, 664–675.
26. He, Z. L., Wu, L. Y., Li, X. Y., Fields, M. W., and Zhou, J. Z. (2005), Appl. Environ.
Microbiol. 71, 3753–3760.
674 Brown et al.
Applied Biochemistry and Biotechnology Vol. 136–140, 2007
    • "CelA (Cthe_0269) is a GH8 endoglucanase. It is one of the most abundantly transcribed and secreted proteins in C. thermocellum during growth on cellulosic substrates (Brown et al., 2007; Gold and Martin, 2007; Raman et al., 2011; Riederer et al., 2011). Analysis of the crystal structure of the enzyme suggested that the substrate binding channel was optimally configured to bind a cellopentaose molecule (Alzari et al., 1996). "
    [Show abstract] [Hide abstract] ABSTRACT: Chemically synthesized nanostructure-initiator mass spectrometry (NIMS) probes derivatized with tetrasaccharides were used to study the reactivity of representative Clostridium thermocellum β-glucosidase, endoglucanases, and cellobiohydrolase. Diagnostic patterns for reactions of these different classes of enzymes were observed. Results show sequential removal of glucose by the β-glucosidase and a progressive increase in specificity of reaction from endoglucanases to cellobiohydrolase. Time-dependent reactions of these polysaccharide-selective enzymes were modeled by numerical integration, which provides a quantitative basis to make functional distinctions among a continuum of naturally evolved catalytic properties. Consequently, our method, which combines automated protein translation with high-sensitivity and time-dependent detection of multiple products, provides a new approach to annotate glycoside hydrolase phylogenetic trees with functional measurements.
    Full-text · Article · Oct 2015
    • "The scaffoldin also includes a special type of dockerin domain (type II dockerin) for the attachment of the cellulosome to a complementary type of non-cellulosomal cohesin (type II), which is positioned on the cell surface via cell-surface anchoring proteins [16,35,49]. Regulation studies by us212223 and others [17,46474853,58] demonstrated that in C. thermocellum the expression level and the composition of the cellulosomal proteins vary with the availability of the carbon source (cellobiose) and the presence of extracellular plant cell wall derived polysaccharides [14,31,37,41424347]. Somewhat surprisingly, C. thermocellum is capable of growing efficiently only on b-glucans (b-1,4 and b-1,3 glucans), utilizing mainly cellodextrins (derived from cellulose) although it encodes and regulates numerous hemicellulolytic genes, whose end products (mainly five-carbon sugars) cannot enter the cell [39]. "
    [Show abstract] [Hide abstract] ABSTRACT: Clostridium thermocellum efficiently degrades crystalline cellulose by a high molecular weight protein complex, the cellulosome. The bacterium regulates its cellulosomal genes using a unique extracellular biomass-sensing mechanism that involves alternative sigma factors and extracellular carbohydrate-binding modules attached to intracellular anti-sigma domains. In this study, we identified three cellulosomal xylanase genes that are regulated by the σ(I6)/RsgI6 system by utilizing sigI6 and rsgI6 knockout mutants together with primer extension analysis. Our results indicate that cellulosomal genes are expressed from both alternative σ(I6) and weak σ(A) vegetative promoters. Copyright © 2015. Published by Elsevier B.V.
    Full-text · Article · Aug 2015
    Andy SandAndy SandEvert K HolwerdaNatalie M RuppertsbergerNatalie M Ruppertsberger+8 more authors ...Yuval ShohamYuval Shoham
    • "Original experiments indicated the presence of additional putative cellulosomal enzyme components [18] and scaffoldins [19] which were probed by the ScaC cohesin but were never fully identified. The expansion of genome sequencing efforts during the past decade has also provided information regarding several cellulosome-producing bacteria23242526 , and their genomewide comparison has spawned the field of cellulosomics [5], i.e., a general overview of cellulosome-related constituents of a given bacterium. The recent sequencing of the A. cellulolyticus genome [22] has thus enabled identification and analysis of numerous additional cellulosomal components, gene regulatory elements, and cell anchoring modules in the bacterium, as documented in this communication. "
    [Show abstract] [Hide abstract] ABSTRACT: Microbial degradation of plant cell walls and its conversion to sugars and other byproducts is a key step in the carbon cycle on Earth. In order to process heterogeneous plant-derived biomass, specialized anaerobic bacteria use an elaborate multi-enzyme cellulosome complex to synergistically deconstruct cellulosic substrates. The cellulosome was first discovered in the cellulolytic thermophile, Clostridium thermocellum, and much of our knowledge of this intriguing type of protein composite is based on the cellulosome of this environmentally and biotechnologically important bacterium. The recently sequenced genome of the cellulolytic mesophile, Acetivibrio cellulolyticus, allows detailed comparison of the cellulosomes of these two select cellulosome-producing bacteria. Comprehensive analysis of the A. cellulolyticus draft genome sequence revealed a very sophisticated cellulosome system. Compared to C. thermocellum, the cellulosomal architecture of A. cellulolyticus is much more extensive, whereby the genome encodes for twice the number of cohesin- and dockerin-containing proteins. The A. cellulolyticus genome has thus evolved an inflated number of 143 dockerin-containing genes, coding for multimodular proteins with distinctive catalytic and carbohydrate-binding modules that play critical roles in biomass degradation. Additionally, 41 putative cohesin modules distributed in 16 different scaffoldin proteins were identified in the genome, representing a broader diversity and modularity than those of Clostridium thermocellum. Although many of the A. cellulolyticus scaffoldins appear in unconventional modular combinations, elements of the basic structural scaffoldins are maintained in both species. In addition, both species exhibit similarly elaborate cell-anchoring and cellulosome-related gene- regulatory elements. This work portrays a particularly intricate, cell-surface cellulosome system in A. cellulolyticus and provides a blueprint for examining the specific roles of the various cellulosomal components in the degradation of complex carbohydrate substrates of the plant cell wall by the bacterium.
    Full-text · Article · May 2012
Show more